Growing Number Of COVID-19 Deaths Among Vaccinated People: Federal Data

Authors: Katabella Roberts via The Epoch Times MY 13, 2022

An increasing number of COVID-19 deaths are occurring among individuals in the United States who have been vaccinated, according to federal data.

In August of 2021, roughly 18.9 percent of COVID-19 deaths happened among individuals who were vaccinated, an ABC News analysis of the data shows. Six months later in February 2022, that figure had risen to over 40 percent as the highly-transmissible Omicron variant made its way across the globe.

Similarly, in September 2021, just 1.1 percent of COVID-19 deaths occurred among Americans who had been fully vaccinated and boosted once. Five months later in February, that percentage had jumped to about 25 percent, according to ABC News.

A separate analysis of federal data by CNN shows that in the second half of September 2021—when the Delta variant was at its peak—less than a quarter of all COVID-19 deaths were among individuals who were vaccinated with at least two doses of the Moderna or Pfizer/BioNTech mRNA vaccines or a single dose of the Johnson & Johnson vaccine. However, just months later in January and February as Omicron surged, that figure had jumped to 40 percent.

Some experts believe the increase in deaths among fully vaccinated people or “breakthrough infections” in those who have received all their shots is not overly concerning, saying it is because while more and more people become fully vaccinated, new variants emerge and vaccine protection begins to wane as fewer people continue to get booster shots.

These data should not be interpreted as vaccines not working. In fact, these real-world analyses continue to reaffirm the incredible protection these vaccines afford especially when up to date with boosters,” said John Brownstein, an epidemiologist at Boston Children’s Hospital and an ABC News contributor.

Despite an increasing number of deaths among the vaccinated, the Centers for Disease Control and Prevention (CDC) states that vaccines are safe and effective. Data from the government agency says that overall, the risk of death from COVID-19 is roughly five times higher in unvaccinated individuals than in those who have had at least their initial dose of a vaccine.

However, in some cases, serious adverse events such as thrombosis with thrombocytopenia syndrome (blood clots), myocarditis (inflammation of the heart muscle), and pericarditis (inflammation of the outer lining of the heart) have been documented.

As of May 4, around 257.9 million people in the United States, or 77.7 percent of the total population in the nation have received at least one dose of vaccine, while roughly 219.9 million people, or 66.2 percent of the total U.S. population, have been fully vaccinated.

Around 100.9 million of those who are fully vaccinated have received a booster shot, while 49.4 percent of those eligible for booster shots have not yet had one.

As the Omicron variant swept through the nation, an increasing number of vulnerable, older populations were being hospitalized, and 73 percent of deaths have been among those 65 and older, despite the fact that 90 percent of seniors have had all of their vaccine shots.

However, a large percentage—a third of them—have not yet had their booster jab.

“This trend in increased risk among the elderly further supports the need for community-wide immunization,” Brownstein said. “Older populations, especially those with underlying conditions, continue to be at great risk of severe complications, especially as immunity wanes. The best way to protect them is to make sure everyone around them is fully immunized.”

The data comes a month after pharmaceutical and biotechnology company Moderna said that preliminary results from its study on a COVID-19 vaccine intended to protect against variants showed that it outperformed the company’s currently authorized booster shot, mRNA-1273.

Moderna said on April 19 that its mRNA-1273.211 shot, its first bivalent booster vaccine candidate, showed “superiority” against the Beta, Delta, and Omicron variants of the virus one month after being administered, compared to the booster shot of its original vaccine currently in use.

Exclusive: Pilots Injured by COVID Vaccines Speak Out: ‘I Will Probably Never Fly Again’

Authors: MICHAEL NEVRADAKIS  MAY 8, 2022 The Epoch Times Originally Published Children’s Defense Fund

In interviews with The Defender, pilots injured by COVID-19 vaccines said despite a “culture of fear and intimidation” they are compelled to speak out against vaccine mandates that rob pilots of their careers — and in some cases their lives.

As a commercial pilot, Bob Snow had long looked forward to seeing his daughter follow in his footsteps by helping her learn to fly an airplane.

However, having received the COVID-19 vaccine “under duress,” this dream is no longer a possibility for Snow.

“I will probably never fly again,” Snow said in a video he made about his story. “I was hoping to teach my daughter to fly. She wants to be a pilot. That will probably never happen, all courtesy of the vaccine.”

Snow is one of a growing number of pilots coming forward to share stories of injuries they experienced after getting a COVID-19 vaccine.

Some of these accounts are “hair-raising and deeply disturbing,” according to Maureen Steele, a paralegal and head of media relations for the John Pierce Law Firm.

The firm represents U.S. Freedom Flyers (USFF), an organization opposing vaccine and mask mandates for pilots and airline staff, in a series of legal actions against the U.S. Federal Aviation Administration (FAA) and several airlines.

Josh Yoder, a pilot with a major commercial airline, Army combat veteran and former flight medic, is a co-founder of USFF.

In a recent interview with The Defender, Yoder said the FAA has been aware of cases of pilots suffering vaccine injuries since at least December 2021, when the California-based Advocates for Citizens’ Rights hand-delivered an open letter to the FAA, major airlines and their insurers.

Yoder said USFF “has received hundreds of phone calls from airline employees who are experiencing adverse reactions post COVID-19 vaccination,” describing the stories as “heartbreaking.”

According to Yoder, the warnings contained in the letter, including testimony by “world-renowned experts,” were “completely ignored,” adding that “we are now beginning to see the consequences.”

This is leading an increasing number of pilots to “come forward to expose the truth regarding these toxic injections,” Yoder said.

The Defender recently reported on a series of reports that have been submitted to the Vaccine Adverse Event Reporting System, or VAERS, involving pilots who sustained severe injuries and side effects following the COVID-19 vaccine.

Congressional testimony from Cody Flint, an agricultural pilot who has logged more than 10,000 flight hours, was included in this letter.

“The FAA has created a powder keg and lit the fuse,” Flint said in an interview with The Defender.

“We are now seeing pilots experiencing blood clots, myocarditis, pericarditis, dizziness and confusion at rates never seen before. Pilots are losing their careers and having to call in sick or go on medical leave from medical issues developing almost immediately after vaccination.”

Vaccine-Injured Pilots Share Stories With the Defender

Several pilots, including Bob Snow, shared their stories with The Defender in a recent series of interviews.

Snow, a captain with a major U.S. airline, told The Defender he received the Johnson & Johnson COVID-19 vaccine on Nov. 4, 2021, “as a result of an unambivalent company mandate to receive the vaccine or be terminated.”

According to Snow, he “began experiencing issues a little over two months” after receiving the vaccine. Due to a history of gastroenteritis, he underwent an endoscopy and an abdominal CT scan.

The results of the endoscopy were normal and Snow was awaiting the results of the CT scan when he suffered cardiac arrest on April 9, immediately after landing at Dallas-Forth Worth International Airport.

As Snow described it:

“I was very lucky to have collapsed when and where I did, as the aircraft was shut down at the gate post-flight and care was immediately provided.

“There was absolutely no warning preceding my collapse in the cockpit. It was literally as if someone ‘pulled the plug.’”

After receiving CPR and AED (automated external defibrillator) shocks to be revived, Snow spent almost a week in the hospital, where he was diagnosed with having sustained sudden cardiac arrest (SCA).

Medical studies indicate survival rates for out-of-hospital SCA cases are estimated at 10.8% to 11.4%.

Snow said:

“Needless to say, that’s not an encouraging number and I feel very, very lucky to have survived.

“Had this happened in a hotel, in flight, at home or almost anywhere else, I do not believe I would be here right now.”

Snow said prior to this incident, he had “no history of prior significant cardiac issues,” based on two EKGs (electrocardiograms) per year for each of the previous 10 years — none of which, according to Snow, “provided any indication of incipient issues that might lead to cardiac arrest.”

“I have no known family history to indicate a predisposition to developing significant cardiac issues at this point in my life,” Snow added.

Snow has been recuperating at home since April 15, while awaiting more tests that will provide a prognosis for his long-term survival.

However, it is likely that he will never fly again in any capacity.

Snow said, “[f]or now, it appears my flying career — indeed, likely all flying as a pilot —  has come to a rapid and unexpected conclusion as SCA is a red flag to FAA medical certification.”

This, according to Snow, has resulted “in a significant loss of income and lifestyle,” adding that he has a college student and high school student at home and a non-working spouse who relied on his livelihood.

‘Last Thing I Remember Is . . . Praying I Would Make It’

Like Snow, Cody Flint had no prior medical history to indicate he was at risk.

“I have been extremely healthy my whole life with no underlying conditions,” said Flint, adding:

“As a pilot that held a second-class medical [certification], I was required to get a yearly FAA flight physical to show I was healthy enough to safely operate an airplane.

“I have renewed my medical every year since I was 17. The last FAA medical I received was on January 19, 2021. The medical showed I was perfectly healthy just 10 days before receiving the COVID-19 vaccine.”

Flint got his first (and only) dose of the Pfizer COVID-19 vaccine on Feb. 1, 2021. He told The Defender:

“Within 30 minutes, I developed a severe burning headache at the base of my skull and blurred vision. After a few hours, the pain was constant, but didn’t seem to be getting worse. I thought the pain would go away, eventually. It did not.”

Two days later began his seasonal job as an agricultural pilot, which typically runs from February to October of each year, Flint said.

He said:

“Approximately one hour into my flight, I felt my condition starting to rapidly decline and I was developing severe tunnel vision. I pulled my airplane up to turn around to head home and immediately felt an extreme burst of pressure in my skull and ears.”

Flint initially considered landing on a nearby highway, unsure he’d make it back to the airstrip, but chose not to so as not to put the public in danger.

Instead, according to Flint:

“The last thing I remember is seeing our airstrip from a few miles out and praying I would make it.

“Later, my coworkers told me I landed and immediately stopped my plane. They described me as being unresponsive, shaking and slumped over in my seat … I do not remember landing or being pulled from the plane.”

Flint said various doctors, including his longtime hometown doctor, refused to consider that his recent COVID-19 vaccination caused his symptoms. Instead, he was prescribed Meclizine for vertigo and Xanax for panic attacks.

According to Flint, doctors told him he would be “completely better within two days.” But two days later, Flint “could barely walk without falling over.”

Seeking a second opinion, Flint visited the Ear & Balance Institute in Louisiana, where he was diagnosed with left and right perilymphatic fistulas (a lesion in the inner ear), and highly elevated intracranial pressure due to swelling in his brainstem.

As Flint described it, “[m]y intracranial pressure had risen so high that it caused both of my inner ears to ‘blow out.’” Doctors told him this is usually caused by major head trauma.

“Obviously, I did not have head trauma,” said Flint. “What I did have, though, was an unapproved and experimental ‘vaccine’ just two days prior to suffering this bodily damage.”

“My doctors [at the Ear & Balance Institute] clearly stated my health issues were a direct result of a severe adverse reaction to the Pfizer COVID-19 vaccine,” he added.

Flint says he now cannot receive renewed medical certification from the FAA due to the injuries he sustained, the physical condition he is currently in and “the fact that I will be on the FAA-unapproved medicine Diamox for the foreseeable future.”

Like Snow, Flint believes “it is … highly unlikely that I’ll ever be able to fly again,” adding, “On most days, I am too dizzy to even safely drive a vehicle.”

Greg Pierson, like Snow and Flint, shared a similar story. A commercial pilot with a major U.S. airline that is also a federal contractor, he was mandated to get vaccinated.

Pierson told The Defender:

“I felt extremely pressured to consider getting vaccinated, even though I am adamant against any mandates that violate personal freedom choices.

“I did research and consulted several medical professionals regarding the associated risks.

“I have never had a flu shot in my lifetime, so this was not something I wanted to do. I reluctantly received the first dose of the Pfizer vaccine on August 26, 2021.”

For Pierson, the onset of symptoms was almost immediate, beginning “approximately 14 hours” after receiving the vaccine, when he experienced “an extremely erratic and highly elevated heart rate.”

Pierson visited a local emergency room, where he was diagnosed with atrial fibrillation. His condition was stabilized and he was soon discharged, though he remained on medication to help his heart return to a normal rhythm.

While Pierson says he has not experienced any further episodes, he nevertheless still has not been cleared to return to the cockpit.

“I successfully passed all the required protocols to re-obtain my certification that will allow me to return to work,” he said, adding the FAA has had his records and test results since Feb. 16, but he still hasn’t received a determination.

“I have been on disability since this occurrence, and combined with the leave, the personal and financial impacts have been significant,” Pierson said.

Pierson also described a similar experience to that of Flint, regarding the attitudes of some medical professionals regarding the possibility that his condition was brought on by the COVID-19 vaccine.

“When I brought the subject up to the ER cardiologist, that it was obvious what triggered my onset, she simply stated ‘s*it happens,’” Pierson said.

Widow Describes Husband’s Last Days

Snow, Flint and Pierson are fortunate in that they have managed to survive, even if their flying careers are in jeopardy.

But other pilots have not been so lucky.

American Airlines pilot Wilburn Wolfe suffered a major seizure following his COVID-19 vaccination, which cost him his life. Fortunately, Wolfe was not on duty when his seizure hit.

Claudia Wolfe, his widow, shared her late husband’s story with The Defender.

Wolfe, a former Marine just a few years from retirement, “was definitely against getting this vaccine but was put in the position to take it or lose his job as a captain,” Claudia Wolfe said.

He received the Johnson & Johnson vaccine on Nov. 9, 2021.

Claudia Wolfe told The Defender:

“[The] first 10 days were without any event … [on] day 11, it started with a migraine-like headache which got better that afternoon after taking a couple of aspirin.

“Unfortunately, the migraine came back and he was hoping that it’s nothing else but a migraine.

“On November 22, 13 days after the COVID vaccine, he had a seizure. When paramedics arrived and my husband came out of the seizure, he was paralyzed on his right side, arm and leg, and was taken to the emergency room.”

At the emergency room, a CT scan showed he was experiencing brain bleeding, and he was admitted into intensive care. There, according to Claudia Wolfe, “he continued to have convulsions on his right hand … shortly after he was admitted, he had another seizure and doctors decided to sedate him and put him on a ventilator.”

“That was the last time I talked to my husband, before the seizure in the ICU,” Claudia Wolfe said.

Wolfe never regained consciousness and died on Nov. 26, 2021 — only 17 days after receiving the COVID-19 vaccine. Even if he had survived, he likely would not have been able to work as a pilot again.

As Claudia Wolfe explained:

“Doctors told me that he couldn’t work as a pilot anymore because he would have to be on seizure medication.

“But as the bleeding continued to spread I was told that he probably would not recognize me or his family and he probably would need a 24-hour facility to help him.

“This man was so strong and never needed a doctor, he was never sick enough to need one, and [he] just had a physical a couple months prior for his job as a pilot.”

Pilots Describe Culture of Fear and Reluctance to Come Forward

Pilots who spoke to The Defender described a culture of intimidation that has led to many of their colleagues fearing professional or personal consequences if they speak publicly about injuries following COVID-19 vaccination.

According to Yoder, “Many pilots and other airline employees capitulated to the tactics of threats, harassment and intimidation perpetrated by the very companies they serve.”

Yoder described airlines, as well as aviation industry unions, as “state actors” illegally “working in lockstep with the U.S. government” to “enforce unconstitutional mandates via a culture of fear.”

Snow told The Defender several of his colleagues shared stories of vaccine injuries with him:

“Since my SCA I have heard from several other airline personnel regarding potential vaccine injuries up to and including cardiac issues (chest pain and myocarditis).

“Many crewmembers are very reluctant to divulge potential significant health issues for fear of losing their FAA medical certification and, potentially, their careers.”

According to Snow, such fear exists “due to both concern for one’s career and also the fear of being portrayed as a vaccine skeptic.”

“There seems to be genuine reluctance on the part of corporations, businesses, government and the medical community in general to acknowledge the potential for COVID vaccine injury,” Snow said.

Claudia Wolfe also shared her experience, stating that following her husband’s death, she learned “of others that died after the COVID vaccine,” adding that “not many talk about it or believe this vaccine can harm or kill you.”

Pierson also expressed concerns, telling The Defender, “Some things I have stated publicly could have consequences in this regard.”

This culture of intimidation appears to extend beyond just accusations of being a “vaccine skeptic.”

Steele described incidents of airline employees’ non-work and online activities seemingly being monitored by their employers, who are then using this as a justification to question or harass those employees.

“I believe the airlines have people on staff that must be trolling the social media of employees and when they find a conservative, or someone they believe to be, they attack,” Steele said.

Steele said female employees appear to be particular targets of the airlines, as they “appear to be isolated and intimidated for hours on end.”

Flint connected incidents such as those described above to political interests, telling The Defender the FAA approved COVID-19 vaccines for pilots just two days after the U.S. Food and Drug Administration (FDA) issued its first Emergency Use Authorization (EUA) for such vaccines, on Dec. 10, 2020.

“I thought to myself, how could the FAA analyze the data and determine it was safe for pilots in just two days, when it took the FDA months to go over the trial data?” Flint said.

Flint said that was an especially jarring development, in light of the increased risk that pilots and cabin crew face:

“I was also extremely curious to know how the FAA is so certain that this vaccine will be safe for pilots when it’s obvious that Pfizer did not do a trial solely on pilots to find out if it would cause some of the serious health problems that immediately started to show up once the mass vaccination campaign [began].”

In the process, Flint stated, the FAA violated its own regulations.

Under the Guide for Aviation Medical Examiners: Pharmaceuticals (Therapeutic Medications) Do Not Issue – Do Not Fly, the FAA has a long-standing rule that states:

“FAA requires at least one year of post-marketing experience with a new drug before consideration for aeromedical certification purposes. This observation allows time for uncommon, but aeromedically significant, adverse reactions to manifest themselves.”

Flint said it “became painfully obvious” the FAA issued this guidance based not on science or safety, but political reasons.

“Why did the FAA abandon its own rules by encouraging pilots to take a brand-new experimental drug?” Flint asked. “This action by the FAA was totally unprecedented and extremely dangerous.”

Providing an example of such danger, Flint said, “it is now widely reported that mRNA COVID-19 vaccines can cause blood clots,” adding that several peer-reviewed studies going back more than a decade “show pilots are approximately 60% more likely to experience blood clots due to the ‘nature of the job.’”

Supporting this assertion, on May 5, the FDA announced that it would restrict who could receive doses of the Johnson & Johnson COVID-19 vaccine, due to the risk of blood clots.

Pierson also believes politics are at play in the medical community, telling The Defender even his longtime doctor told the FAA, in paperwork aimed at restoring Pierson’s suspended medical certification, that “it is impossible for the vaccine to have caused” his condition, though “he could not provide any explanation for an alternative hypothesis” — a stance Pierson characterized as “medical malpractice.”

Such politics are also found in professional organizations within the aviation industry, according to Pierson, who described his experience with one such entity:

“I approached the medical division of ALPA, the Air Line Pilots Association, to which I am a member, and presented them with data to substantiate my concerns.

“It was initially seemingly a concerned, open dialogue, which quickly was dismissed at the highest levels.”

Legal Actions to Follow Against the FAA, Federal Agencies, Airlines

The USFF, according to Yoder, is currently pursuing several legal actions related to the vaccine injuries that pilots and air staff are increasingly reporting.

He told The Defender:

“The U.S. Freedom Flyers have always taken a strong stance against the threats of government and corporate totalitarianism.

“We are filing massive, individual plaintiff lawsuits against the FAA, DOT [U.S. Department of Transportation] and commercial airlines to hold them accountable for the criminal and civil atrocities they’ve committed against our members.

“We will not rest until justice is served and constitutional American freedom is restored.”

Steele added:

“We are teeing up lawsuits for all the major airlines, with thousands of potential plaintiffs on our plaintiff lists.

“We also are going to be holding the FAA and the [U.S. Department of Transportation] accountable for their part in this atrocity.”

Steele said USFF “will be seeking retribution and restitution for these crimes against humanity,” mirroring remarks made by Pierson, who described the actions taken in the name of the pandemic as “nothing short of the highest crimes against humanity ever.”

According to Steele, unions are, in part, responsible for the injuries being sustained by pilots and other employees, as a result of their acceptance of vaccine mandates.

“Unfortunately the unions — from all industries — have let their members down,” Steele told The Defender. “They simply are rolling over and are in bed with the state and the corporations.”

Flint, in turn, assigned a significant amount of blame to the federal agencies:

“The FAA has failed at its duties in the most spectacular fashion, causing pilots to lose their lives, livelihoods and careers.

“The federal government, including the FAA, has not helped one single person injured by the COVID-19 vaccine.

“They [the federal agencies] have not publicly acknowledged there is a problem. They haven’t even so much as adjusted their ‘guidance’ to prevent this from happening in the future.”

Are Passengers at Risk From Pilot Vaccine Mandates?

When Snow suffered cardiac arrest, it occurred only a few minutes after he had landed a commercial airliner, full of passengers, at one of the most heavily trafficked airports in the U.S.

This begs the question: Are passengers — and the public at large — at risk due to potential adverse effects that may impact vaccinated pilots during flight?

According to Pierson, there is indeed a risk of a “catastrophic” incident:

“I became an outspoken critic of the vaccines after my injury, and due to becoming much more knowledgeable of all the potential health and safety risks from the vaccines.

“It became very clear to me that the implications of having an immediate, severe adverse reaction could be catastrophic if actively piloting an aircraft.”

Flint believes such a disaster may be an inevitability.

“It is only a matter of time before a pilot has a medically significant event from an adverse reaction to this [COVID-19] vaccine and crashes an airliner, killing a few hundred American citizens in the process.”

He added:

“When will the FAA finally do the right thing by trying to adhere to its own mission statement, which is ‘to provide the safest, most efficient aerospace system in the world’?

“How many more pilots have to die or be severely injured before the FAA acknowledges the horrible and dangerous problem it has created?”

In addition to the risk of a disaster involving casualties among passengers and the general public, the difficulties that pilots are experiencing as a result of vaccine-related adverse reactions are creating other disruptions for the airline industry and the flying public, such as flight cancellations and delays.

Yoder described this as a “ripple effect”:

“Vaccine mandates are having a ripple effect in the aviation industry that will continue for years to come.

“Pilot shortages were a concern pre-mandate, [and] have now been amplified due to early retirements and medical disqualification due to certain adverse vaccine reactions which prohibit pilots from maintaining medical certification.”

Pilots, Advocates Describe Importance of Speaking Out

The pilots, legal professionals and advocates who spoke to The Defender all expressed their hope that by speaking out and sharing their stories and experiences, they will make a difference.

Snow said:

“I hope to shine the spotlight on the potential for significant safety issues that exist within the airlines, commercial vehicles/transportation, and other safety-sensitive work that might be affected by [the] sudden onset of health issues that could be attributed to the COVID vaccines.

“It is in our collective best interest that real research and data analysis be undertaken to address this potentially dangerous situation.

“Why is there such a reluctance to investigate these EUA COVID vaccines which are still being aggressively marketed to, if not outright forced upon, the global public?”

Snow went on to discuss the history of unsafe drugs and therapies that had initially received FDA approval and the importance of “clinical and scientific studies to evaluate the possibility of injuries and deaths” instead of “parroting the marketing mantra ‘safe and effective.’”

Flint described the FAA’s handling of the issue as “one of the most glaring instances of incompetence and corruption I have ever witnessed,” adding that “the Pfizer COVID-19 vaccine has taken nearly everything from myself and my family … my health and my career have been taken from me.”

He added that due to his inability to fly, he is facing mounting debt and unpaid taxes, with an income “20% of what it was before vaccination.”

Steele, who also organized the People’s Convoy, expressed her view that “[t]he only way to push back on the government and corporate overstep is demanding accountability … to hold these policymakers unequivocally accountable.”

She specifically referenced the importance of pursuing legal claims, telling The Defender:

“The only way to ensure it never happens again is to hit them in the pocketbook … In doing so, the awarded damages will also assist the victims of these policies that have been so grievously harmed.”

Yoder described the resistance he has observed to such private and government mandates, saying that “Americans have rallied in defiance to the totalitarian dictators dubbed ‘government,’” adding that “American patriots will never succumb to totalitarianism.”

Steele drew upon her experience with the People’s Convoy to share her own observation of wide public opposition to such mandates, while expressing a message of hope:

“My greatest takeaway and the most refreshing finding on the Convoy was that patriotism is alive and well in our great country.

“The American people have had it with the nonsense with the overstepping, with the ‘PC police,’ the degrading of morality in our country. They are simply over it and looking for actionable items that they can do.

“They want to see accountability. They want to see our country restored … It is important for people to know they are absolutely not alone. In fact, we are the majority.”

Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line

Current Issues In Molecular Biology

Authors: Markus Aldén 1 , Francisko Olofsson Falla 1 , Daowei Yang 1 , Mohammad Barghouth 1 , Cheng Luan 1 , Magnus Rasmussen 2 and Yang De Marinis 1,*

Abstract: Preclinical studies of COVID-19 mRNA vaccine BNT162b2, developed by Pfizer and
BioNTech, showed reversible hepatic effects in animals that received the BNT162b2 injection.
Furthermore, a recent study showed that SARS-CoV-2 RNA can be reverse-transcribed and integrated into the genome of human cells. In this study, we investigated the effect of BNT162b2 on the human liver cell line Huh7 in vitro. Huh7 cells were exposed to BNT162b2, and quantitative PCR was performed on RNA extracted from the cells. We detected high levels of BNT162b2 in Huh7 cells and changes in gene expression of long interspersed nuclear element-1 (LINE-1), which is an endogenous reverse transcriptase. Immunohistochemistry using antibody binding to LINE-1 open reading frame-1 RNA-binding protein (ORFp1) on Huh7 cells treated with BNT162b2 indicated increased nucleus distribution of LINE-1. PCR on genomic DNA of Huh7 cells exposed to BNT162b2 amplified the DNA sequence unique to BNT162b2. Our results indicate a fast up-take of BNT162b2 into human liver cell line Huh7, leading to changes in LINE-1 expression and distribution. We also show that BNT162b2 mRNA is reverse transcribed intracellularly into DNA in as fast as 6 h upon BNT162b2 exposure.

Introduction
Coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2) was announced by the World Health Organization (WHO)
as a global pandemic on 11 March 2020, and it emerged as a devasting health crisis.
As of February 2022, COVID-19 has led to over 430 million reported infection cases and
5.9 million deaths worldwide [1]. Effective and safe vaccines are urgently needed to reduce the morbidity and mortality rates associated with COVID-19. Several vaccines for COVID-19 have been developed, with particular focus on mRNA vaccines (by Pfizer-BioNTech and Moderna), replication-defective recombinant adenoviral vector vaccines (by Janssen-Johnson and Johnson, Astra-Zeneca, Sputnik-V, and CanSino), and inactivated vaccines (by Sinopharm, Bharat Biotech and Sinovac). The mRNA vaccine has the advantages of being flexible and efficient in immunogen design and manufacturing, and currently, numerous vaccine candidates are in various stages of development and application. Specifically, COVID-19 mRNA vaccine BNT162b2 developed by Pfizer and BioNTech has been evaluated in successful clinical trials [2–4] and administered in national COVID-19 vaccination campaigns in different regions around the world [5–8]. BNT162b2 is a lipid nanoparticle (LNP)–encapsulated, nucleoside-modified RNA vaccine (modRNA) and encodes the full-length of SARS-CoV-2 spike (S) protein, modified by two proline mutations to ensure antigenically optimal pre-fusion conformation, which mimics the intact virus to elicit virus-neutralizing antibodies [3]. Consistent with randomized clinical trials, BNT162b2 showed high efficiency in a wide range of COVID-19-related outcomes in a real-world setting [5]. Nevertheless, many challenges remain, including monitoring for long-term safety and efficacy of the vaccine. This warrants further evaluation and investigations. The safety profile of BNT162b2 is currently only available from short-term clinical studies. Less common adverse effects of BNT162b2 have been reported, including pericarditis, arrhythmia, deep-vein thrombosis, pulmonary embolism, myocardial infarction, intracranial hemorrhage, and thrombocytopenia [4,9–20]. There are also studies that report adverse effects observed in other types of vaccines [21–24]. To better understand mechanisms underlying vaccine-related adverse effects, clinical investigations as well as cellular and molecular analyses are needed. A recent study showed that SARS-CoV-2 RNAs can be reverse-transcribed and integrated into the genome of human cells [25]. This gives rise to the question of if this may also occur with BNT162b2, which encodes partial SARS-CoV-2 RNA. In pharmacokinetics data provided by Pfizer to European Medicines Agency (EMA), BNT162b2 biodistribution was studied in mice and rats by intra-muscular injection with radiolabeled LNP and luciferase modRNA. Radioactivity was detected in most tissues from the first time point (0.25 h), and results showed that the injection site and the liver were the major sites of distribution, with maximum concentrations observed at 8–48 h post-dose [26]. Furthermore, in animals that received the BNT162b2 injection, reversible hepatic effects were observed, including enlarged liver, vacuolation, increased gamma glutamyl transferase (γGT) levels, and increased levels of aspartate transaminase (AST) and alkaline phosphatase (ALP) [26]. Transient hepatic effects induced by LNP delivery systems have been reported previously [27–30], nevertheless, it has also been shown that the empty LNP without modRNA alone does not introduce any significant liver injury [27]. Therefore, in this study, we aim to examine the effect of BNT162b2 on a human liver cell line in vitro and investigate if BNT162b2 can be reverse transcribed into DNA through endogenous mechanisms.

Materials and Methods 2.1.

Cell Culture Huh7 cells (JCRB Cell Bank, Osaka, Japan) were cultured in 37 ◦C at 5% CO2 with DMEM medium (HyClone, HYCLSH30243.01) supplemented with 10% (v/v) fetal bovine serum (Sigma-Aldrich, F7524-500ML, Burlington, MA, USA) and 1% (v/v) PenicillinStreptomycin (HyClone, SV30010, Logan, UT, USA). For BNT162b2 treatment, Huh7 cells were seeded with a density of 200,000 cells/well in 24-well plates. BNT162b2 mRNA vaccine (Pfizer BioNTech, New York, NY, USA) was diluted with sterile 0.9% sodium chloride injection, USP into a final concentration of 100 µg/mL as described in the manufacturer’s guideline [31]. BNT162b2 suspension was then added in cell culture media to reach final concentrations of 0.5, 1.0, or 2.0 µg/mL. Huh7 cells were incubated with or without BNT162b2 for 6, 24, and 48 h. Cells were washed thoroughly with PBS and harvested by trypsinization and stored in −80 ◦C until further use. 2.2. REAL-TIME RT-QPCR RNA from the cells was extracted with RNeasy Plus Mini Kit (Qiagen, 74134, Hilden, Germany) following the manufacturer’s protocol. RT-PCR was performed using RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, K1622, Waltham, MA, USA) following the manufacturers protocol. Real-time qPCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, K0222, Waltham, MA, USA) with primers for BNT162b2, LINE-1 and housekeeping genes ACTB and GAPDH (Table 1). Curr. Issues Mol. Biol. 2022, 44 1117 Table 1. Primer sequences of RT-qPCR and PCR. Target Sequence ACTB forward CCTCGCCTTTGCCGATCC ACTB reverse GGATCTTCATGAGGTAGTCAGTC GAPDH forward CTCTGCTCCTCCTGTTCGAC GAPDH reverse TTAAAAGCAGCCCTGGTGAC LINE-1 forward TAACCAATACAGAGAAGTGC LINE-1 reverse GATAATATCCTGCAGAGTGT BNT162b2 forward CGAGGTGGCCAAGAATCTGA BNT162b2 reverse TAGGCTAAGCGTTTTGAGCTG 2.3. Immunofluorescence Staining and Confocal Imaging Huh7 cells were cultured in eight-chamber slides (LAB-TEK, 154534, Santa Cruz, CA, USA) with a density of 40,000 cells/well, with or without BNT162b2 (0.5, 1 or 2 µg/mL) for 6 h. Immunohistochemistry was performed using primary antibody anti-LINE-1 ORF1p mouse monoclonal antibody (Merck, 3574308, Kenilworth, NJ, USA), secondary antibody Cy3 Donkey anti-mouse (Jackson ImmunoResearch, West Grove, PA, USA), and Hoechst (Life technologies, 34850, Carlsbad, CA, USA), following the protocol from Thermo Fisher (Waltham, MA, USA). Two images per condition were taken using a Zeiss LSM 800 and a 63X oil immersion objective, and the staining intensity was quantified on the individual whole cell area and the nucleus area on 15 cells per image by ImageJ 1.53c. LINE-1 staining intensity for the cytosol was calculated by subtracting the intensity of the nucleus from that of the whole cell. All images of the cells were assigned a random number to prevent bias. To mark the nuclei (determined by the Hoechst staining) and the whole cells (determined by the borders of the LINE-1 fluorescence), the Freehand selection tool was used. These areas were then measured, and the mean intensity was used to compare the groups. 2.4. Genomic DNA Purification, PCR Amplification, Agarose Gel Purification, and Sanger Sequencing Genomic DNA was extracted from cell pellets with PBND buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20) according to protocol described previously [32]. To remove residual RNA from the DNA preparation, RNase (100 µg/mL, Qiagen, Hilden, Germany) was added to the DNA preparation and incubated at 37 ◦C for 3 h, followed by 5 min at 95 ◦C. PCR was then performed using primers targeting BNT162b2 (sequences are shown in Table 1), with the following program: 5 min at 95 ◦C, 35 cycles of 95 ◦C for 30 s, 58 ◦C for 30 s, and 72 ◦C for 1 min; finally, 72 ◦C for 5 min and 12 ◦C for 5 min. PCR products were run on 1.4% (w/v) agarose gel. Bands corresponding to the amplicons of the expected size (444 bps) were cut out and DNA was extracted using QIAquick PCR Purification Kit (Qiagen, 28104, Hilden, Germany), following the manufacturer’s instructions. The sequence of the DNA amplicon was verified by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany). Statistics Statistical comparisons were performed using two-tailed Student’s t-test and ANOVA. Data are expressed as the mean ± SEM or ± SD. Differences with p < 0.05 are considered significant. 2.5. Ethical Statements The Huh7 cell line was obtained from Japanese Collection of Research Bioresources (JCRB) Cell Bank.

Results

BNT162b2 Enters Human Liver Cell Line Huh7 Cells at High Efficiency
To determine if BNT162b2 enters human liver cells, we exposed human liver cell
line Huh7 to BNT162b2. In a previous study on the uptake kinetics of LNP delivery in
Huh7 cells, the maximum biological efficacy of LNP was observed between 4–7 h [33].
Therefore, in our study, Huh7 cells were cultured with or without increasing concentrations
of BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6, 24, and 48 h. RNA was extracted from cells
and a real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR)
was performed using primers targeting the BNT162b2 sequence, as illustrated in Figure 1.
The full sequence of BNT162b2 is publicly available [34] and contains a two-nucleotides cap;
50 untranslated region (UTR) that incorporates the 50-UTR of a human α-globin gene; the
full-length of SARS-CoV-2 S protein with two proline mutations; 30-UTR that incorporates
the human mitochondrial 12S rRNA (mtRNR1) segment and human AES/TLE5 gene segment with two C→U mutations; poly(A) tail. Detailed analysis of the S protein sequence in BNT162b2 revealed 124 sequences that are 100% identical to human genomic sequences and three sequences with only one nucleotide (nt) mismatch in 19–26 nts (Table S1, see Supplementary Materials). To detect BNT162b2 RNA level, we designed primers with forward primer located in SARS-CoV-2 S protein regions and reverse primer in 30-UTR,which allows detection of PCR amplicon unique to BNT162b2 without unspecific binding of the primers to human genomic regions.

Discussion
In this study we present evidence that COVID-19 mRNA vaccine BNT162b2 is able
to enter the human liver cell line Huh7 in vitro. BNT162b2 mRNA is reverse transcribed
intracellularly into DNA as fast as 6 h after BNT162b2 exposure. A possible mechanism for reverse transcription is through endogenous reverse transcriptase LINE-1, and the nucleus protein distribution of LINE-1 is elevated by BNT162b2. Intracellular accumulation of LNP in hepatocytes has been demonstrated in vivo [36]. A preclinical study on BNT162b2 showed that BNT162b2 enters the human cell line HEK293T cells and leads to robust expression of BNT162b2 antigen [37]. Therefore, in this study, we first investigated the entry of BNT162b2 in the human liver cell line Huh7 cells. The choice of BNT162b2 concentrations used in this study warrants explanation. BNT162b2 is administered as a series of two doses three weeks apart, and each dose contains 30 µg of BNT162b2 in a volume of 0.3 mL, which makes the local concentration at the injection site at the highest 100 µg/mL [31]. A previous study on mRNA vaccines against H10N8 and H7N9 influenza viruses using a similar LNP delivery system showed that the mRNA vaccine can distribute rather nonspecifically to several organs such as liver, spleen, heart, kidney, lung, and brain, and the concentration in the liver is roughly 100 times lower than that of the intra-muscular injection site [38]. In the assessment report on BNT162b2 provided to EMA by Pfizer, the pharmacokinetic distribution studies in rats demonstrated that a relatively large proportion (up to 18%) of the total dose distributes to the liver [26]. We therefore chose to use 0.5, 1, and 2 µg/mL of vaccine in our experiments on the liver cells. However, the effect of a broader range of lower and higher concentrations of BNT162b2 should also be verified in future studies. In the current study, we employed a human liver cell line for in vitro investigation. It is worth investigating if the liver cells also present the vaccine-derived SARS-CoV-2 spike protein, which could potentially make the liver cells targets for previously primed spike protein reactive cytotoxic T cells. There has been case reports on individuals who developed autoimmune hepatitis [39] after BNT162b2 vaccination. To obtain better under-standing of the potential effects of BNT162b2 on liver function, in vivo models are desired for future studies. In the BNT162b2 toxicity report, no genotoxicity nor carcinogenicity studies have been provided [26]. Our study shows that BNT162b2 can be reverse transcribed to DNA in liver cell line Huh7, and this may give rise to the concern if BNT162b2-derived DNA may be integrated into the host genome and affect the integrity of genomic DNA, which may potentially mediate genotoxic side effects. At this stage, we do not know if DNA reverse transcribed from BNT162b2 is integrated into the cell genome. Further studies are needed to demonstrate the effect of BNT162b2 on genomic integrity, including whole genome sequencing of cells exposed to BNT162b2, as well as tissues from human subjects who received BNT162b2 vaccination. Human autonomous retrotransposon LINE-1 is a cellular endogenous reverse transcriptase and the only remaining active transposon in humans, able to retrotranspose itself and other nonautonomous elements [40,41], and ~17% of the human genome are comprised of LINE-1 sequences [42]. The nonautonomous Alu elements, short, interspersed nucleotide elements (SINEs), variable-number-of-tandem-repeats (VNTR), as well as cellular mRNA-processed pseudogenes, are retrotransposed by the LINE-1 retrotransposition proteins working in trans [43,44]. A recent study showed that endogenous LINE-1 mediates reverse transcription and integration of SARS-CoV-2 sequences in the genomes of infected human cells [25]. Further-more, expression of endogenous LINE-1 is often increased upon viral infection, including SARS-CoV-2 infection [45–47]. Previous studies showed that LINE-1 retrotransposition activity is regulated by RNA metabolism [48,49], DNA damage response [50], and autophagy [51]. Efficient retro-transposition of LINE-1 is often associated with cell cycle and nuclear envelope breakdown during mitosis [52,53], as well as exogenous retroviruses [54,55], which promotes entrance of LINE-1 into the nucleus. In our study, we observed increased LINE-1 ORF1p distribution as determined by immunohistochemistry in the nucleus by BNT162b2 at all concentrations tested (0.5, 1, and 2 µg/mL), while elevated LINE-1 gene expression was detected at the highest BNT162b2 concentration (2 µg/mL). It is worth noting that gene transcription is regulated by chromatin modifications, transcription factor regulation, and the rate of RNA degradation, while translational regulation of protein involves ribosome recruitment on the initiation codon, modulation of peptide elongation, termination of protein synthesis, or ribosome biogenesis. These two processes are controlled by different mechanisms, and therefore they may not always show the same change patterns in response to external challenges. The exact regulation of LINE-1 activity in response to BNT162b2 merits further study. The cell model that we used in this study is a carcinoma cell line, with active DNA replication which differs from non-dividing somatic cells. It has also been shown that Huh7 cells display significant different gene and protein expression including upregulated proteins involved in RNA metabolism [56]. However, cell proliferation is also active in several human tissues such as the bone marrow or basal layers of epithelia as well as during embryogenesis, and it is therefore necessary to examine the effect of BNT162b2 on genomic integrity under such conditions. Furthermore, effective retrotransposition of LINE-1 has also been reported in non-dividing and terminally differentiated cells, such as human neurons [57,58]. The Pfizer EMA assessment report also showed that BNT162b2 distributes in the spleen (<1.1%), adrenal glands (<0.1%), as well as low and measurable radioactivity in the ovaries and testes (<0.1%) [26]. Furthermore, no data on placental transfer of BNT162b2 is available from Pfizer EMA assessment report. Our results showed that BNT162b2 mRNA readily enters Huh7 cells at a concentration (0.5 µg/mL) corresponding to 0.5% of the local injection site concentration, induce changes in LINE-1 gene and protein expression, and within 6 h, reverse transcription of BNT162b2 can be detected. It is therefore important to investigate further the effect of BNT162b2 on other cell types and tissues both in vitro and in vivo. 5. Conclusions Our study is the first in vitro study on the effect of COVID-19 mRNA vaccine BNT162b2 on human liver cell line. We present evidence on fast entry of BNT162b2 into the cells and subsequent intracellular reverse transcription of BNT162b2 mRNA into DNA.

Supplementary Materials: The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/cimb44030073/s1.

Author Contributions: M.A., F.O.F., D.Y., M.B. and C.L. performed in vitro experiments. M.A. and F.O.F. performed data analysis. M.R. and Y.D.M. contributed to the implementation of the research, designed, and supervised the study. Y.D.M. wrote the paper with input from all authors. All authors have read and agreed to the published version of the manuscript.

Funding: This study was supported by the Swedish Research Council, Strategic Research Area Exodiab, Dnr 2009-1039, the Swedish Government Fund for Clinical Research (ALF) and the foundation of Skåne University Hospital. Institutional Review Board Statement: Not applicable.

Informed Consent Statement: Not applicable.

Data Availability Statement: All data supporting the findings of this study are available within the article and supporting information.

Acknowledgments: The authors thank Sven Haidl, Maria Josephson, Enming Zhang, Jia-Yi Li, Caroline Haikal, and Pradeep Bompada for their support to this study

References

  1. World Health Organization. Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on
    22 February 2022).
  2. Mulligan, M.J.; Lyke, K.E.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Raabe, V.; Bailey, R.; Swanson, K.A.; et al.
    Phase I/II study of COVID-19 RNA vaccine BNT162b1 in adults. Nature 2020, 586, 589–593. [CrossRef] [PubMed]
  3. Walsh, E.E.; Frenck, R.W., Jr.; Falsey, A.R.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Mulligan, M.J.;
    Bailey, R.; et al. Safety and Immunogenicity of Two RNA-Based COVID-19 Vaccine Candidates. N. Engl. J. Med. 2020, 383,
    2439–2450. [CrossRef] [PubMed]
  4. Polack, F.P.; Thomas, S.J.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Perez, J.L.; Perez Marc, G.; Moreira, E.D.; Zerbini, C.; et al.
    Safety and Efficacy of the BNT162b2 mRNA COVID-19 Vaccine. N. Engl. J. Med. 2020, 383, 2603–2615. [CrossRef] [PubMed]
  5. Harris, R.J.; Hall, J.A.; Zaidi, A.; Andrews, N.J.; Dunbar, J.K.; Dabrera, G. Effect of Vaccination on Household Transmission of
    SARS-CoV-2 in England. N. Engl. J. Med. 2021, 385, 759–760. [CrossRef]
  6. Butt, A.A.; Omer, S.B.; Yan, P.; Shaikh, O.S.; Mayr, F.B. SARS-CoV-2 Vaccine Effectiveness in a High-Risk National Population in a
    Real-World Setting. Ann. Intern. Med. 2021, 174, 1404–1408. [CrossRef]
  7. Dagan, N.; Barda, N.; Kepten, E.; Miron, O.; Perchik, S.; Katz, M.A.; Hernan, M.A.; Lipsitch, M.; Reis, B.; Balicer, R.D. BNT162b2
    mRNA Covid-19 Vaccine in a Nationwide Mass Vaccination Setting. N. Engl. J. Med. 2021, 384, 1412–1423. [CrossRef]
  8. Rossman, H.; Shilo, S.; Meir, T.; Gorfine, M.; Shalit, U.; Segal, E. COVID-19 dynamics after a national immunization program in
    Israel. Nat. Med. 2021, 27, 1055–1061. [CrossRef]
  9. Fan, B.E.; Shen, J.Y.; Lim, X.R.; Tu, T.M.; Chang, C.C.R.; Khin, H.S.W.; Koh, J.S.; Rao, J.P.; Lau, S.L.; Tan, G.B.; et al. Cerebral venous
    thrombosis post BNT162b2 mRNA SARS-CoV-2 vaccination: A black swan event. Am. J. Hematol. 2021, 96, E357–E361. [CrossRef]
  10. Larson, K.F.; Ammirati, E.; Adler, E.D.; Cooper, L.T., Jr.; Hong, K.N.; Saponara, G.; Couri, D.; Cereda, A.; Procopio, A.; Cavalotti, C.; et al.
    Myocarditis After BNT162b2 and mRNA-1273 Vaccination. Circulation 2021, 144, 506–508. [CrossRef]
  11. Menni, C.; Klaser, K.; May, A.; Polidori, L.; Capdevila, J.; Louca, P.; Sudre, C.H.; Nguyen, L.H.; Drew, D.A.; Merino, J.; et al. Vaccine
    side-effects and SARS-CoV-2 infection after vaccination in users of the COVID Symptom Study app in the UK: A prospective
    observational study. Lancet Infect. Dis. 2021, 21, 939–949. [CrossRef]
  12. Hansen, T.; Titze, U.; Kulamadayil-Heidenreich, N.S.A.; Glombitza, S.; Tebbe, J.J.; Rocken, C.; Schulz, B.; Weise, M.; Wilkens, L.
    First case of postmortem study in a patient vaccinated against SARS-CoV-2. Int. J. Infect. Dis. 2021, 107, 172–175. [CrossRef]
    [PubMed]
  13. Kadali, R.A.K.; Janagama, R.; Peruru, S.; Malayala, S.V. Side effects of BNT162b2 mRNA COVID-19 vaccine: A randomized,
    cross-sectional study with detailed self-reported symptoms from healthcare workers. Int. J. Infect. Dis. 2021, 106, 376–381.
    [CrossRef] [PubMed]
  14. Parkash, O.; Sharko, A.; Farooqi, A.; Ying, G.W.; Sura, P. Acute Pancreatitis: A Possible Side Effect of COVID-19 Vaccine. Cureus
    2021, 13, e14741. [CrossRef] [PubMed]
  15. Mazzatenta, C.; Piccolo, V.; Pace, G.; Romano, I.; Argenziano, G.; Bassi, A. Purpuric lesions on the eyelids developed after
    BNT162b2 mRNA COVID-19 vaccine: Another piece of SARS-CoV-2 skin puzzle? J. Eur. Acad. Dermatol. Venereol. 2021, 35,
    e543–e545. [CrossRef]
  16. Lee, E.J.; Cines, D.B.; Gernsheimer, T.; Kessler, C.; Michel, M.; Tarantino, M.D.; Semple, J.W.; Arnold, D.M.; Godeau, B.;
    Lambert, M.P.; et al. Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination. Am. J. Hematol. 2021, 96, 534–537.
    [CrossRef]
  17. Ishay, Y.; Kenig, A.; Tsemach-Toren, T.; Amer, R.; Rubin, L.; Hershkovitz, Y.; Kharouf, F. Autoimmune phenomena following
    SARS-CoV-2 vaccination. Int. Immunopharmacol. 2021, 99, 107970. [CrossRef]
  18. Das, B.B.; Kohli, U.; Ramachandran, P.; Nguyen, H.H.; Greil, G.; Hussain, T.; Tandon, A.; Kane, C.; Avula, S.; Duru, C.; et al.
    Myopericarditis following mRNA COVID-19 Vaccination in Adolescents 12 through 18 Years of Age. J. Pediatr. 2021, 238, 26–32.e1.
    [CrossRef]
  19. McLaurin-Jiang, S.; Garner, C.D.; Krutsch, K.; Hale, T.W. Maternal and Child Symptoms Following COVID-19 Vaccination Among
    Breastfeeding Mothers. Breastfeed. Med. 2021, 16, 702–709. [CrossRef]
  20. Barda, N.; Dagan, N.; Ben-Shlomo, Y.; Kepten, E.; Waxman, J.; Ohana, R.; Hernan, M.A.; Lipsitch, M.; Kohane, I.; Netzer, D.; et al.
    Safety of the BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Setting. N. Engl. J. Med. 2021, 385, 1078–1090. [CrossRef]
  21. Baden, L.R.; El Sahly, H.M.; Essink, B.; Kotloff, K.; Frey, S.; Novak, R.; Diemert, D.; Spector, S.A.; Rouphael, N.; Creech, C.B.; et al.
    Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N. Engl. J. Med. 2021, 384, 403–416. [CrossRef]
  22. Sadoff, J.; Gray, G.; Vandebosch, A.; Cardenas, V.; Shukarev, G.; Grinsztejn, B.; Goepfert, P.A.; Truyers, C.; Fennema, H.;
    Spiessens, B.; et al. Safety and Efficacy of Single-Dose Ad26.COV2.S Vaccine against Covid-19. N. Engl. J. Med. 2021, 384,
    2187–2201. [CrossRef] [PubMed]
  23. Eichinger, S.; Warkentin, T.E.; Greinacher, A. Thrombotic Thrombocytopenia after ChAdOx1 nCoV-19 Vaccination. Reply. N. Engl.
    J. Med. 2021, 385, e11. [CrossRef] [PubMed]
  24. Doroftei, B.; Ciobica, A.; Ilie, O.D.; Maftei, R.; Ilea, C. Mini-Review Discussing the Reliability and Efficiency of COVID-19 Vaccines.
    Diagnostics 2021, 11, 579. [CrossRef]Zhang, L.; Richards, A.; Barrasa, M.I.; Hughes, S.H.; Young, R.A.; Jaenisch, R. Reverse-transcribed SARS-CoV-2 RNA can integrate
  25. into the genome of cultured human cells and can be expressed in patient-derived tissues. Proc. Natl. Acad. Sci. USA 2021, 118,
  26. e2105968118. [CrossRef] [PubMed]
  27. Available online: https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_
  28. en.pdf (accessed on 24 February 2022).
  29. Tanaka, H.; Takata, N.; Sakurai, Y.; Yoshida, T.; Inoue, T.; Tamagawa, S.; Nakai, Y.; Tange, K.; Yoshioka, H.; Maeki, M.; et al.
  30. Delivery of Oligonucleotides Using a Self-Degradable Lipid-Like Material. Pharmaceutics 2021, 13, 544. [CrossRef]
  31. Sedic, M.; Senn, J.J.; Lynn, A.; Laska, M.; Smith, M.; Platz, S.J.; Bolen, J.; Hoge, S.; Bulychev, A.; Jacquinet, E.; et al. Safety
  32. Evaluation of Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat and Cynomolgus Monkey. Vet. Pathol.
  33. 2018, 55, 341–354. [CrossRef]
  34. Sato, Y.; Matsui, H.; Yamamoto, N.; Sato, R.; Munakata, T.; Kohara, M.; Harashima, H. Highly specific delivery of siRNA to
  35. hepatocytes circumvents endothelial cell-mediated lipid nanoparticle-associated toxicity leading to the safe and efficacious
  36. decrease in the hepatitis B virus. J. Control. Release 2017, 266, 216–225. [CrossRef]
  37. Heidel, J.D.; Yu, Z.; Liu, J.Y.; Rele, S.M.; Liang, Y.; Zeidan, R.K.; Kornbrust, D.J.; Davis, M.E. Administration in non-human
  38. primates of escalating intravenous doses of targeted nanoparticles containing ribonucleotide reductase subunit M2 siRNA. Proc.
  39. Natl. Acad. Sci. USA 2007, 104, 5715–5721. [CrossRef]
  40. Available online: https://www.cvdvaccine-us.com/ (accessed on 24 February 2022).
  41. Available online: http://bridgeslab.sph.umich.edu/protocols/index.php/Preparation_of_Tail_Samples_(for_Genotyping)
  42. (accessed on 24 February 2022).
  43. Gallud, A.; Munson, M.J.; Liu, K.; Idstrom, A.; Barriga, H.M.; Tabaei, S.; Aliakbarinodehi, N.; Ojansivu, M.; Lubart, Q.;
  44. Doutch, J.J.; et al. Time evolution of PEG-shedding and serum protein coronation determines the cell uptake kinetics and delivery
  45. of lipid nanoparticle. bioRxiv 2021. [CrossRef]
  46. World Health Organization Messenger RNA Encoding the Full-Length SARS-CoV-2 Spike Glycoprotein. 2020. Available
  47. online: https://web.archive.org/web/20210105162941/https://mednet-communities.net/inn/db/media/docs/11889.doc
  48. (accessed on 24 February 2022).
  49. Mita, P.; Wudzinska, A.; Sun, X.; Andrade, J.; Nayak, S.; Kahler, D.J.; Badri, S.; LaCava, J.; Ueberheide, B.; Yun, C.Y.; et al. LINE-1
  50. protein localization and functional dynamics during the cell cycle. Elife 2018, 7, e30058. [CrossRef]
  51. Sato, Y.; Kinami, Y.; Hashiba, K.; Harashima, H. Different kinetics for the hepatic uptake of lipid nanoparticles between the
  52. apolipoprotein E/low density lipoprotein receptor and the N-acetyl-d-galactosamine/asialoglycoprotein receptor pathway. J.
  53. Control. Release 2020, 322, 217–226. [CrossRef]
  54. Vogel, A.B.; Kanevsky, I.; Che, Y.; Swanson, K.A.; Muik, A.; Vormehr, M.; Kranz, L.M.; Walzer, K.C.; Hein, S.; Guler, A.; et al.
  55. BNT162b vaccines protect rhesus macaques from SARS-CoV-2. Nature 2021, 592, 283–289. [CrossRef] [PubMed]
  56. Bahl, K.; Senn, J.J.; Yuzhakov, O.; Bulychev, A.; Brito, L.A.; Hassett, K.J.; Laska, M.E.; Smith, M.; Almarsson, O.; Thompson, J.; et al.
  57. Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses. Mol. Ther.
  58. 2017, 25, 1316–1327. [CrossRef] [PubMed]
  59. Bril, F.; Al Diffalha, S.; Dean, M.; Fettig, D.M. Autoimmune hepatitis developing after coronavirus disease 2019 (COVID-19)
  60. vaccine: Causality or casualty? J. Hepatol. 2021, 75, 222–224. [CrossRef]
  61. Kazazian, H.H., Jr.; Moran, J.V. Mobile DNA in Health and Disease. N. Engl. J. Med. 2017, 377, 361–370. [CrossRef] [PubMed]
  62. Coffin, J.M.; Fan, H. The Discovery of Reverse Transcriptase. Annu. Rev. Virol. 2016, 3, 29–51. [CrossRef]
  63. Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al.
  64. Initial sequencing and analysis of the human genome. Nature 2001, 409, 860–921. [CrossRef]
  65. Ostertag, E.M.; Goodier, J.L.; Zhang, Y.; Kazazian, H.H., Jr. SVA elements are nonautonomous retrotransposons that cause disease
  66. in humans. Am. J. Hum. Genet. 2003, 73, 1444–1451. [CrossRef]
  67. Hancks, D.C.; Kazazian, H.H., Jr. Active human retrotransposons: Variation and disease. Curr. Opin. Genet. Dev. 2012, 22, 191–203.
  68. [CrossRef]
  69. Jones, R.B.; Song, H.; Xu, Y.; Garrison, K.E.; Buzdin, A.A.; Anwar, N.; Hunter, D.V.; Mujib, S.; Mihajlovic, V.; Martin, E.; et al.
  70. LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells. J. Virol. 2013, 87, 13307–13320. [CrossRef]
  71. Macchietto, M.G.; Langlois, R.A.; Shen, S.S. Virus-induced transposable element expression up-regulation in human and mouse
  72. host cells. Life Sci. Alliance 2020, 3, e201900536. [CrossRef] [PubMed]
  73. Yin, Y.; Liu, X.Z.; He, X.; Zhou, L.Q. Exogenous Coronavirus Interacts With Endogenous Retrotransposon in Human Cells. Front.
  74. Cell Infect. Microbiol. 2021, 11, 609160. [CrossRef] [PubMed]
  75. Belancio, V.P.; Roy-Engel, A.M.; Deininger, P. The impact of multiple splice sites in human L1 elements. Gene 2008, 411, 38–45.
  76. [CrossRef] [PubMed]
  77. Dai, L.; Taylor, M.S.; O’Donnell, K.A.; Boeke, J.D. Poly(A) binding protein C1 is essential for efficient L1 retrotransposition and
  78. affects L1 RNP formation. Mol. Cell Biol. 2012, 32, 4323–4336. [CrossRef]
  79. Servant, G.; Streva, V.A.; Derbes, R.S.; Wijetunge, M.I.; Neeland, M.; White, T.B.; Belancio, V.P.; Roy-Engel, A.M.; Deininger, P.L.
  80. The Nucleotide Excision Repair Pathway Limits L1 Retrotransposition. Genetics 2017, 205, 139–153. [CrossRef]
  81. Guo, H.; Chitiprolu, M.; Gagnon, D.; Meng, L.; Perez-Iratxeta, C.; Lagace, D.; Gibbings, D. Autophagy supports genomic stability
  82. by degrading retrotransposon RNA. Nat. Commun. 2014, 5, 5276. [CrossRef]Xie, Y.; Mates, L.; Ivics, Z.; Izsvak, Z.; Martin, S.L.; An, W. Cell division promotes efficient retrotransposition in a stable L1 reporter
  83. cell line. Mob. DNA 2013, 4, 10. [CrossRef]
  84. Shi, X.; Seluanov, A.; Gorbunova, V. Cell divisions are required for L1 retrotransposition. Mol. Cell Biol. 2007, 27, 1264–1270.
  85. [CrossRef]
  86. Goff, S.P. Host factors exploited by retroviruses. Nat. Rev. Microbiol 2007, 5, 253–263. [CrossRef]
  87. Suzuki, Y.; Craigie, R. The road to chromatin—Nuclear entry of retroviruses. Nat. Rev. Microbiol. 2007, 5, 187–196. [CrossRef]
  88. Shi, J.; Wang, X.; Lyu, L.; Jiang, H.; Zhu, H.J. Comparison of protein expression between human livers and the hepatic cell lines
  89. HepG2, Hep3B, and Huh7 using SWATH and MRM-HR proteomics: Focusing on drug-metabolizing enzymes. Drug Metab.
  90. Pharmacokinet. 2018, 33, 133–140. [CrossRef] [PubMed]
  91. Kubo, S.; Seleme, M.C.; Soifer, H.S.; Perez, J.L.; Moran, J.V.; Kazazian, H.H., Jr.; Kasahara, N. L1 retrotransposition in nondividing
  92. and primary human somatic cells. Proc. Natl. Acad. Sci. USA 2006, 103, 8036–8041. [CrossRef] [PubMed]
  93. Macia, A.; Widmann, T.J.; Heras, S.R.; Ayllon, V.; Sanchez, L.; Benkaddour-Boumzaouad, M.; Munoz-Lopez, M.; Rubio, A.;
  94. Amador-Cubero, S.; Blanco-Jimenez, E.; et al. Engineered LINE-1 retrotransposition in nondividing human neurons. Genome Res.
  95. 2017, 27, 335–348. [CrossRef] [PubMed]

Complications From Taking COVID Vaccine Is 40 Times Higher Than Previously Recorded

Authors:  Jim Hoft Published May 3, 2022 

A new German study with around 40,000 participants concluded that severe complications after receiving the COVID vaccine.

The study found that those suffering serious complications is 40 times higher than previously recorded.

“The number of severe complications after vaccination against Sars-CoV-2 is 40 times higher than previously recorded by the Paul Ehrlich Institute (PEI),” a study with around 40,000 participants by the Berlin Charité concludes.

A study on side effects after corona vaccinations is being carried out at the Charite in Berlin. Professor Harald Matthes is leading the study and is calling for more contact points for those affected.

The number of serious complications after vaccinations against Sars-CoV-2 is 40 times higher than previously recorded by the Paul Ehrlich Institute (PEI). This is one of the results of a long-term observational study by the Berlin Charité. Study director Professor Harald Matthes is now calling for more contact points for those affected.

Study with around 40,000 participants
The study “Safety Profile of Covid-19 Vaccines” (“ImpfSurv” for short), which focuses on the effects and side effects of the various vaccines, has been running for a year. Around 40,000 vaccinated people are interviewed at regular intervals throughout Germany. Participation in the study is voluntary and independent of how the vaccines work in the subjects.

One result: eight out of 1,000 vaccinated people struggle with serious side effects. “The number is not surprising,” explains Prof. Dr. Harald Matthes, head of the study: “It corresponds to what is known from other countries such as Sweden, Israel or Canada. Incidentally, even the manufacturers of the vaccines had already determined similar values ​​in their studies.” With conventional vaccines, such as against polio or measles, the number of serious side effects is significantly lower.

Vaccinated Up to 15X MORE LIKELY Than Unvaxxed to Develop Heart Inflammation Requiring Hospitalization: Peer Reviewed Study

Authors:  Julian Conradson Published April 25, 2022 at 4:14pm

A new study out of Europe has revealed that cases of heart inflammation that required hospitalization were much more common among vaccinated individuals compared to the unvaccinated.

A team of researchers from health agencies in Finland, Denmark, Sweden, and Norway found that rates of myocarditis and pericarditis, two forms of potentially life-threatening heart inflammation, were higher in those who had received one or two doses of either mRNA-based vaccine – Pfizer’s or Moderna’s.

In all, researchers studied a total of 23.1 million records on individuals aged 12 or older between December 2020 and October 2021. In addition to the increased rate overall, the massive study confirmed the chances of developing the heart condition increased with a second dose, which mirrors other data that has been uncovered in recent months.

From the *peer-reviewed study, which was published by the Journal of the American Medical Association (JAMA):

“Results of this large cohort study indicated that both first and second doses of mRNA vaccines were associated with increased risk of myocarditis and pericarditis. For individuals receiving 2 doses of the same vaccine, risk of myocarditis was highest among young males (aged 16-24 years) after the second dose. These findings are compatible with between 4 and 7 excess events in 28 days per 100 000 vaccinees after BNT162b2, and between 9 and 28 excess events per 100 000 vaccinees after mRNA-1273.

The risks of myocarditis and pericarditis were highest within the first 7 days of being vaccinated, were increased for all combinations of mRNA vaccines, and were more pronounced after the second dose.”

Also mirroring other data, the study confirmed that young people, especially young males, are the ones who are suffering the worst effects of the experimental jab. Young men, aged 16-24 were an astounding 5-15X more likely to be hospitalized with heart inflammation than their unvaccinated peers.

But it isn’t just young men, all age groups across both sexes – except for men over 40 and girls aged 12-15 – experienced a higher rate of heart inflammation post-vaccination when compared to the unvaxxed.

From The Epoch Times, who spoke with one of the study’s main researchers, Dr. Rickard Ljung:

“‘These extra cases among men aged 16–24 correspond to a 5 times increased risk after Comirnaty and 15 times increased risk after Spikevax compared to unvaccinated,’ Dr. Rickard Ljung, a professor and physician at the Swedish Medical Products Agency and one of the principal investigators of the study, told The Epoch Times in an email.

Comirnaty is the brand name for Pfizer’s vaccine while Spikevax is the brand name for Moderna’s jab.

Rates were also higher among the age group for those who received any dose of the Pfizer or Moderna vaccines, both of which utilize mRNA technology. And rates were elevated among vaccinated males of all ages after the first or second dose, except for the first dose of Moderna’s shot for those 40 or older, and females 12- to 15-years-old.”

Although the peer-reviewed study found a direct link between mRNA based vaccines and increased incident rate of heart inflammation, the researchers claimed that the “benefits” of the experimental vaccines still “outweigh the risks of side effects,” because cases of heart inflammation are “very rare,” in a press conference about their findings earlier this month.

However, while overall case numbers may be low in comparison to the raw numbers and thus technically “very rare,” the rate at which individuals are developing this serious condition has increased by a whopping amount. When considering the fact that 5-15X more, otherwise healthy, young men will come down with the condition – especially since the chances of Covid-19 killing them at that age are effectively zero (99.995% recovery rate) – it’s downright criminal for governments across the world to continue pushing mass vaccinations for everyone.

Dr. Peter McCullough, a world-renowned Cardiologist who has been warning about the long-term horror show that is vaccine-induced myocarditis in young people, certainly thinks so. In his expert opinion, the study does anything but give confidence that the benefits of the vaccine outweigh the risks. In “no way” is that the case, he says. Actually, it’s quite the opposite.

From McCullough, via The Epoch Times:

“In cardiology we spend our entire career trying to save every bit of heart muscle. We put in stents, we do heart catheterization, we do stress tests, we do CT angiograms. The whole game of cardiology is to preserve heart muscle. Under no circumstances would we accept a vaccine that causes even one person to stay sustain heart damage. Not one. And this idea that ‘oh, we’re going to ask a large number of people to sustain heart damage for some other theoretical benefit for a viral infection,’ which for most is less than a common cold, is untenable. The benefits of the vaccines in no way outweigh the risks.”

It’s also worth pointing out that the new study’s findings could be an indicator as to what is driving the massive spike in the excess death rates in the United States and across the world. Correlating exactly with the rollout of the experimental mRNA Covid-19 vaccines, people have been dying at record-breaking rates, especially millennials, who experienced a jaw-dropping 84% increase in excess deaths (compared to pre-pandemic) in the final four months of 2021.

With all the data that has been made available up to this point, there is no denying that the vaccine is at least partially to blame for the spike in severe illness and death, if not entirely. Nevertheless, the CDC, Fauci, Biden, and the rest of the corrupt establishment continue to push mass vaccines, just approved another booster jab (with plans for another already in the works), and are licking their chops to unleash another round of Covid hysteria and crippling restrictions come this fall.

HHS Secretary Becerra Claims COVID Vaccines ‘Kill People Of Color’ At ‘Twice The Rate Of Whites,’ Vows To ‘Work’ Harder To Get More People Vaccinated

Authors: Alicia Powe Published April 19, 2022

After months of mandates forcing people to get two and three doses of COVID-19 vaccines to keep their jobs attend, school, travel and enter indoor venues, the federal government admits the experimental gene modification shots are killing people.

While vowing to ramp up biomedical tyranny and the effort to get more Americans vaccinated, U.S. Health and Human Services Director Xavier Becerra Experimental claimed the “safe and effective” mRNA shots are killing people with dark skin at a much higher rate than those with light skin.

“By the way, we know that vaccines are killing people of color — blacks, Latinos, indigenous people — at about two times the rate of white Americans,” Becerra explained during a digital “White House Convening on Equity” seminar on April 14.

After months of mandates forcing people to get two and three doses of COVID-19 vaccines to keep their jobs attend, school, travel and enter indoor venues, the federal government admits the experimental gene modification shots are killing people.

While vowing to ramp up biomedical tyranny and the effort to get more Americans vaccinated, U.S. Health and Human Services Director Xavier Becerra Experimental claimed the “safe and effective” mRNA shots are killing people with dark skin at a much higher rate than those with light skin.

“By the way, we know that vaccines are killing people of color — blacks, Latinos, indigenous people — at about two times the rate of white Americans,” Becerra explained during a digital “White House Convening on Equity” seminar on April 14.

After acknowledging the lethality of COVID shots, Becerra explained that approximately 80 percent of the American public is vaccinated.

But the government needs to “work” harder to vaccinate Americans who have refrained from getting inoculated, he argued.

“So, on vaccines, last year, we saw that about two-thirds of white American adults had received at least one shot of vaccine,” Becerra said. “That was just barely over 50 percent for black Americans and Latinos at that particular time. So, again, we’ve got to work.

“Today, a year later, over 80 percent of white American adults have received at least one shot. Over 80% of black American adults have received at least one shot. Over 80 percent of Latino Americans have received at least one vaccine shot.”

While HHS acknowledges the deadly effects COVID vaccines have on minority communities, the Center for Disease Control and Prevention’s Vaccine Adverse Effects System confirms the COVID shots are killing more people than any other vaccine in history.

According to VAERS, only 421 vaccine-related deaths in 2020 prior to the administration of the mRNA shots. In 2021, the number of people who dies after getting vaccinated precipitously spiked with at least 21,914 people died after receiving the COVID shots.

As yet, 5689 people died after receiving a COVID vaccine in 2022.

Meanwhile, the CDC is deploying fleets of federally funded “pandemic” buses to minority communities across the nation to persuade unvaccinated Americans into getting jabbed.

As reported, the CDC’s PANDEMIC (Program to Alleviate National Disparities in Ethnic and Minority Immunizations in the Community) deploys teams of health care workers into minority communities to educate people about why they need to be vaccinated.

According to PANDEMIC grant program materials, PANDEMIC’s goal is to reach groups that may experience “immunization disparities” in racial and ethnic minorities, residents of rural communities, migrant farmworkers, Native Americans, Hispanics, Blacks, and people identifying as part of the LGBTQ community and boost vaccination rates in areas chosen for having “high vaccine-hesitancy rate. ”

“If people aren’t sure [that they want the vaccine], then we have educational materials, and our community health workers and the extension agents will talk to them about their particular questions and try to answer their questions and their concerns. And then…[we] immediately give them the vaccine,” explained Catherine Striley of the University of Florida, who helps oversee the PANDEMIC project.

Worse Than the Disease? Reviewing Some Possible Unintended Consequences of the mRNA Vaccines Against COVID-19

Authors: Stephanie Seneff Computer Science and Artificial Intelligence Laboratory, MIT, Cambridge MA, 02139, USA, Greg Nigh Naturopathic Oncology, Immersion Health, Portland, OR 97214, USA International Journal of Vaccine Theory, Practice, and Research

Abstract

Operation Warp Speed brought to market in the United States two mRNA vaccines, produced by Pfizer and Moderna. Interim data suggested high efficacy for both of these vaccines, which helped legitimize Emergency Use Authorization (EUA) by the FDA. However, the exceptionally rapid movement of these vaccines through controlled trials and into mass deployment raises multiple safety concerns. In this review we first describe the technology underlying these vaccines in detail. We then review both components of and the intended biological response to these vaccines, including production of the spike protein itself, and their potential relationship to a wide range of both acute and long-term induced pathologies, such as blood disorders, neurodegenerative diseases and autoimmune diseases. Among these potential induced pathologies, we discuss the relevance of prion-protein-related amino acid sequences within the spike protein. We also present a brief review of studies supporting the potential for spike protein “shedding”, transmission of the protein from a vaccinated to an unvaccinated person, resulting in symptoms induced in the latter. We finish by addressing a common point of debate, namely, whether or not these vaccines could modify the DNA of those receiving the vaccination. While there are no studies demonstrating definitively that this is happening, we provide a plausible scenario, supported by previously established pathways for transformation and transport of genetic material, whereby injected mRNA could ultimately be incorporated into germ cell DNA for transgenerational transmission. We conclude with our recommendations regarding surveillance that will help to clarify the long-term effects of these experimental drugs and allow us to better assess the true risk/benefit ratio of these novel technologies.

How Vaccine Messaging Confused The Public

Authors: John Gibson the Brownstone Institute 

Pivotal randomized control trials (RCTs) underpinning approval of Covid-19 vaccines did not set out to, and did not, test if the vaccines prevent transmission of the SARS-CoV-2 virus. Nor did the trials test if the vaccines reduce mortality risk. A review of seven phase III trials, including those for Moderna, Pfizer/BioNTech and AstraZeneca vaccines, found the criterion the vaccines were trialled against was just reduced risk of Covid-19 symptoms

There should be no secret about these facts, as they were discussed in August 2020 in the BMJ (formerly the British Medical Journal); one of the oldest and most widely cited medical journals in the world. Moreover, this was not an isolated article, as the editor-in-chief also gave her own summary of the vaccine-testing situation, which has proved very prescient:

“…we are heading for vaccines that reduce severity of illness rather than protect against infection [and] provide only short-lived immunity, … as well as damaging public confidence and wasting global resources by distributing a poorly effective vaccine, this could change what we understand a vaccine to be. Instead of long-term, effective disease prevention it could become a suboptimal chronic treatment.”It was not just the BMJ covering these features of the RCTs. When health bureaucrats Rochelle Walensky, Henry Walke and Anthony Fauci claimed (in the Journal of the American Medical Association) that “clinical trials have shown that the vaccines authorized for use in the US are highly effective against Covid-19 infection, severe illness and death” this was felt sufficiently false that the journal published a comment simply titled “Inaccurate Statement.”

The basis of the comment was that the primary endpoint for the RCTs was symptoms of Covid-19; a less exacting standard than testing to show efficacy against infection, severe illness, and death.

Yet these aspects of the vaccine trials discussed in medical journals are largely unknown by the general public. To measure public understanding of the Covid-19 vaccine trials I added a question about the vaccine testing to an ongoing nationally representative survey of adult New Zealanders.

While not top-of-mind for most readers, New Zealand is a useful place for finding out about public understanding of the vaccine trials. Until recently, when a few doses of AstraZeneca and Novavax vaccines were allowed, it was 100% Pfizer, making it easy to word the survey question very specifically about the Pfizer vaccine trials.

Also, New Zealanders were vaccinated in a very short period, just prior to the survey. In late August 2021 New Zealand was last in the OECD in dosing rates but by December, when the survey was fielded, it had jumped into the top half of the OECD, with vaccinations rising by an average of 110 doses per 100 people in just over three months. 

This rapid rise in vaccination was partly driven by mandates, for health, education, police, and emergency workers and also by a vaccine passport system that blocked the unvaccinated from most places. The mandates were strictly applied, and even people suffering adverse reactions after their first shot, such as Bell’s Palsy and pericarditis, still had to get the second shot. The vaccine passport law had gone through Parliament just prior to the survey, so the vaccines, and what was expected of them, should have been utmost in peoples’ minds. 

The other relevant factor about New Zealand is the government-dominated media, which is either publicly funded, or is heavily subsidized by a “public interest journalism fund” and by generous government advertising of the Covid-19 vaccines. Also, supposedly independent commentators prominent in the media got their talking points about the vaccines from the government in a carefully orchestrated public relations campaign. 

Thus, it was mainly overseas journalists who expressed concern when New Zealand’s Prime Minister made the Orwellian claim that in matters of Covid-19 and vaccines: “Dismiss anything else, we will continue to be your single source of truth.”

Yet a government-controlled media and a vaccine advertising blitz yielded widespread public misunderstanding about the testing the vaccines underwent in pivotal trials. The survey asked if the Pfizer vaccine had been trialled against: (a) preventing infection and transmission of SARS-CoV-2, or (b) reducing risk of getting symptoms of Covid-19, or (c) reducing risk of getting serious sick or dying, or (d) all of the above. The correct answer is (b), the trials only set out to test if the vaccines reduced the risk of getting Covid-19 symptoms.

Only four percent of respondents got the right answer. In other words, 96 percent of adult New Zealanders thought the Covid-19 vaccines were tested against more demanding criteria than is actually the case. 

Currently, most Covid-19 cases in New Zealand are post-vaccination. And despite almost everyone being vaccinated, and most boosted, the rate of new confirmed Covid-19 cases is one of the highest in the world. As people see with their own eyes that one can still get infected they may question what they have been led to (mis)understand about the vaccines.

Elsewhere it is noted that vaccine fanaticism—especially denying natural immunity—fuels vaccine scepticism. As people see that public health authorities lied about natural immunity they will wonder if they also lied about vaccine efficacy. Likewise, as they realise they were given a misleading impression about what the vaccines were trialled against they might doubt other claims about vaccines.

In particular, by believing the vaccines were tested against more demanding criteria than was actually so, public expectations of what vaccination would achieve were likely too high. As the public witnesses a failure of mass vaccination to prevent SARS-CoV-2 infections, and a failure to reduce overall mortality, scepticism about these and other vaccines will grow.

In New Zealand this issue is exacerbated by the Prime Minister creating a false equivalence between Covid-19 vaccines and measles vaccines. Currently the paediatric vaccination rate (which includes the measles vaccine) for indigenous Maori has dropped 12 percentage points in two years and 0.3 million measles vaccines had to be discarded after expiring due to lack of demand. The advertising for Covid-19 vaccines particularly targets Maori, with claims that boosters will protect them against Omicron. The progress of infections is likely to prove this claim to be largely untrue, and so Maori are likely to be even more sceptical about future vaccination, even for vaccines that truly can be described as ‘safe and effective.’

If politicians and health bureaucrats had been honest with the public, setting out the criteria the Covid-19 vaccines were trialed against, and what could and could not be expected of the vaccines, then this widespread misunderstanding need not have occurred. Instead, their lack of honesty is likely to damage future vaccination efforts and harm public health.

Spectrum of neurological complications following COVID-19 vaccination

Authors: Ravindra Kumar Garg1 and Vimal Kumar Paliwal2 Neuro 2022; 43(1): 3–40.Published online 2021 Oct 31. doi: 10.1007/s10072-021-05662-9PMCID: PMC8557950PMID: 34719776

Abstract

COVID-19 vaccines have brought us a ray of hope to effectively fight against deadly pandemic of COVID-19 and hope to save lives. Many vaccines have been granted emergency use authorizations by many countries. Post-authorization, a wide spectrum of neurological complications is continuously being reported following COVID-19 vaccination. Neurological adverse events following vaccination are generally mild and transient, like fever and chills, headache, fatigue, myalgia and arthralgia, or local injection site effects like swelling, redness, or pain. The most devastating neurological post-vaccination complication is cerebral venous sinus thrombosis. Cerebral venous sinus is frequently reported in females of childbearing age, generally following adenovector-based vaccination. Another major neurological complication of concern is Bell’s palsy that was reported dominantly following mRNA vaccine administration. Acute transverse myelitis, acute disseminated encephalomyelitis, and acute demyelinating polyneuropathy are other unexpected neurological adverse events that occur as result of phenomenon of molecular mimicry. Reactivation of herpes zoster in many persons, following administration of mRNA vaccines, has been also recorded. Considering the enormity of recent COVID-19-vaccinated population, the number of serious neurological events is miniscule. Large collaborative prospective studies are needed to prove or disprove causal association between vaccine and neurological adverse events occurring vaccination.

SARS-CoV-2 is a novel coronavirus that can rapidly affect human beings and can result in coronavirus disease (COVID-19). COVID-19 is dominantly characterized by lung damage and hypoxia. The first case of COVID-19, in Wuhan, China, was reported on December 8, 2019. Later, the World Health Organization announced COVID-19 as a worldwide health emergency, on January 30, 2020. On March 11, 2020, COVID-19 was declared a pandemic. As per the latest World Health Organization report, there were 196,553,009 confirmed cases as on August 1, 2021 along with 4,200,412 deaths [1].

Early this year, COVID-19 vaccines has brought a ray of hope to effectively fight against this deadly pandemic and save precious human lives. Currently, four major vaccine types are being used. These vaccine types include viral vector-based vaccines, COVID-19 mRNA-based vaccines, inactivated or attenuated virus vaccine, and protein-based vaccines. In viral vector-based vaccines, adenovirus is used to deliver a part of SARS-COV-2 genome to human cells. Human cells use this genetic material to produce SARS-COV-2 spike protein. Human body recognizes this protein to start a defensive response. The mRNA-based vaccines consist of SARS-COV-2 RNA. Once introduced, genetic material helps in making SARS-COV-2-specific protein. This protein is recognized by human body to start defensive immune reaction. In inactivated or attenuated vaccines, killed or attenuated SARS-COV-2 virus triggers immune response. Protein-based vaccines use the spike protein or its fragments for inciting immune response. These COVID-19 vaccines have received emergency approvals in different countries for human use [2]. As per the latest World Health Organization report, until August 1, 2021, globally, a total of 3,839,816,037 COVID-19 vaccine doses have been globally administered [1].

In fact, all kinds of vaccines are associated with the risk of several serious neurological complications, like acute disseminated encephalomyelitis, transverse myelitis, aseptic meningitis, Guillain-Barré syndrome, macrophagic myofasciitis, and myositis. Influenza vaccine has been found associated with narcolepsy in young persons. Several pathogenic mechanisms, like molecular mimicry, direct neurotoxicity, and aberrant immune reactions, have been ascribed to explain these vaccines associated with neurological complications [3]. Even COVID-19 vaccines are not free from neurological complications. In this article, we have focused on the neurological complications following COVID-19 vaccination that were reported after their emergency use authorizations.

Search strategy

We reviewed available data regarding neurological complications (post-authorization) described following the World Health Organization–approved COVID-19 vaccination. We classified COVID-19 vaccination associated with neurological complications in two broad groups: (1) common but mild and (2) rare but severe. We searched PubMed, Google, and Google Scholar databases using the keywords “COVID‐19” or “SARS‐CoV‐2” and “vaccination” or “vaccine,” to identify all published reports on neurological complications of COVID‐19 vaccines. We in this review will focus on spectrum of published neurological adverse events following COVID-19 vaccination. Last search was done on August 1, 2021.

Mild neurological events

Neurological adverse events following COVID-19 vaccination are generally mild and transient, like fever/chills, headache, fatigue, myalgia and arthralgia, or local injection site effects like swelling, redness, or pain. These mild neurological symptoms are common following administration of all kinds of COVID-19 vaccines.

Anxiety-related events, like feeling of syncope and/or dizziness, are particularly common. For example, Centers for Disease Control and Prevention, in a report published on April 30, 2021, recorded 64 anxiety-related events (syncope in 17) among 8,624 Janssen COVID-19 vaccine recipients. None of the event was labeled as serious [4].

In Mexico (data available in form of preprint) among 704 003 subjects who received first doses of the Pfizer-BioNTech mRNA COVID-19 vaccine, 6536 adverse events following immunization were recorded. Among those, 4258 (65%) had at least one neurologic manifestation, mostly (99.6%) mild and transient. These events included headache (62·2%), transient sensory symptoms (3·5%), and weakness (1%). In this study, there were only 17 serious adverse events, seizures (7), functional syndromes (4), Guillain-Barré syndrome (3), and transverse myelitis (2) [5].

In South Korea, Kim and co-workers collected data of post-vaccination adverse events following first dose of adenovirus vector vaccine ChAdOx1 nCoV-19 (1,403 subjects) and mRNA vaccine BNT162b2 (80 subjects) vaccinations. Data were collected daily for 7 days after vaccination. Authors noted that 91% of adenovirus-vectored vaccine and 53% of mRNA vaccine recipients had mild adverse reactions, like injection-site pain, myalgia, fatigue, headache, and fever [6]. A mobile-based survey among healthcare workers (265 respondents) who received both doses of the BNT162b2 mRNA vaccine was conducted. The most common adverse effects were muscle ache, fatigue, headache, chills, and fever. Adverse reactions were higher after the second dose compared with that after the first dose [7].

Headache

Headache is one of the most frequent mild neurological complaints reported by a large number of COVID-19 vaccine recipients, soon after they receive vaccine.

A review of headache characteristic noted that among 2464 participants, headache begun 14.5 ± 21.6 h after AstraZeneca adenovirus vector vaccine COVID-19 vaccination and persisted for 16.3 ± 30.4 h. Headaches, in majority, were moderate to severe in intensity and generally localized to frontal region. Common accompanying symptoms were fatigue, chills, exhaustion, and fever [8]. In a multicenter observational cohort study, Göbel et al. recorded clinical characteristic of headache occurring after the mRNA BNT162b2 mRNA COVID-19 vaccination. Generally, headache started 18.0 ± 27.0 h after vaccination and persisted for 14.2 ± 21.3 h. In majority, the headaches were bifrontal or temporal, dull aching character and were moderate to severe in intensity. The common accompanying symptoms were fatigue, exhaustion, and muscle pain [8].

Severe neurological adverse events

Serious adverse reaction following immunization is defined as a post-vaccination event that are either life-threatening, requires hospitalization, or result in severe disability. The World Health Organization listed Guillain-Barré syndrome, seizures, anaphylaxis, syncope, encephalitis, thrombocytopenia, vasculitis, and Bell’s palsy as serious neurologic adverse events. Instances of serious adverse events following COVID-19 vaccinations are continuously pouring in the current scientific literature and are source of vaccine hesitancy in many persons [9] (Fig. 1).

An external file that holds a picture, illustration, etc.
Object name is 10072_2021_5662_Fig1_HTML.jpg

Fig. 1

A flow diagram depicts the spectrum of severe neurological complications following COVID-19 vaccinations (ADEM, acute disseminated encephalomyelitis; CVST, cerebral venous sinus thrombosis; LETM, longitudinally extensive transverse myelitis; MS, multiple sclerosis; NMOSD, neuromyelitis optica spectrum disorders; PRES, posterior reversible encephalopathy syndrome; TIA, transient ischemic attacks)

Functional neurological disorders

Functional neurological disorders are triggered by physical/emotional stress following an injury, medical illness, a surgery, or vaccination. Functional neurological disorders often remain misdiagnosed despite extensive workup.

After availability of COVID-19 vaccine, many YouTube videos depicted continuous limb and trunk movements and difficulty walking immediately after COVID-19 vaccine administration. These videos were of concern as they were the source of “vaccine hesitancy” [10]. Kim and colleagues reviewed several such social media videos demonstrating motor movements consistent with functional motor symptoms occurring after administration of COVID-19 vaccine. Motor movements were bizarre asynchronous and rapidly variable in frequency and amplitude consistent with functional neurological disorder. The Functional Neurological Disorder Society has lately clarified that movement disorder is consistent with functional in nature. The spread of these videos are important because these functional disorders created concerns for vaccine hesitancy [11].

Several other kinds of functional neurological disorders have also been reported. Butler and colleagues described two young ladies, who presented with functional motor deficits mimicking stroke. Both these patients had variability in weakness and had many non-specific symptoms. A detailed workup and neuroimaging failed to demonstrate any specific abnormality [12]. Ercoli and colleagues described a middle-aged man who, immediately after vaccine administration, reported bilateral facial paralysis along with failure to blink. These manifestations resolved quickly within 40 min. Immediately after administration of second dose of vaccine, he complained of respiratory distress and swollen tongue. Again, all these symptoms resolved quickly following treatment with corticosteroids, however, he developed new symptoms in the form of right hemiparesis. Two weeks later, he developed facial hypoesthesia. A detailed workup of the patient failed to demonstrate any abnormality. A diagnosis of functional neurological disorder was, finally, made [13].

Cerebral vascular events

As a matter of concern, increasing number of reports about adenoviral vector vaccine-induced cerebral vascular adverse events, like cerebral venous thrombosis, arterial stroke, and intracerebral hemorrhage, is getting published in leading medical journals. These reports are alarming as post-vaccination vascular events culminate either in severe disability or death. Vaccine-induced cerebral vascular adverse events are generally associated with severe immune-mediated thrombotic thrombocytopenia. Thrombocytopenia generally clinically manifests within 5 to 30 days after administration of adenovirus vector-based vaccines. In post-vaccination thrombotic thrombocytopenia, a picture similar to that of heparin-induced thrombocytopenia is encountered. When heparin binds platelet factor 4, there is generation of antibodies against platelet factor 4. Antibodies against platelet factor 4 result in platelet destruction and trigger the intravascular blood clotting [14]. The post-mortem examination, in patients with vaccine-induced thrombocytopenia, demonstrated extensive involvement of large venous vessels. Microscopic findings showed vascular thrombotic occlusions occurring in the vessels of multiple body organs along with marked inflammatory infiltration [15]. The vector-based vaccines contain genetic material of SARS-COV-2 that is capable of encoding the spike glycoprotein. Possibly, leaked genetic material binds to platelet factor 4 that subsequently activates formation of autoantibodies. These autoantibodies destroy platelets [1617].

Cerebral venous thrombosis

Cerebral venous thrombosis is the one of the most feared devastating COVID-19 vaccine-associated neurological complication. Cerebral venous thrombosis should be suspected in all vaccinated patients, who has persistent headache. Headache is generally unresponsive to the analgesics, and some patients may have focal neurological deficits. Affected patients are generally females of younger ages (Table ​(Table1)1) [1846].

Table 1

Clinical, magnetic resonance imaging findings, and outcome details of patients who developed cerebral venous sinus thrombosis after vaccination against SARS-CoV-2

ReferenceNeurological complicationsCountryAge/sexVaccine typeDuration of onset after vaccinationClinical featuresNeuroimagingTreatment given
Castelli et al. [18]Cerebral venous sinus thrombosisItaly50/MCOVID-19 vaccine AstraZeneca10 daysSevere headache, right hemiparesis, unsteady gait, and visual impairment of 4 days Patient needed ICU care and mechanical ventilationIntra-parenchymal hemorrhage CT angiography = left transverse and sigmoid venous sinuses thrombosisFibrinogen concentrate (10 g total) and platelet (4 units total) a bilateral decompressive craniectomy
D’Agostino et al. [19Cerebral venous thrombosis and disseminated intravascular coagulationItaly54/FThe AstraZeneca vaccine12 daysAltered sensorium and hemiparesis Myocardial infarctionMultiple subacute lobar hemorrhages basilar artery thrombosis associated with the superior sagittal sinus thrombosis Bilateral adrenal hemorrhageIntensive care unit
Scully et al. (report of 23 patients) [20]Thrombocytopenia (23 patients) Cerebral venous thrombosis (13 patients)London12 years (Median)ChAdOx1 nCoV-19 vaccine (AstraZeneca)6 to 24 days13 patients with cerebral venous thrombosisNot availableNot available
Franchini et al. [21]Cerebral venous thrombosisItaly50/MCOVID-19 vaccine AstraZeneca7 daysComa thrombocytopeniaIntra-parenchymal hemorrhage Angiography cerebral venous sinus thrombosisIntensive care unit
Mehta et al. [22]Cerebral venous sinus thrombosisUK32/MVaxzevria vaccine9 daysThunderclap headache Left hemiparesis, left-sided incoordination Thrombocytopenia and rapidly evolving comaSuperior sagittal sinus and cortical vein thrombosis and significant cortical edema with small areas of parenchymal and subarachnoid hemorrhageIntensive care unit
25/MVaxzevria vaccine6 daysHeadache hemiparesis, left hemisensory loss Seizures, agitation, decerebrate posturing, reduced GCS ThrombocytopeniaSuperior sagittal sinus thrombosis with extension into the cortical veins and hemorrhage in lobar and sub-arachnoid locationsIntensive care unit
Bersinger et al. [23]Cerebral venous sinus thrombosisFrance21/FChAdOx1 nCoV-19 vaccine9 daysHeadaches, seizures, hemiplegia, expressive aphasia, and no pupillary abnormalities and altered sensorium The platelet count was 61,000 per cubic millimeterCT of the head showed massive thrombosis in the deep and superficial cerebral veins, thrombosis of the left jugular vein, and left frontoparietal venous hemorrhagic infarctionA selective arterial embolization was performed immediately after decompressive craniectomy IV immunoglobulin Fondaparinux
Ramdeny et al. [24]Cerebral venous sinus thrombosisUnited Kingdom54/MCOVID-19 Vaccine AstraZeneca21 daysWorsening headache, bruising and unilateral right calf swelling Thrombocytopenia D-dimer = 60,000 ng/ml Anti-platelet factor 4Cerebral venous sinus thrombosisIntravenous immunoglobulin
Zakaria et al. [25]Cerebral venous sinus thrombosisMalaysia49/MFirst dose of mRNA SARS-CoV-2 vaccine16 daysNew onset of mild to moderate headache and giddinessCT) of the brain showed cordlike hyperattenuation within the left transverse and sigmoid sinus suggestive of cord or dense clot sign CT cerebral venography a long segment-filling defect and empty delta sign within the superior sagittal sinus extending into the torcula Herophili, left transverse sinus, and sigmoid sinus to proximal internal jugular veinSubcutaneous Clexane improved
Ryan et al. [26]Cerebral venous sinus thrombosisIreland35/FAZD1222 (COVID-19 Vaccine AstraZeneca)10 daysHeadache thrombocytopenia bruising and petechiae Antibody to platelet factor 4MR venogram showed cerebral venous sinus thrombosisApixaban
Graf et al. [27]Cerebral venous sinus thrombosisGermany29/MChAdOx1 nCov-19, AstraZeneca9 daysSevere headache and hematemesis thrombocytopeniaComplete thrombosis of the left transverse and sigmoid sinus down to the left proximal jugular vein Temporo-parietal intracranial hemorrhage CT angiography revealed extensive thrombosis of the mesenteric and portal veinHigh-dose immunoglobulins Argatroban
George et al. [28]Cerebral venous sinus thrombosisUSA40/FChAdOx1 nCov-19, AstraZeneca7 daysHeadache thrombocytopenia Antibody to platelet factor 4Venous thrombosis involving the left transverse sigmoid sinus and internal jugular veinA direct thrombin inhibitor (bivalirudin) Intravenous immune globulin (IVIG)
Jamme et al. [29]Cerebral venous sinus thrombosisFrance69/FFirst dose of Oxford–AstraZeneca vaccine11 daysHeadache associated with behavioral symptomsBilateral frontal hemorrhage cerebral venous thrombosis of the left internal jugular vein, sigmoid sinus, and superior sagittal sinusNone
Tiede et al. (report of 5 patients) [30]Cerebral venous sinus thrombosisGermany41 and 67 years All femalesChAdOx1 COVID-19 vaccine (AZD1222, Vaxzevria)5 to 11 days after first vaccinationCerebral venous sinus thrombosis (CVST), splanchnic vein thrombosis (SVT), arterial cerebral thromboembolism, and thrombotic microangiopathy thrombocytopenia Autoantibodies against platelet factor 4Brain hematomas infarcts, presence of thrombi in major vesselsIntravenous immunoglobulin or corticosteroids Argatroban
Schulz et al. (report of 45 cases) [31]Cerebral venous thrombosisGermany46.5 years (mean)/35 femalesBNT162b2, ChAdOx1, and mRNA-1273Within 30 days of vaccinationThrombocytopenia in all patientsCerebral venous thrombosisIntravenous immunoglobulins, plasmapheresis, corticosteroids, anticoagulants
Bourguignon et al. [32]A report three patients one had cerebral venous sinus thrombosisCanada69/MChAdOx1 nCov-19, AstraZeneca12 daysDiabetes mellitus, hypertension, obstructive sleep apnea, recently diagnosed prostate cancer Headache and confusion left-sided weakness Thrombocytopenia Autoantibodies against platelet factor 4Right middle cerebral-artery stroke with hemorrhagic transformation Right cerebral transverse and sigmoid sinuses, right internal jugular vein, hepatic vein, and distal lower-limb vein; pulmonary embolismIntravenous immunoglobulin Plasmapheresis
Gattringer et al. [33]Cerebral venous sinus thrombosisAustria39/FThe first vaccination with ChAdOx1 nCov-19 (AstraZeneca)8 daysHeadache since 2 days thrombocytopenia (84 × 10 [8]/L)Left sigmoid/transverse sinus thrombosis without brain parenchymal involvementIntravenous immunoglobulin
Ikenberg et al. [34]Cerebral venous sinus thrombosisGermanyearly 30 s/FThe first dose of ChAdOx1 nCov-19 (AstraZeneca)Headache Gait ataxia, and amnestic difficulties as well as aphasia Thrombocytopenia of 37 000/µLCVST of the left transverse and sigmoidal sinus with a left-temporal and left-cerebellar intracerebral hemorrhageIntravenous immunoglobulin argatroban
Clark et al. [35]Cerebral venous sinus thrombosisUSA40/FThe Ad26.COV2.S (Johnson & Johnson/ Jansen) vaccine5 daysWorsening headaches thrombocytopeniaCerebral venous sinus thrombosis involving the left transverse and sigmoid sinuses, extending into the left internal jugular veinBivalirudin infusion Intravenous immunoglobulin
Bonato et al. [36]Cerebral venous sinus thrombosisItaly26/FChAdOx1 nCoV-19 vaccine14 daysheadache non-responsive to drugs right-sided weakness and visual disturbances rapidly deteriorated with decreased consciousnessMultifocal venous thrombosis with bilateral occlusion of parietal cortical veins, straight sinus, vein of Galen, internal cerebral veins, and inferior sagittal sinus. Right parietal and left frontoparietal lobes an extensive venous infarction with hemorrhagic transformation Platelet-factor 4 (PF4)–heparin IgG antibodies – elevated thrombocytopeniaDexamethasone Intravenous immunoglobulin argatroban
Wang et al. [37]Cerebral venous sinus thrombosisTaiwan41/FFirst vaccination with ChAdOx1 nCoV-197 daysFever and headache thrombocytopenia positive anti-PF4 antibodiesMR venography revealed cerebral venous sinus thrombosisIntravenous immunoglobulin
Dutta et al. [38]Cerebral venous sinus thrombosisIndia51/MFirst-dose of COVISHIELD6 daysHeadache double vision papilledema Platelet count was normalMR venography revealed thrombosis in superior sagittal sinus and transverse sinusLow-molecular-weight heparin
Aladdin et al. [39]Cerebral venous sinus thrombosisSaudi Arabia36/FFirst dose of the ChAdOx1 nCoV-19 vaccine14 daysVomiting and severe headache left upper limb weakness thrombocytopenia Disseminated intravascular coagulationBrain computed tomography (CT) scan showed superior sagittal thrombosis with thickened cortical veins and bilateral hypodensities in the parietal lobesLow-molecular-weight heparin ICU care
Lavin et al. (a series of 4 patients) [40]Cerebral venous sinus thrombosisIreland29/F 38/M 50/F 35/FVaxzevria vaccine (ChAdOx1 nCoV-19, AstraZeneca)10 days 16 days 23 days 14 daysVisual disturbance followed by a headache, nausea, vomiting, bruising and petechiae severe thunderclap headache, nausea and vomiting headache, persistent bruising and petechiae all had thrombocytopeniaDural venous sinus thrombosis in one patient only other had abdominal abnormalitiesIntravenous immunoglobulin
Tølbøll Sørensen et al. [41]Cerebral venous sinus thrombosisUK30/FChAdOx1 nCoV-19Headache and general malaise portal vein thrombosis thrombocytopenia and consumption coagulopathy Anti-platelet antibodies were detectedNormalTinzaparin
Fan et al. [42] (a series of 3 patients)Cerebral venous sinus thrombosisSingapore54/M 62/F 60/FBNT162b2 mRNA vaccination1 day 9 days 8 daysSevere headache and vomiting and acute left hemiparesis Headache and vomiting Right ataxic hemiparesis There was no thrombocytopeniaA large right temporo-parietal lobe intraparenchymal hemorrhage Acute right cerebral bleed involving occipital and temporal lobes associated with subarachnoid hemorrhage Venous infarct in bilateral perirolandic gyri Venogram confirmed cerebral venous sinus thrombosis in all threeLow-molecular-weight heparin decompressive craniectomy
Suresh and Petchey  [43]Cerebral venous sinus thrombosisUK27/MChAdOx1 nCOV-19 vaccine2 daysWorsening headache and new homonymous hemianopia Thrombocytopenia Anti-platelet antibodies were detectedAcute parenchymal bleed with subdural extension CT venogram confirmed significant cerebral venous sinus thrombosisDabigatran and intravenous immunoglobulins
Dias et al. (a series of 2 patients) [44]Cerebral venous sinus thrombosisPortugal47/F 67/FBNT162b2 mRNA SARS-CoV-2 vaccine6 days 3 daysHeadache, nausea and photophobia a sudden left motor deficit Sudden right lower limb clonic movements, followed by motor deficit, loss of consciousness and headache There was no thrombocytopenia Anti-platelet antibodies were not detectedMRI with venography revealed thrombosis of superior sagittal, right lateral, transverse, sigmoid sinuses, and jugular vein and left sigmoid sinus, together with right frontal subarachnoid hemorrhage and a cortical venous infarct Brain MRI showed thrombosis of high convexity cortical veins, superior sagittal, right transverse, and sigmoid sinus and jugular veinAcetazolamide and enoxaparin Levetiracetam 500 mg bid and enoxaparin
Guan et al. [45]Cerebral venous sinus thrombosisTaiwan52/MThe first dose of ChAdOx1 nCov-19 (AstraZeneca)10 daysNausea and thunderclap headache thrombocytopenia Platelet factor 4 antibodies detectedHyperdensity of the sinus, including cord sign and dense vein sign at the left transverse and sigmoid sinuses CT venogram revealed CVST at the left transverse sinus and sigmoid sinuses and thrombosis of the left internal jugular veinApixaban Outcome not provided
Varona et al. [46]Cerebral venous sinus thrombosis and primary adrenal insufficiencySpain47/MAdenoviral (ChAdOx1) vector-based COVID-19 vaccine10 daysHeadache, somnolence, and mild confusion Blateral segmentary pulmonary embolism Thrombocytopenia Anti-platelet antibodies were detectedConsistent with cerebral venous thrombosisIntravenous immunoglobulins and subcutaneous fondaparinux hydrocortisone Patient improved

Open in a separate window

In Europe, since March 2021, cases of cerebral venous thrombosis started pouring in following COVID-19 vaccination, particularly after administration of viral vector based (AstraZeneca ChAdOx1 nCoV-19 and the Johnson and Johnson Ad26. COV2.S) vaccines [22]. Scully and colleagues recently reported findings of 23 patients, who presented with thrombosis and thrombocytopenia (platelet counts below 10 × 109/L). These patients developed thrombosis and thrombocytopenia 6 to 24 days after they received the first dose of the viral vector-based vaccines. In a significant observation, authors, in majority of patients, demonstrated the presence of autoantibodies against platelet factor 4. Additionally, D-dimer levels were found elevated [20]. Tiede and co-workers reported five German cases of prothrombotic immune thrombocytopenia after vaccination with viral vector-based vaccine (Vaxzevria). In these patients, acute vascular events clinically manifested as cerebral venous sinus thrombosis, splanchnic vein thrombosis, arterial cerebral thromboembolism, and/or thrombotic microangiopathy within 2 weeks post vaccination. All five patients had low platelet counts and markedly raised D-dimer. In all, autoantibodies against platelet factor 4 were also demonstrated [30].

Pottegård et al. in Denmark and Norway evaluated incidence of arterial events, venous thromboembolism, thrombocytopenia, and bleeding among vaccinated population. The vaccinated cohorts comprised of 148,792 Danish people and 132,472 persons from Norway. All has received their first dose of viral vector-based vaccine (ChAdOx1-S). An excess rate of venous thromboembolism (like cerebral venous thrombosis) was observed among vaccine recipients, within 28 days of vaccine administration. Authors estimated an increased rate for venous thromboembolism corresponding to 11 excess events per 100,000 vaccinations with 2.5 excess cerebral venous thrombosis events per 100,000 vaccinations [47].

Krzywicka et al., from the Netherlands, collected data of 213 cases with post-vaccination (187 after adenoviral vector vaccines and 26 after a mRNA vaccine) cerebral venous sinus thrombosis; they noted thrombocytopenia in 107/187 (57%) post-vaccination cerebral venous sinus thrombosis cases. Thrombocytopenia was not recorded in any of patients, who received an mRNA-based vaccine. Cerebral venous sinus thrombosis after adenoviral vector vaccines carried poorer prognosis. Approximately, 38% (44/117) patients in adenoviral vector vaccine group died, while in mRNA vaccine group, 20% (2/10) had died [48].

Recently published National Institute for Health and Care Excellence (NICE) guidelines recommend that the patients with clinical diagnosis of vaccine-induced immune thrombocytopenia and thrombosis should be treated with intravenous administration of human immunoglobulin, at a dose of 1 g/kg. If there is no response or there is further deterioration, second dose of human immunoglobulin should be given. In patients with insufficient response, methylprednisolone 1 g intravenously for 3 days or dexamethasone 20 to 40 mg for 4 days can be used [49].

Heparin needs to be avoided, instead alternative anticoagulants like argatroban, bivalirudin, fondaparinux, rivaroxaban, or apixaban should be used for anticoagulation [4951]. NICE guidelines further recommend that patients with very low platelet count should be treated either alone with a argatroban or a combination of argatroban and platelet transfusion [49].

Arterial events

Several acute arterial events, like arterial thrombosis, intracerebral hemorrhage, transient global amnesia, and spinal artery ischemia, have also been reported following vaccination [31].

Simpson and colleagues, in Scotland, estimated the incidence of vaccine-associated thrombocytopenia and vascular events following administration of first dose of viral vector-based vaccine (ChAdOx1) or mRNA (BNT162b2 Pfizer-BioNTech or mRNA-1273 Moderna) vaccination. First dose of viral vector-based vaccine was associated with small enhanced risk of idiopathic thrombocytopenic purpura; in addition, up to 27 days after vaccination, there was possibility of an increased risk for thromboembolic and hemorrhagic events. No such adverse associations were noted with mRNA vaccines [52]. The reports of COVID-19 vaccine-related intracerebral hemorrhage and ischemic stroke are summarized in Table ​Table22 [5361].

Table 2

Clinical, neuroimaging and outcome details of patients who suffered strokes (other than cerebral venous thrombosis) after vaccination against SARS-CoV-2

ReferenceNeurological complicationCountryAge/sexVaccine typeDuration after vaccinationClinical featuresNeuroimagingTreatmentOutcome
Athyros and Doumas [53]Intracerebral hemorrhageGreece71/FModerna anti-COVID-19 vaccine3 daysRight hemiplegia, aphasia, agnosia Acute hypertensive crisisLeft basal ganglia hemorrhageClonidine, furosemideDied
Bjørnstad-Tuveng [54]Intracerebral hemorrhageNorwayThirties/FAstraZeneca’s vaccine ChAdOx1 nCoV-199 daysSlurred speech, left hemiparesis, and reduced consciousnessRight intracerebral hemorrhage on CT, thrombosis in transverse sinus and pulmonary artery on postmortemICU managementDied
de Mélo Silva et al. [55]Intracerebral hemorrhage with intraventricular extensionBrazil57/FChAdOx1 nCoV-19 vaccine5 daysLeft hemiparesis, vomiting, and somnolenceA large right deep frontal lobe parenchymal hematomaICU management Decompressive craniectomySurvived with disabilities
Bayas et al. [56]Bilateral superior ophthalmic vein thrombosis, ischemic stroke, and immune thrombocytopeniaGermany55/FSARS-CoV-2— ChAdOx1 nCoV-1910 daysFlu-like illness, diplopia, vision loss, a transient, mild, right-sided hemiparesis, and aphasia, focal seizuresMRI showed superior ophthalmic vein thrombosis An MRI showed an ischemic stroke in the left parietal lobe, middle cerebral artery territory, with restricted diffusionIntravenous dexamethasone AnticoagulantsImproved
Al-Mayhani et al. [57Ischemic stroke with thrombocytopeniaLondon35/F 37/F 43/FChAdOx1 nCoV-19 vaccine ChAdOx1 nCoV-19 vaccine ChAdOx1 nCoV-19 vaccine11 days 12 days 21 daysLeft face, arm, leg weakness and drowsiness Headache, left visual field loss, confusion, left arm weakness DysphasiaRight middle-cerebral artery infarct Bilateral acute border zone infarcts Left middle-cerebral artery infarctDecompressive hemicraniectomy Intravenous immunoglobulin Intravenous immunoglobulinDied Improved Stable
Blauenfeldt et al. [58]Ischemic strokeDenmark60/MmRNA-based vaccine BNT162b2 (Pfizer/BIOTECH)7 daysBilateral adrenal hemorrhages A massive right sided ischemic stroke Thrombocytopenia Platelet factor 4 (PF‐4) reactive antibodiesAngiography showed occlusion of the right internal. Carotid arteryIntensive care unitPalliative care
Malik et al. [59]transient ischemic attackUSA43/FJohnson and Johnson COVID-19 Ad26.COV2.S vaccination10 daysHeadache, fever, body aches, chills, mild dyspnea and light-headedness thrombocytopenia numbness and tingling of her face and right armRight internal carotid artery (ICA) thrombusFondaparinuxImproved
Finsterer and Korn [60]AphasiaAustria52/MThe second dose of an mRNA-based SARS-CoV-2 vaccine7 daysSudden-onset reading difficulty and aphasia motor aphasia with paraphasiaA lobar bleeding in the left temporal lobeSupportiveImproved
Walter et al. [61]Ischemic stroke Main stem occlusion of middle cerebral arteryGermanyFirst dose ChAdOx1 nCov-19 vaccineacute headache, aphasia, and hemiparesis Platelet count and fibrinogen level were normalMain stem occlusion of middle cerebral artery A wall-adherent, non-occluding thrombus in the ipsilateral carotid bulb was notedWithin 1 h after start of IV thrombolysisThrombus dissolved and patient improved

Open in a separate window

Intracerebral hemorrhage

Athyros and Doumas reported a 71-year-old female. who developed intracerebral hemorrhage after she received the first dose of the Moderna mRNA vaccine.

On the third post-vaccination day, the patient developed right hemiplegia, aphasia, and agnosia along with accelerated hypertension. Computed tomography revealed a hematoma in the left basal ganglia. On the 9th day, she died [53].

In another report, Bjørnstad-Tuveng et al. described a young woman, who had a fatal cerebral event following vaccination with AstraZeneca’s ChAdOx1 nCoV-19 vaccine. She was found to have severe thrombocytopenia. The patient died the next day of the event. Post-mortem examination revealed antibodies against platelet factor 4 and the presence of small thrombi in the transverse sinus, frontal lobe, and pulmonary artery [54].

Acute ischemic stroke

Bayas and co-workers described a case that presented with superior ophthalmic vein thrombosis, ischemic stroke, and immune thrombocytopenia, after administration of viral vector-based vaccine. Intravenous dexamethasone resulted in marked improvement in platelet count [56]. Al-Mayhani et al. described three cases of vaccine-induced thrombotic thrombocytopenia, all presented with arterial strokes. Authors opined that young patients with arterial stroke after receiving the COVID-19 vaccine should always be evaluated for vaccine-induced thrombotic thrombocytopenia. Other laboratory tests, like platelet count, D-dimers, fibrinogen level, and testing for platelet factor 4 antibodies, should also be performed [57].

Blauenfeldt et al. described a 60-year-old woman, who presented with intractable abdominal pain, 7 days after receiving the adenoviral (ChAdOx1) vector-based COVID-19 vaccine. Abdominal computed tomography revealed bilateral adrenal necrosis. Later, a massive right cerebral infarction, secondary to occlusion of the right internal carotid artery, occurred that led to death of the patient. Blood tests showed thrombocytopenia, elevated in D-dimer and platelet factor 4 antibodies [58].

Many reports of acute brain disorders like encephalopathy, seizures, acute disseminated encephalopathy, neuroleptic malignant syndrome, and post-vaccine encephalitis were described secondary to COVID-19 vaccine. These are summarized in Table ​Table33 [6275].

Table 3

Clinical, neuroimaging and outcome details of patients who presented with an acute brain disorder (other than cerebral venous thrombosis and arterial stroke) after vaccination against SARS-CoV-2

ReferenceNeurological complicationCountryAge/sexVaccine typeDuration after vaccinationClinical featuresNeuroimagingTreatmentOutcome
Baldelli et al. [62]Reversible encephalopathyItaly77/MThe first dose of ChAdOx1 nCoV-19 vaccine (AstraZeneca)1 dayDelirium A significant increase of interleukin (IL)-6 in both CSF and serumNormalCorticosteroids
Aladdin and Shirah [63]New-onset refractory status epilepticusSaudi Arabia42/FChAdOx1 nCoV-19 vaccine10 daysHeadache and fever first-ever generalized tonic–clonic seizure lorazepam, levetiracetam, and phenytoin failed to controlIncrease in the signal on FLAIR images at bilateral hippocampi and insulaMidazolam and propofol Plasma exchangeImproved
Ghosh et al. [64]SeizuresIndia68/MCovishield vaccine4 daysFocal onset non-motor seizurePeriventricular leukoaraiosis and cortical atrophybrivaracetamImproved
Liu et al. [65] (two cases)Associated with non-convulsive status epilepticusUSA86/F 73/MModerna COVID-19 vaccine7 days 21 daysDiastolic dysfunction, chronic kidney disease and diabetes mellitus with acute encephalopathy Acute confusion with visual hallucinations EEG demonstrated non-convulsive focal status epilepticus Acute encephalopathy with non-convulsive status epilepticusNormalAntiepileptic therapy and ICU careBoth improved
Naharci and Tasc [66]DeliriumTurkey88/Ffirst dose of CoronaVac–-an inactivated COVID-19 vaccineAcute confusion, hallucinations, agitation, and sleep disturbanceNoneHaloperidol and trazodoneImproved
Salinas et al. [67]Transient akathisiaUSA36/FPfizer-BioNTech vaccineWithin 24 h of second doseRestless body syndrome had fever after 5 h of motor restlessness resolved after 24 hNoneNoneImproved
Zavala-Jonguitud et al. [68]DeliriumMexico89/MThe first dose of BNT162b2 RNA vaccine24 hAcute confusion, fluctuating attention, anxiety and inversion of the sleep–wake cycle History of type 2 diabetes mellitus, hypertension, stage III‐b chronic kidney disease, prostatic hyperplasiaNot doneQuetiapineImproved
Alfishawy et al. [69]Neuroleptic malignant syndromeKuwait74/FBNT162b2 mRNA COVID-19 vaccine16 daysOld case of dementia and bipolar disorder and was receiving memantine, donepezil, and quetiapine presented with fever, delirium, rigidity, and elevated CPKNormalSymptomaticImproved
Ozen Kengngil et al. [70]Acute disseminated encephalomyelitis like MRI lesionsTurkey46/FInactivated SARS-CoV-2 vaccine of Sinovac1 MonthSeizures, normal examinationT2, FLAIR hyperintensity in thalamus, and corona radiataMethyl prednisoloneNo recurrence of seizures
Cao and Ren [71]Acute disseminated encephalomyelitisChina24/FSARS-CoV-2 Vaccine (Vero Cell), Inactivated2 weeksSomnolence and memory decline, MMSE-11 inflammatory changes in CSFT2/FLAIR white matter hyperintensity in both temporal lobesIV immunoglobulinImproved
Raknuzzaman et al. [72]Acute disseminated encephalomyelitisBangladesh55/MBNT162b2 mRNA COVID-19 vaccine3 weeksDelirium followed by loss of consciousnessT2/FLAIR white matter hyperintensities in periventricular regionMethyl prednisoloneImproved
Torrealba-Acosta et al. [73]Acute encephalitis, myoclonus and Sweet syndromeUSA77/MmRNA-1273 vaccine1 dayConfusion, fever and generalized rash; later headache, dizziness and double vision leading to severe encephalopathy Intermittent orofacial movements and upper extremity myoclonus CSF showed increased cells and protein. Skin biopsy showed vasculitis changesNormalMethylprednisoloneImproved
Vogrig et al. [74]Acute disseminated encephalomyelitisItaly56/FPfizer-BioMTech COVID-19 vaccine (Comirnaty)2 weeksHorizontal gaze-evoked nystagmus, Mild weakness on left upper limb, left hemi-ataxic gaitT2/FLAIR white matter hyperintensity in left cerebellar peduncle prednisone improved FLAIR sequences were observed, the largest in the left centrum semiovalePrednisoneImproved
Zuhorn et al. [75]Postvaccinal encephalitis Similar to autoimmune encephalitisGermany21/FChAdOx1 nCov-19 vaccine the first dose5 daysHeadache and progressive neurological symptoms including attention and concentration difficulties and a seizure CSF lymphocytic pleocytosis EEG slow delta rhythmNormalPrednisoneImproved
63/FChAdOx1 nCov-19 vaccine6 daysGait disorder, a vigilance disorder and a twitching all over her body Opsoclonus-myoclonus syndrome CSF lymphocytic pleocytosis EEG slow delta rhythmNormalMethylprednisoloneImproved
63/MChAdOx1 nCov-19 vaccine8 daysIsolated aphasia and fever CSF lymphocytic pleocytosis EEG normalNormalNoneMild improvement despite no treatment

Open in a separate window

Encephalopathy

Some patients developed encephalopathy following administration of COVID-19 vaccines. Acute encephalopathy is defined as rapidly evolving disorder of the brain. Acute encephalopathy clinically manifests either with delirium, decreased consciousness, or coma.

Delirium

Delirium is characterized with fluctuating disturbance in attention and awareness. Zavala-Jonguitud and Pérez-García described an 89-year-old man, who developed delirium after mRNA vaccination. Within 24 h, patient developed confusion, fluctuating attention, anxiety, and inversion of the sleep–wake cycle. Patient had many comorbidities (diabetes mellitus, hypertension, and chronic kidney disease). Patient improved after he was treated with quetiapine [68].

Neuroleptic malignant syndrome

Neuroleptic malignant syndrome is a life-threatening complication of many antipsychotic drugs characterized by fever, altered mental status, muscle rigidity, and autonomic dysfunction. In an isolated report, neuroleptic malignant syndrome, in a 74-year-old female with dementia and bipolar disorder 16 days after COVID-19 vaccination, has been described [69].

Acute disseminated encephalomyelitis

Acute disseminated encephalomyelitis (ADEM) is an acute inflammatory demyelinating disorder of the central nervous system. In the majority, ADEM is a post-infectious entity; in many cases, it even develops after vaccination [76]. In two cases, acute disseminated encephalomyelitis following COVID-19 vaccination has been reported. In first such case a 46-year-old woman received Sinovac inactivated SARS-CoV-2 vaccine before onset of clinical manifestations. Patient was presented with seizures, and magnetic resonance imaging revealed multiple, discrete T2/FLAIR periventricular. hyperintense lesions. Patient improved following methylprednisolone treatment [70] Another patient was a 24-year-old female who presented with encephalopathy along with limb weakness of 1-day duration. Two weeks prior, patient was vaccinated with inactivated SARS-CoV-2 vaccine. Magnetic resonance imaging revealed multiple, discrete T2/FLAIR hyperintense lesions in the brain. Patient improved following treatment with antiepileptics and intravenous immunoglobulins [71].

Post-vaccinal encephalitis

Zuhorn et al. reported a case series 3 patients, who presented with post-vaccinal encephalitis, akin to autoimmune encephalitis, 7 to 11 days after administration of adenovirus-based ChAdOx1 nCov-19 vaccine. All patients fulfilled the diagnostic criteria for possible autoimmune encephalitis. One interesting case had presented with opsoclonus-myoclonus syndrome. Two patients presented with cognitive decline, seizures, and gait disorder. Neuroimaging did not reveal any abnormality. CSF pleocytosis was noted in all three patients. All patients responded well to corticosteroids [75].

Transverse myelitis

Acute transverse myelitis is an inflammatory spinal cord disorder that clinically manifests with the paraparesis/quadriparesis, transverse sensory level, and bowel or bladder dysfunction. Acute transverse myelitis usually is a postinfectious disorder. Magnetic resonance imaging demonstrates T2/FLAIR hyperintensity extending several spinal cord segments. Autoimmunity via mechanism of molecular mimicry is usually responsible for spinal cord dysfunction. Adenoviral vector-based COVID-19 vaccines are more frequently associated with causation of transverse myelitis. In isolated cases, even inactivated virus vaccine and mRNA-based vaccines had precipitated acute demyelination spinal cord syndromes, like multiple sclerosis and neuromyelitis optica. Reports of myelitis associated with vaccination for SARS-CoV-2 are summarized in Table ​Table44 [7783].

Table 4

Clinical, neuroimaging, and outcome details of patients who presented with spinal cord involvement after vaccination against SARS-CoV-2

ReferenceNeurological complicationCountryAge/sexVaccine typeDuration after vaccinationClinical featuresNeuroimagingTreatmentOutcome
Malhotra et al. [77]Transverse myelitisIndia36/MViral-vectored, recombinant ChAdOX1 nCoV-19 Covishield vaccine (AstraZeneca vaccine by Serum Institute of India)On the 8th post-vaccination dayAbnormal sensations in lower limbs with truncal levelT2-hyperintense lesion in the dorsal aspect of spinal cord at C6 and C7 vertebral levelsMethylprednisoloneImproved
Fitzsimmons and Nance [78]Transverse myelitisUSA63/MSecond dose of the Moderna vaccineWithin 1 dayLower back pain, paresthesia in both feet, and pain in lower extremities difficulty in walking and urinary retentionIncreased T2 cord signal seen in the distal spinal cord and conusIntravenous immunoglobulin and methylprednisoloneImproved
Tahir et al. [79]Transverse myelitisUSA44/FAd26.COV2.S (Johnson & Johnson) vaccine10 daysCervical cord transverse myelopathy CSF increased cellsIncreased T2 cord signal seen in the spinal cord extending from the C2-3 segment into the upper thoracic regionPlasma exchange and methylprednisoloneImproved
Pagenkopf and Südmeyer [80]Longitudinally extensive transverse myelitisGermany45/MFirst dose COVID-19-vaccine (AZD1222, AstraZeneca)11 daysThoracic back pain and urinary retentionT2 hyperintense signal of the spinal cord with wide axial and longitudinal extent reaching from C3 to Th2PrednisoloneImproved
Helmchen et al. [81]Optic neuritis with longitudinal extensive transverse myelitis in stable multiple sclerosisGermany40/FAstra Zeneca, COVID19 Vaccine®; Vaxzevria2 weeksBlindness paraplegia, with absent tendon reflexes in the legs, incontinence, and a sensory deficit for all qualities below Th5. CSF showed severe pleocytosis and elevated proteinIncreased longitudinal centrally located signal intensities throughout the thoracic spinal cordCorticosteroids and plasmapheresisImproved
Havla et al. [82]First manifestation of multiple sclerosisGermany28/FPfizer-BioNTech COVID-19 vaccine6 days first doseMyelitis oligoclonal bandsMRI revealed multiple (> 20), partially confluent lesions with spatial dissemination but no gadolinium enhancement. Contrast-enhancing lesion at the T6 level, suggestive of myelitisMethylprednisolone and plasma exchangeImproved
Chen et al. [83]Neuromyelitis optica spectrum disorderChinaMiddle-aged femaleThe first dose of inactivated virus vaccine3 daysDizziness and unsteady walking AQP4-positiveMRI scanning of the brain revealed area postrema and bilateral hypothalamus lesionsMethylprednisoloneImproved

Open in a separate window

Malhotra and colleagues reported a 36-year-old patient, who had short-segment myelitis 21 days after first dose of adenoviral vector-based (Oxford/AstraZeneca, COVISHIELD™) vaccine. Patient recovered completely after treatment with methylprednisolone [77]. Fitzsimmons and Nance reported another patient of acute transverse myelitis following Moderna vaccine (an mRNA vaccine). The 63-year-old patient developed symptoms of acute myelopathy within 24 h of vaccination. MRI revealed increased T2 cord signal seen in the distal spinal cord and conus. Patient improved considerably following treatment with methylprednisolone and intravenous immunoglobulin [78].

Earlier, in phase III trial of Oxford/AstraZeneca vaccine, 2 patients had developed transverse myelitis. One of the case of transverse myelitis was reported 14 days after booster vaccination. The expert committee considered that this case was the most likely an idiopathic, short segment transverse myelitis. The second case was reported 68 days post-vaccination. Experts believed that in this case, transverse myelitis was not likely to be associated with vaccination. This patient was earlier diagnosed as a case of multiple sclerosis [8485].

The pathogenesis of acute transverse myelitis following COVID-19 vaccination remains unknown. Possibly, SARS-CoV-2 antigens present in the COVID-19 vaccine or its adenovirus adjuvant induce immunological reaction in the spinal cord. The occurrence of 3 reported acute transverse myelitis adverse effects among 11,636 participants in the vaccine trials was considered high and a cause of concern [86].

Bell’s palsy

Several cases of Bell’s palsy have occurred following COVID-19 vaccination. (Table ​(Table5)5) [8795]. The instances of Bell’s palsy are most often associated with mRNA vaccines [96]. Vaccine-associated Bell’s palsy generally responds very well to the oral corticosteroids. The exact pathogenesis remains speculative.

Table 5

Summary of reported patients, who suffered from Bell’s palsy after vaccination against SARS-CoV-2

ReferenceNeurological complicationCountryAge/sexVaccine typeDuration after vaccinationClinical featuresNeuroimagingTreatmentOutcome
Shemer et al. (a report of 9 cases) [87]Bell’s palsyIsrael35–86 (M = 5 and F = 4)BNT162b2 SARS-CoV-2 vaccine4–30 days after first dose 3 received 2nd doseAcute facial weakness One had herpes zoster ophthalmicus and herpes zoster oticusNoneCorticosteroidsNot given
Repajic et al. [88]Bell’s palsyUSA57/FPfizer-BioNTech COVID-19 A messenger RNA (mRNA) vaccine36 h after second dose3 previous episodes of Bell’s palsy ageusia Facial weaknessNonePrednisoneImproved
Colella et al. [89]Bell’s palsyItaly37/MmRNA vaccine BNT162b25 days after first doseAcute facial weaknessNot doneCorticosteroidsImproved
Martin-Villares et al. [90]Bell’s palsySpain34/FModerna COVID-19 vaccine2 daysGrade III facial palsy She developed a right Bell’s palsy in 2012 during pregnancy (5th month)NoneCorticosteroidsImproved
Nishizawa et al. [91]Bell’s palsyJapan62/FAd26.COV2.S vaccination20 daysHouse-Brackmann score 4 Bell’s PalsyNormalNoneNone
Gómez de Terreros et al. [92]Bell’s palsySpain50/MPfizer-BNT162b2 mRNA vaccine9 daysMuscle weakness on the left side of his faceNormalCorticosteroidsImproved
Burrows et al. [93]Sequential contralateral facial nerve palsiesUKFirst and second doses of the Pfizer-BioNTech COVID-19 vaccineRight palsy, 5 h Left palsy after 2 daysTwo discrete contralateral episodes of Bell’s palsyNormalPrednisoloneImproved both the time
Obermann et al. [94]Bell’s palsyGermany21/FFirst dose of SARS-CoV-2 mRNA vaccine Comirnaty (BNT162b2, BioNTech/Pfizer)2 dayFacial muscle paralysis SARS-CoV-2 antibodies were present in blood and CSFNormalPrednisoloneImproved
Iftikhar et al. [95]Bell’s palsyQatar36/MSecond dose of the mRNA-1273 vaccine1 dayFacial palsyNormalPrednisoloneImproved

Open in a separate window

In a case–control study, Shemer et al. compared clinical parameters of patients with Bell’s palsy following mRNA vaccination with that of patients with Bell’s palsy without vaccination. Out of 37 patients, 21 had received vaccination. Bell’s palsy developed within 2 weeks following first dose of COVID-19 vaccination. There was no difference in any of the clinical parameter between vaccinated or unvaccinated groups [97].

Earlier, in the Pfizer-BioNTech clinical trial, which included 44,000 participants, 4 people had Bell’s palsy. No case of Bell’s palsy was reported in the placebo arm. In the Moderna trial, which included 30,400 participants, 3 vaccine recipients reported Bell’s palsy. One person was in the placebo arm [98]. An article, published in the Lancet, analyzed the combined phase 3 data of Pfizer and Moderna trials and noted that the rate of Bell’s palsy was higher than expected [98].

Other cranial nerve involvement

In isolated instances, mRNA vaccines were found associated with olfactory dysfunction and sixth cranial nerve palsy (Table ​(Table6)6) [99104].

Table 6

Summary of reported patients, who suffered from cranial nerve involvement (other than Bell’s palsy) after vaccination against SARS-CoV-2

ReferenceNeurological complicationCountryAge/sexVaccine typeDuration after vaccinationClinical featuresNeuroimagingTreatmentOutcome
Konstantinidis et al. [99] Report of 2 patientsOlfactory dysfunctionGreeceBoth femalePfizer-BioNTech BNT162b23 and 5 days after second doseHyposmia after their second doseNoneOlfactory trainingImproved
Keir et al. [100]PhantosmiaUSA57/FPfizer-BioNTech COVID-19 vaccination Second doseNoneFeeling weak, fatigued, with random episodes of ‘‘smelling smoke’’ associated with hyposmiaPostcontrast CT demonstrates faint enhancement left olfactory tract MRI enhancement of the left greater than right olfactory bulb and bilateral olfactory tractsNoneNone
Reyes-Capo et al. [101]Acute abducens nerve palsyUSA59/FPfizer-BioNTech COVID-19 vaccine2 daysFever for 1 day followed by diplopiaNormal MRI of brain and orbitsNot availableSensory-motor examination remained unchanged in recent follow-up
Parrino et al. [102]TinnitusItaly37/F 63/ 30/MBNT162b2 mRNA-vaccine7-h first dose 20 h 7 daysSudden unilateral tinnitusNormal MRICorticosteroids, in twoImproved all
Tseng et al. [103 ] PMID: 34,297,133Reversible tinnitus and cochleopathyTaiwan32/MFirst dosage of the AstraZeneca COVID-19 vaccine5 hHigh-pitch tinnitus and disturbed the normal hearing high fever with chills and myalgiaNot doneCorticosteroidsImproved
Narasimhalu et al. [104]Trigeminal and cervical radiculitisSingapore52/FPfizer-BioNTech vaccination (tozinameran)3 h first doseNumbness, swelling and pain over the left face and neckMRI of trigeminal nerve revealed thickening and perineural sheath enhancement of the V3 segment of the left trigeminal nerve The MRI of the cervical spine revealed spondylotic changesPregabalinImproved

Open in a separate window

Olfactory dysfunction

Olfactory dysfunction is the most frequent neurological complication of COVID-19. Konstantinidis and colleagues reported two cases of smell impairment after second dose of the BioNTechBNT162b2 vaccine (Pfizer) administration [51].

Keir and colleagues reported phantosmia following administration of Pfizer COVID-19 vaccine. Patient complained of constantly “smelling smoke” and headaches. MRI of brain of the patient showed enhancement of the olfactory bulbs and bilateral olfactory tracts [100].

Abducens nerve palsy

Reyes-Capo et al. reported a 59-year-old lady, who presented with an abducen nerve palsy 2 days post-vaccination (Pfizer-BioNTech mRNA vaccine). Neuroimaging in this patient was normal..

Otologic manifestations

A variety of otologic manifestations has been noted following COVID-19 vaccination. Parrino and colleagues described three patients with sudden unilateral tinnitus following BNT162b2 mRNA vaccine administration. Tinnitus rapidly resolved in 2 cases. Wichova and colleagues in a retrospective review recorded 30 patients, who either had significantly exacerbated otologic symptoms or had a new symptom after getting mRNA vaccine. Post-vaccination otologic manifestations included hearing loss with tinnitus, dizziness, or with vertigo. In some patients, with Menière’s disease or autoimmune inner ear disease, vaccine led to exacerbation of the pre-existing otologic symptoms [102,105].

Acute vision loss

Santovito and Pinna reported an unusual patient, who developed acute visual impairment following the 2nd dose of the Pfizer-BioNTech COVID-19 vaccine. Prior to visual symptoms, patient experienced unilateral headache. He also reported mild confusion, asthenia, and profound nausea. His symptoms got relieved after taking analgesics. Possibly, patient had an acute attack of migraine with aura that got precipitated by the vaccine [106].

Guillain-Barré syndrome

Guillain-Barré syndrome is a post-infectious disorder of peripheral nerve manifesting with lower motor neuron type of sensory-motor quadriparesis. Acute motor weakness is frequently preceded by an antecedent microbial infection. There are numerous reports indicating that COVID-19 infection can trigger Guillain-Barré syndrome. The US Food and Drug Administration has recently expressed its concern regarding a possible association between the Johnson and Johnson COVID-19 vaccine with Guillain-Barré syndrome [107].

After emergency use approvals, all kinds of COVID-19 vaccines were found associated with Guillain-Barré syndrome. Adenovector-based vaccines were more frequently associated with Guillain-Barré syndrome. Earlier, in phase 3 trial of Johnson and Johnson adenovirus vector-based COVID-19 vaccine, 2 patients developed Guillain-Barré syndrome. One patient belonged to vaccine group and other to placebo group. Both patients had Guillain-Barré syndrome within 2 weeks of receiving injections. The Guillain-Barré syndrome in the vaccine arm was preceded by chills, nausea, diarrhea, and myalgia [108109].

Post-vaccination Guillain-Barré syndrome generally affects older adults within 2 weeks of vaccine administration. Clinical presentation is similar to acute demyelinating neuropathy; nerve conduction studies show demyelinating pattern, and CSF examination shows cyto-albuminic dissociation. Many patients present only with facial diplegia. Response to immunotherapy is generally good. (Table ​(Table7)7) [110126].

Table 7

Summary of reported patients, who developed an acute peripheral nerve disorder after vaccination against SARS-CoV-2

ReferenceNeurological complicationCountryAge/sexVaccine typeDuration after vaccinationClinical featuresNeuroimagingTreatmentOutcome
Waheed et al. [110]Guillain-Barré syndromeUSA82/FPfizer-BioNTech COVID-19 A messenger RNA (mRNA) vaccine2 weeksAreflexic paraparesis with distal sensory loss CSF showed albuminocytologic dissociationenhancement of cauda equina nerve rootsIV immunoglobulinImproved
Márquez Loza et al. [111]Guillain-Barré syndromeUSA60/FJohnson & Johnson, d26.COV2.S, a recombinant adenovirus serotype 26 (Ad26) vector vaccine2 weeksOphthalmoplegia, facial diplegia and Areflexic quadriparesis CSF showed albuminocytologic dissociationEnhancement of cauda equina nerve rootsIV immunoglobulinImproved
Patel et al. [112]Guillain-Barré syndromeUK37/MCOVID-19 ChAdOx1 vaccine adenovirus-vectored vaccine Oxford AstraZeneca2 weeksSymmetrical, progressive ascending muscle weakness areflexic bilaterally in the lower limbsCauda equina nerve root enhancementIntravenous immunoglobulinImproved
Razok et al. [113]Guillain-Barré syndromeQatar73/MPfizer-BioNTech COVID-19 vaccine20 days Second doseAcute bilateral lower limb weaknessNoneIVIGImproved
Ogbebor et al. [114]Guillain-Barré syndromeUS86/3FPfizer-BioNTech COVID-19 vaccine1 dayWeakness in her bilateral lower extremities and by day 6, she could no longer walk CSF = a protein 162 mg/dL and glucose (49 mg/dL)NoneIntravenous immunoglobulinImproved
Finsterer  [115]Exacerbating Guillain-Barré syndromeAustria32/MA vector-based COVID-19 vaccine8 daysParesthesia and dysphagia bilateral frontal and nuchal headacheNoneIntravenous immunoglobulinImproved
Marammatom et al. [116] Report of 7 casesGuillain-Barré syndromeIndiaChAdOx1-S/nCoV-19 adenovector-based vaccineWithin 2 weeks of the first doseAll patients progressed to areflexic quadriplegia 2 cases required mechanical ventilation All 7 cases had bilateral facial paresis Four patients (57%) also developed other cranial neuropathies (4th and 5th)In two patients, MRI brain and spine were normalIntravenous immunoglobulinOne recovered Rest six still bed bound
Allen et al. [117] Report of 4 casesGuillain-Barré syndrome variantUK20–57 all malesOxford-AstraZeneca SARS-CoV2 vaccineWithin 3 weeksFacial weakness in 1 facial diplegia in 3 areflexic quadriparesis in 1 Cyto-albuminic dissociation in allMRI of the brain and whole spine with contrast showed enhancement of the facial nerve within the right internal auditory canalIntravenous immunoglobulin, oral steroids, or no treatmentAll improved
Kohli et al. [118]Guillain-Barré syndromeIndia71/MCovishield, AstraZeneca, University of Oxford6 daysAreflexic quadriparesis with bulbar palsy NCV- demyelinating patternNoneIntravenous immunoglobulin and mechanical ventilationImproved
Azam et al. [119]Guillain-Barré syndromeUK67/MThe first dose of the AstraZeneca COVID-1915 daysAreflexic quadriparesis with facial diplegiaNCV- demyelinating patternNormalIntravenous immunoglobulinImproved
Hasan et al. [120]Guillain-Barré syndromeUK62/FFirst dose of the Oxford/AstraZeneca COVID-19 vaccineWeakness of bilateral lower limbs preceded by paresthesia and numbness a flaccid-type paraplegia NCV- demyelinating pattern CSF-albumin-cytological dissociationNormalIntravenous immunoglobulinThe patient remains in the ICU
Theuriet et al. [121]Guillain-Barré syndromeFrance72/MFirst dose of ChAdOx1 nCoV-19 vaccine (VaxZevria/Oxford-AstraZeneca)3 weeksAreflexic quadriparesis with facial diplegia NCV- demyelinating patternNoneIntravenous immunoglobulinThe patient remains in the ICU
Bonifacio et al. [122] (A series of 5 cases)Guillain-Barré syndromeUK43/M 51 M 53/M 66/m 71/fVaxzevria AstraZeneca, University of Oxford COVID-19 vaccine11 days 7 days 7 days 8 days 12 daysBilateral facial weakness with paresthesia variant of Guillain-Barré syndrome NCV- demyelinating pattern in 4 patientsBilateral contrast enhancement along whole facial nerve in 3 patientsIntravenous immunoglobulin Was given in 2 patientsAll improved
Nasuelli et al. [123]Guillain-Barré syndromeItaly59/MChAdOx1 nCoV-19 vaccine10 daysAreflexic quadriparesis with facial diplegia NCV- demyelinating pattern in 4 patients CSF-albumin-cytological dissociationNormalIntravenous immunoglobulinImproved
Jain et al. [124]Guillain-Barré syndromeUSA65/FAd26.COV2.S (Johnson & Johnson) vaccine19 daysFacial diplegiaNormalIntravenous immunoglobulin And plasmapheresisImproved
McKean and Chircop [125]Guillain-Barré syndromeMalta48/MVaxzevria AstraZeneca, University of Oxford COVID-19 vaccine First dose10 daysFacial diplegia and severe back pain ascending paresthesia and bilateral progressive areflexic lower limb weakness. CSF-albumin-cytological dissociation NCV multifocal sensorimotor demyelinating polyneuropathyNormalIntravenous immunoglobulin and oral prednisoloneImproved
Bonifacio et al. [126] (a report of 5 cases)Guillain-Barré syndromeUK
Waheed et al. [127]Small fiber neuropathyUSA57/FPfizer-BioNTech COVID-19 A messenger RNA (mRNA) vaccine (Second dose)Subacute onsetIntense burning dysesthesias in the feet gradually spreading to the calves and minimally into the hands (Nerve biopsy proved small fiber neuropathy)NoneGabapentinSymptomatic improvement

Open in a separate window

Proposed pathogenesis of Guillain-Barré syndrome is an autoantibody-mediated immunological damage of peripheral nerves via mechanism of molecular mimicry between structural components of peripheral nerves and the microorganism. Lately, several cases of Guillain-Barré syndrome following COVID-19 vaccination have also been reported.

Small fiber neuropathy

Waheed et al. described a 57-year-old female, who presented with painful neuropathy following administration of the mRNA COVID-19 vaccine. Patient subacutely presented with intense peripheral burning sensations. Electrodiagnostic studies were normal. Skin biopsy proved small fiber neuropathy. Patient responded to gabapentin.(Table ​gabapentin.(Table7)7) [127].

Parsonage-Turner syndrome

Parsonage-Turner syndrome or neuralgic amyotrophy is clinically manifested with acute unilateral shoulder pain followed by brachial plexopathy. Parsonage-Turner syndrome is usually triggered by any infection, surgery, or rarely vaccination. In many reports, Parsonage-Turner syndrome has been described following COVID-19 vaccination.(Table ​vaccination.(Table8)8) [128130].

Table 8

Summary of reported patients, who developed neuralgic amyotrophy after vaccination against SARS-CoV-2

ReferenceNeurological complicationCountryAge/sexVaccine typeDuration after vaccinationClinical featuresNeuroimagingTreatmentOutcome
Mahajan et al. [128]Parsonage-Turner syndromeUSA50/MCOVID-19 BNT162b2 vaccination7 daysSudden onset of severe left periscapular pain after first dose One week after the second dose, the patient developed left hand grip and left wrist extension weakness. Electromyography showed decreased motor unit recruitmentNormalCorticosteroidsImproved
Diaz-Segarra et al. [129]Painless idiopathic neuralgic amyotrophyUSA35/FPfizer-BioNTech COVID-19 vaccine9 daysNew-onset painless left arm weakness, numbness, and paresthesiasCervical spine computed tomography showed mild degenerative changes without foraminal narrowingHigh-dose prednisoneImproved
Antonio Crespo Burillo et al. [130]Parsonage-Turner syndromeSpain38/MVaxzevria (AstraZeneca)4 daysShoulder and arm pain Electrophysiology suggested brachial plexopathyMRI of the shoulder revealed a mild left subacromial tendinopathyMethylprednisoloneImproved

Open in a separate window

Herpes zoster

Herpes zoster occurs following reactivation of varicella zoster virus. Patients with herpes zoster present with the classic maculopapular rash, which is unilateral, confined to a single dermatome. The rash disappears in 7 to 10 days. Postherpetic neuralgia is the frequent complication of herpes zoster, which is noted in 1 in 5 patients. McMahon and co-workers recorded 414 cutaneous reactions to mRNA COVID-19 vaccines, and 5 (1.9%) were diagnosed with herpes zoster [131]. Other types of COVID-19 vaccines are infrequently associated with post-vaccination reactivation of herpes zoster. It has been suggested that vaccine-induced immunomodulation, resulting in dysregulation of T cell function, is responsible for reactivation of herpes zoster virus [132133]. Reports of herpes zoster reactivation after vaccine against SARS-CoV-2 are summarized in Table ​Table99 [134142].

Table 9

Summary of reported patients, who developed Herpes zoster after vaccination against SARS-CoV-2

ReferenceNeurological complicationCountryAge/sexVaccine typeDuration after vaccinationClinical featuresNeuroimagingTreatmentOutcome
Tessas and Kluger [134]Herpes zosterFinland44/MBNT162b2 mRNA COVID-19 vaccine7 daysHerpetiform vesicular and erythematous rash on the left upper backNoneOral valacyclovirImproved
Rodríguez-Jiménez et al. [135] A report of 5 casesHerpes zosterSpain39–58 F = 3BNT162b2 mRNA COVID-19vaccine (Pfizer)1–16 (4 less than 7 days)Painful herpetiform dermatomal rashNoneNoneNone
Eid et al. [136]Herpes zosterLebanon79/MmRNA COVID vaccine6 daysPainful herpetiform dermatomal rashNoneAntiviral treatmentImproved
Bostan and Yalici-Armagan [137]Herpes zosterTurkey78/MInactivated COVID-19 vaccineErythematous, painful, and pruritic lesions on chest
Furer et al. [138] (a report of 6 cases)Herpes zosterIsrael36–61 All femalesBNT162b2 mRNA vaccination3 -14 daysAll had autoimmune inflammatory rheumatic diseases Herpes zoster ophthalmicus in one Truncal herpes zoster in othersNot doneNANA
Aksu and Öztürk et al. [139]Herpes zosterTurkey68/MThe inactivated COVID-19 vaccine5 daysmultiple pinheaded vesicular lesions upon an erythematous base occupying an area on his right mammary region and back corresponding to T3–T5 dermatomesNot doneValacyclovir paracetamolImproved
Chiu et al. [140] (a report of 3 cases)Herpes zosterTaiwan71/M 46/M 42/MPfizer-BNT162b2 mRNA and Moderna mRNA-12732 days 7 days 2 daysErythematous papules and vesicle in dermatomal patternNot doneOral acyclovirAll improved
Alpalhão and Filipe et al. [141] (a report of 4 cases)Herpes zosterPortugalNAPfizer’s Comirnaty™ vaccine AstraZeneca Vaxzevria™ vaccine3–6 daysErythematous papules and vesicle in dermatomal patternNot doneValacyclovirAll improved
Channa et al. [142]Herpes zosterUSA81/MmRNA-1273 (Moderna) Covid-19 vaccine3 daysA dermatomal rashNot doneNot availableNot available

Open in a separate window

Myositis and rhabdomyolysis

There are reports, which have indicated that COVID-19 vaccines have potential to damage the skeletal muscles as well (Table ​(Table10)10) [143147]. Tan and colleagues described a patient with a known carnitine palmitoyltransferase-II deficiency disorder, who developed fever, vomiting, shortness of breath, frank haematuria, myalgia and muscle weakness within four hours of receiving AstraZeneca COVID-19 vaccine [143]. Theodorou and colleagues described a 56-year-old woman who, 8 days after a second dose of vaccine administration, developed severe left upper arm pain along restricted shoulder movements. Her serum creatine kinase was elevated suggesting skeletal muscle damage. MRI revealed severely edematous deltoid muscles. Contrast-enhanced imaging demonstrated enhancement of deltoid muscles suggestive of myositis [146].

Table 10

Summary of reported patients, who developed an acute muscular disorder following vaccination against SARS-CoV-2

ReferenceNeurological complicationCountryAge/sexVaccine typeDuration after vaccinationClinical featuresNeuroimagingTreatmentOutcome
Tan et al. [143]Rhabdomyolysis in a patient with Carnitine palmitoyltransferase II deficiencyUK27/MCOVID-19 vaccine AstraZeneca5 hFever, vomiting, shortness of breath, frank hematuria, and myalgia CK concentration of 105,000 U/L and deranged liver function tests (ALT 300 U/L and AST 1496 U/L)NoneContinuous intravenous dextrose 10% and a high carbohydrate dietImproved
Mack et al. [144]RhabdomyolysisUSA80/MSecond dose of Moderna COVID-19 vaccine2 daysGeneralized body aches, nausea, and vomiting elevated CKNoneIV fluidsImproved
Nassar et al. [145]RhabdomyolysisUSA21/MFirst Pfizer/BioNTech COVID-19 vaccine1 daySevere back pain with radiation to his left lateral thigh Creatinine phosphokinase (CPK) level more than 22,000 U/LNormalIV fluidsImproved
Theodorou et al. [146]MyositisGreece56/FModified mRNA COVID-19 vaccine8 days after second doseThere was tenderness over the deltoid muscle, guarding, and decreased abduction of the shoulder and arm along with elevated CPKOn MRI, the deltoid muscle was edematous. On contrast enhancement, muscle exhibited enhancement indicating inflammationSymptomaticImproved
Godoy et al. [147]Myositis ossificansBrazil51/M3 monthsRight upper arm pain, soreness and palpable massIntramuscular nodule n the proximal fibers of the brachii muscle with perilesional muscle edema One week later, CT showed a hypoattenuating intramuscular nodule with internal calcificationsNSAIDsImproved

Open in a separate window

Conclusion

Post-authorization, a wide spectrum of serious neurological complications has been reported following COVID-19 vaccination. The most devastating neurological complication is cerebral venous sinus thrombosis that has been reported in females of childbearing age following adenovector-based vaccines. Another major neurological complication of concern is Bell’s palsy that was reported dominantly following mRNA vaccine administration. Transverse myelitis, acute disseminated encephalomyelitis, and Guillain-Barré syndrome are other severe unexpected post-vaccination complications that can occur as result of molecular mimicry and subsequent neuronal damage. Most of other serious neurological complications are reported in either in form of isolated case reports or small cases series. A causal association of these adverse events is controversial; large collaborative prospective studies are needed to prove causality.

References

1. World Health Organization. 12 January 2021. WHO Coronavirus (COVID-19) Dashboard. &It; The World Health Organization https://covid19.who.int/. Accessed 1 Aug 2021.

2. Jeff Craven. 10 June 2021. COVID-19 vaccine tracker. &It; https://www.raps.org/news-and-articles/news-articles/2020/3/covid-19-vaccine-tracker. Accessed 16 June 2021.

3. Piyasirisilp S, Hemachudha T. Neurological adverse events associated with vaccination. Curr Opin Neurol. 2002;15(3):333–338. doi: 10.1097/00019052-200206000-00018. [PubMed] [CrossRef] [Google Scholar]

4. Hause AM, Gee J, Johnson T, et al. Anxiety-related adverse event clusters after Janssen COVID-19 vaccination – five U.S. mass vaccination sites, April 2021. MMWR Morb Mortal Wkly Rep. 2021;70(18):685–688. doi: 10.15585/mmwr.mm7018e3. [PubMed] [CrossRef] [Google Scholar]

5. García-Grimshaw M, Ceballos-Liceaga SE, Hernández-Vanegas LE, et al. Neurologic adverse events among 704,003 first-dose recipients of the BNT162b2 mRNA COVID-19 vaccine in Mexico: a nationwide descriptive study. Clin Immunol. 2021;229:108786. doi: 10.1016/j.clim.2021.108786. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

6. Kim SH, Wi YM, Yun SY, et al. Adverse events in healthcare workers after the first dose of ChAdOx1 nCoV-19 or BNT162b2 mRNA COVID-19 vaccination: a single center experience. J Korean Med Sci. 2021;36(14):e107. doi: 10.3346/jkms.2021.36.e107. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

7. Lee YW, Lim SY, Lee JH, et al. Adverse reactions of the second dose of the BNT162b2 mRNA COVID-19 vaccine in healthcare workers in Korea. J Korean Med Sci. 2021;36(21):e153. doi: 10.3346/jkms.2021.36.e153. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

8. Göbel CH, Heinze A, Karstedt S, et al. 2021 Headache attributed to vaccination against COVID-19 (coronavirus SARS-CoV-2) with the ChAdOx1 nCoV-19 (AZD1222) vaccine: a multicenter observational cohort study [published online ahead of print, 2021 Jul 27]. Pain Ther. 1–22. [PMC free article] [PubMed]

9. Module 3. Adverse events following immunization. https://www.who.int/vaccine_safety/initiative/tech_support/Part-3.pdf?ua=1. Accessed 19 June 2021.1

0. Ng JH, Chaudhuri KR, Tan EK. Functional neurological disorders and COVID-19 vaccination. Ann Neurol. 2021;90(2):328. doi: 10.1002/ana.26160. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

11. Kim DD, Kung CS, Perez DL. Helping the public understand adverse events associated with COVID-19 vaccinations: lessons learned from functional neurological disorder. JAMA Neurol. 2021;78(7):789–790. doi: 10.1001/jamaneurol.2021.1042. [PubMed] [CrossRef] [Google Scholar]

12. Butler M, Coebergh J, Safavi F, et al. 2021 Functional neurological disorder after SARS-CoV-2 vaccines: two case reports and discussion of potential public health implications [published online ahead of print, 2021 Jul 15]. J Neuropsychiatry Clin Neurosci. appineuropsych21050116. 10.1176/appi.neuropsych.21050116 [PMC free article] [PubMed]

13. Ercoli T, Lutzoni L, Orofino G, Muroni A, Defazio G. 2021 Functional neurological disorder after COVID-19 vaccination [published online ahead of print, 2021 Jul 29]. Neurol Sci.;1–2. 10.1007/s10072-021-05504-8 [PMC free article] [PubMed]

14. Iba T, Levy JH, Warkentin TE. 2021 Recognizing vaccine-induced immune thrombotic thrombocytopenia [published online ahead of print, 2021 Jul 13]. Crit Care Med. 10.1097/CCM.0000000000005211 [PMC free article] [PubMed]

15. Pomara C, Sessa F, Ciaccio M, et al. 2021 Post-mortem findings in vaccine-induced thrombotic thombocytopenia [published online ahead of print, 2021 May 20]. Haematologica. 10.3324/haematol.2021.279075. [PMC free article] [PubMed]

16. Ledford H. COVID vaccines and blood clots: five key questions. Nature. 2021;592(7855):495–496. doi: 10.1038/d41586-021-00998-w. [PubMed] [CrossRef] [Google Scholar]

17. McGonagle D, De Marco G, Bridgewood C. Mechanisms of Immunothrombosis in vaccine-induced thrombotic thrombocytopenia (VITT) compared to natural SARS-CoV-2 Infection. J Autoimmun. 2021;121:102662. doi: 10.1016/j.jaut.2021.102662. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

18. Castelli GP, Pognani C, Sozzi C, Franchini M, Vivona L. Cerebral venous sinus thrombosis associated with thrombocytopenia post-vaccination for COVID-19. Crit Care. 2021;25(1):137. doi: 10.1186/s13054-021-03572-y. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

19. D’Agostino V, Caranci F, Negro A, et al. A rare case of cerebral venous thrombosis and disseminated intravascular coagulation temporally associated to the COVID-19 vaccine administration. J Pers Med. 2021;11(4):285. doi: 10.3390/jpm11040285. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

20. Scully M, Singh D, Lown R, et al. Pathologic antibodies to platelet factor 4 after ChAdOx1 nCoV-19 vaccination. N Engl J Med. 2021;384(23):2202–2211. doi: 10.1056/NEJMoa210538512. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

21. Franchini M, Testa S, Pezzo M, et al. Cerebral venous thrombosis and thrombocytopenia post-COVID-19 vaccination. Thromb Res. 2021;202:182–183. doi: 10.1016/j.thromres.2021.04.001. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

22. Mehta PR, Apap Mangion S, Benger M, et al. Cerebral venous sinus thrombosis and thrombocytopenia after COVID-19 vaccination – a report of two UK cases. Brain Behav Immun. 2021;95:514–517. doi: 10.1016/j.bbi.2021.04.006.11. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

23. Bersinger S, Lagarde K, Marlu R, Pernod G, Payen JF. Using nonheparin anticoagulant to treat a near-fatal case with multiple venous thrombotic lesions during ChAdOx1 nCoV-19 vaccination-related vaccine-induced immune thrombotic thrombocytopenia. Crit Care Med. 2021;49(9):e870–e873. doi: 10.1097/CCM.0000000000005105. [PubMed] [CrossRef] [Google Scholar]

24. Ramdeny S, Lang A, Al-Izzi S, Hung A, Anwar I, Kumar P. Management of a patient with a rare congenital limb malformation syndrome after SARS-CoV-2 vaccine-induced thrombosis and thrombocytopenia (VITT) [published online ahead of print, 2021 Jun 7]. Br J Haematol. 2021. 10.1111/bjh.17619. [PMC free article] [PubMed]

25. Zakaria Z, Sapiai NA, Ghani ARI. Cerebral venous sinus thrombosis 2 weeks after the first dose of mRNA SARS-CoV-2 vaccine. Acta Neurochir (Wien) 2021;163(8):2359–2362. doi: 10.1007/s00701-021-04860-w. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

26. Ryan E, Benjamin D, McDonald I, et al. AZD1222 vaccine-related coagulopathy and thrombocytopenia without thrombosis in a young female. Br J Haematol. 2021;194(3):553–556. doi: 10.1111/bjh.17530. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

27. Graf T, Thiele T, Klingebiel R, Greinacher A, Schäbitz WR, Greeve I. 2021 Immediate high-dose intravenous immunoglobulins followed by direct thrombin-inhibitor treatment is crucial for survival in Sars-Covid-19-adenoviral vector vaccine-induced immune thrombotic thrombocytopenia VITT with cerebral sinus venous and portal vein thrombosis [published online ahead of print, May 22]. J Neurol. 2021;1–3. 10.1007/s00415-021-10599-2 [PMC free article] [PubMed]

28. George G, Friedman KD, Curtis BR, Lind SE. 2021 Successful treatment of thrombotic thrombocytopenia with cerebral sinus venous thrombosis following Ad26.COV2.S vaccination [published online ahead of print, 2021 May 14]. Am J Hematol. 10.1002/ajh.26237. [PubMed]

29. Jamme M, Mosnino E, Hayon J, Franchineau G. Fatal cerebral venous sinus thrombosis after COVID-19 vaccination. Intensive Care Med. 2021;47(7):790–791. doi: 10.1007/s00134-021-06425-y. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

30. Tiede A, Sachs UJ, Czwalinna A, et al. Prothrombotic immune thrombocytopenia after COVID-19 vaccine [published online ahead of print, 2021 Apr 28]. Blood. 2021;blood.2021011958. 10.1182/blood.2021011958. 13

31. Schulz JB, Berlit P, Diener HC, Gerloff C, Greinacher A, Klein C. 2021 COVID-19 vaccine-associated cerebral venous thrombosis in Germany. medRxiv.04.30.21256383; doi: 10.1101/2021.04.30.21256383. 14 [PMC free article] [PubMed]

32. Bourguignon A, Arnold DM, Warkentin TE, et al. 2021 Adjunct immune globulin for vaccine-induced thrombotic thrombocytopenia [published online ahead of print, 2021 Jun 9]. N Engl J Med. 10.1056/NEJMoa2107051. [PMC free article] [PubMed]

33. Gattringer T, Gressenberger P, Gary T, Wölfler A, Kneihsl M, Raggam RB. 2021 Successful management of vaccine-induced immune thrombotic thrombocytopenia-related cerebral sinus venous thrombosis after ChAdOx1 nCov-19 vaccination [published online ahead of print, 2021 Jul 8]. Stroke Vasc Neurol.svn-2021–001142. 10.1136/svn-2021-001142 [PMC free article] [PubMed]

34. Ikenberg B, Demleitner AF, Thiele T, et al. Cerebral venous sinus thrombosis after ChAdOx1 nCov-19 vaccination with a misleading first cerebral MRI scan. Stroke Vasc Neurol. 2021;8:svn-2021–001095. doi: 10.1136/svn-2021-001095. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

35. Clark RT, Johnson L, Billotti J, et al. Early outcomes of bivalirudin therapy for thrombotic thrombocytopenia and cerebral venous sinus thrombosis after Ad26.COV2.S vaccination. Ann Emerg Med. 2021;S0196 0644(21):00342 5. doi: 10.1016/j.annemergmed.2021.04.035. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

36. Bonato S, Artoni A, Lecchi A, et al. 2021 Massive cerebral venous thrombosis due to vaccine-induced immune thrombotic thrombocytopenia [published online ahead of print, 2021 Jul 15]. Haematologica. 10.3324/haematol.2021.279246 [PMC free article] [PubMed]

37. Wang RL, Chiang WF, Shyu HY, et al. COVID-19 vaccine-associated acute cerebral venous thrombosis and pulmonary artery embolism. QJM. 2021;10:hcab185. doi: 10.1093/qjmed/hcab185. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

38. Dutta A, Ghosh R, Bhattacharya D, et al. Anti-PF4 antibody negative cerebral venous sinus thrombosis without thrombocytopenia following immunization with COVID-19 vaccine in an elderly non-comorbid Indian male, managed with conventional heparin-warfarin based anticoagulation. Diabetes Metab Syndr. 2021;15(4):102184. doi: 10.1016/j.dsx.2021.06.021. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

39. Aladdin Y, Algahtani H, Shirah B. Vaccine-induced immune thrombotic thrombocytopenia with disseminated intravascular coagulation and death following the ChAdOx1 nCoV-19 Vaccine. J Stroke Cerebrovasc Dis. 2021;30(9):105938. doi: 10.1016/j.jstrokecerebrovasdis.2021.105938. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

40. Lavin M, Elder PT, O’Keeffe D, et al. Vaccine-induced immune thrombotic thrombocytopenia (VITT) – a novel clinico-pathological entity with heterogeneous clinical presentations [published online ahead of print, 2021 Jun 22]. Br J Haematol. 2021. 10.1111/bjh.17613. [PMC free article] [PubMed]

41. Tølbøll Sørensen AL, Rolland M, Hartmann J, et al. A case of thrombocytopenia and multiple thromboses after vaccination with ChAdOx1 nCoV-19 against SARS-CoV-2. Blood Adv. 2021;5(12):2569–2574. doi: 10.1182/bloodadvances.2021004904. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

42. Fan BE, Shen JY, Lim XR, et al. Cerebral venous thrombosis post BNT162b2 mRNA SARS-CoV-2 vaccination: a black swan event. Am J Hematol. 2021;96(9):E357–E361. doi: 10.1002/ajh.26272. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

43. Suresh P, Petchey W. ChAdOx1 nCOV-19 vaccine-induced immune thrombotic thrombocytopenia and cerebral venous sinus thrombosis (CVST) BMJ Case Rep. 2021;14(6):e243931. doi: 10.1136/bcr-2021-243931. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

44. Dias L, Soares-Dos-Reis R, Meira J, et al. Cerebral venous thrombosis after BNT162b2 mRNA SARS-CoV-2 vaccine. J Stroke Cerebrovasc Dis. 2021;30(8):105906. doi: 10.1016/j.jstrokecerebrovasdis.2021.105906. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

45. Guan CY, Tsai SH, Fan JS, Lin YK, Kao CC. 2021 A rare case of a middle-age Asian male with cerebral venous thrombosis after COVID-19 AstraZeneca vaccination [published online ahead of print, Jul 8]. Am J Emerg Med. 2021;S0735–6757(21)00571–4. 10.1016/j.ajem.2021.07.011 [PMC free article] [PubMed]

46. Varona JF, García-Isidro M, Moeinvaziri M, Ramos-López M, Fernández-Domínguez M. 2021 Primary adrenal insufficiency associated with Oxford-AstraZeneca ChAdOx1 nCoV-19 vaccine-induced immune thrombotic thrombocytopenia (VITT) [published online ahead of print, Jul 10]. Eur J Intern Med. 2021;S0953–6205(21)00236–3. 10.1016/j.ejim.2021.06.025 [PMC free article] [PubMed]

47. Pottegård A, Lund LC, Karlstad Ø, et al. Arterial events, venous thromboembolism, thrombocytopenia, and bleeding after vaccination with Oxford-AstraZeneca ChAdOx1-S in Denmark and Norway: population based cohort study. BMJ. 2021;373:n1114. doi: 10.1136/bmj.n1114. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

48. Krzywicka K, Heldner MR, Sánchez van Kammen M, et al. Post-SARS-CoV-2-vaccination cerebral venous sinus thrombosis: an analysis of cases notified to the European Medicines Agency. Eur J Neurol. 2021;28(11):3656–3662. doi: 10.1111/ene.15029. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

49. National Institute for Health and Care Excellence. 29 July 2021. COVID-19 rapid guideline: vaccine-induced immune thrombocytopenia and thrombosis (VTT). &It; https://www.nice.org.uk/guidance/ng200/resources/covid19-rapid-guideline-vaccineinduced-immune-thrombocytopenia-and-thrombosis-vitt-pdf-51036811744. Accessed 2 Aug 2021.

50. Krzywicka K, Heldner MR, Sánchez van Kammen M, et al. Post-SARS-CoV-2-vaccination cerebral venous sinus thrombosis: an analysis of cases notified to the European Medicines Agency. Eur J Neurol. 2021;28(11):3656 3662. doi: 10.1111/ene.15029. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

51. Bersinger S, Lagarde K, Marlu R, Pernod G, Payen JF. Using nonheparin anticoagulant to treat a near-fatal case with multiple venous thrombotic lesions during ChAdOx1 nCoV-19 vaccination-related vaccine-induced immune thrombotic thrombocytopenia. Crit Care Med. 2021;49(9):e870–e873. doi: 10.1097/CCM.0000000000005105. [PubMed] [CrossRef] [Google Scholar]

52. Simpson CR, Shi T, Vasileiou E, et al. First-dose ChAdOx1 and BNT162b2 COVID-19 vaccines and thrombocytopenic, thromboembolic and hemorrhagic events in Scotland. Nat Med. 2021;27(7):1290–1297. doi: 10.1038/s41591-021-01408-4. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

53. Athyros VG, Doumas M. 2021 A possible case of hypertensive crisis with intracranial haemorrhage after an mRNA Anti-COVID-19 vaccine [published online ahead of print, 2021 May 21]. Angiology.;33197211018323. 10.1177/00033197211018323 [PubMed]

54. Bjørnstad-Tuveng TH, Rudjord A, Anker P. 2021 Fatal cerebral haemorrhage after COVID-19 vaccine. Fatal hjerneblødning etter covid-19-vaksine. Tidsskr Nor Laegeforen. 2021;141. 10.4045/tidsskr.21.0312. [PubMed]

55. de Mélo Silva ML Jr, Lopes DP. 2021 Large hemorrhagic stroke after ChAdOx1 nCoV-19 vaccination: a case report [published online ahead of print, 2021 Jul 17]. Acta Neurol Scand. 10.1111/ane.13505. [PMC free article] [PubMed]

56. Bayas A, Menacher M, Christ M, Behrens L, Rank A, Naumann M. Bilateral superior ophthalmic vein thrombosis, ischaemic stroke, and immune thrombocytopenia after ChAdOx1 nCoV-19 vaccination. Lancet. 2021;397(10285):e11. doi: 10.1016/S0140-6736(21)00872-2. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

57. Al-Mayhani T, Saber S, Stubbs MJ, et al. Ischaemic stroke as a presenting feature of ChAdOx1 nCoV-19 vaccine-induced immune thrombotic thrombocytopenia. J Neurol Neurosurg Psychiatry. 2021;92(11):1247–1248. doi: 10.1136/jnnp-2021-326984. [PubMed] [CrossRef] [Google Scholar]

58. Blauenfeldt RA, Kristensen SR, Ernstsen SL, Kristensen CCH, Simonsen CZ, Hvas AM. Thrombocytopenia with acute ischemic stroke and bleeding in a patient newly vaccinated with an adenoviral vector-based COVID-19 vaccine. J Thromb Haemost. 2021;19(7):1771–1775. doi: 10.1111/jth.15347. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

59. Malik B, Kalantary A, Rikabi K, Kunadi A. Pulmonary embolism, transient ischaemic attack and thrombocytopenia after the Johnson & Johnson COVID-19 vaccine. BMJ Case Rep. 2021;14(7):e243975. doi: 10.1136/bcr-2021-243975. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

60. Finsterer J, Korn M. 2021 Aphasia seven days after second dose of an mRNA-based SARS-CoV-2 vaccine [published online ahead of print, 2021 Jun 24]. Brain Hemorrhages. 10.1016/j.hest.2021.06.001. [PMC free article] [PubMed]

61. Walter U, Fuchs M, Grossmann A, et al. 2021 Adenovirus-vectored COVID-19 vaccine-induced immune thrombosis of carotid artery: a case report [published online ahead of print, 2021 Jul 26]. Neurology. 10.1212/WNL.0000000000012576. [PubMed]

62. Baldelli L, Amore G, Montini A, et al. Hyperacute reversible encephalopathy related to cytokine storm following COVID-19 vaccine. J Neuroimmunol. 2021;358:577661. doi: 10.1016/j.jneuroim.2021.577661. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

63. Aladdin Y, Shirah B. New-onset refractory status epilepticus following the ChAdOx1 nCoV-19 vaccine. J Neuroimmunol. 2021;357:577629. doi: 10.1016/j.jneuroim.2021.577629. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

64. Ghosh R, Dubey S, Roy D, Mandal A, Naga D, Benito-León J. Focal onset non-motor seizure following COVID-19 vaccination: a mere coincidence? Diabetes Metab Syndr. 2021;15(3):1023–1024. doi: 10.1016/j.dsx.2021.05.003. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

65. Liu BD, Ugloini C, Jha P. Two cases of post-Moderna COVID-19 vaccine encephalopathy associated with nonconvulsive status epilepticus. Cureus. 2021;13(7):e16172. doi: 10.7759/cureus.16172. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

66. Naharci MI, Tasci I. 2021 Delirium in a patient with Alzheimer’s dementia following COVID-19 vaccination [published online ahead of print, 2021 Jul 10]. Psychogeriatrics. 10.1111/psyg.12747. [PMC free article] [PubMed]

67. Salinas MR, Dieppa M. Transient akathisia after the SARS-Cov-2 vaccine. Clin Park Relat Disord. 2021;4:100098. doi: 10.1016/j.prdoa.2021.100098. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

68. Zavala-Jonguitud LF, Pérez-García CC. Delirium triggered by COVID-19 vaccine in an elderly patient. Geriatr Gerontol Int. 2021;21(6):540. doi: 10.1111/ggi.14163. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

69. Alfishawy M, Bitar Z, Elgazzar A, Elzoueiry M. 2021 Neuroleptic malignant syndrome following COVID-19 vaccination [published online ahead of print, Feb 20]. Am J Emerg Med. 2021;S0735–6757(21)00117–0. 10.1016/j.ajem.2021.02.011 [PMC free article] [PubMed]

70. Ozgen Kenangil G, Ari BC, Guler C, Demir MK. Acute disseminated encephalomyelitis-like presentation after an inactivated coronavirus vaccine. Acta Neurol Belg. 2021;121(4):1089–1091. doi: 10.1007/s13760-021-01699-x. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

71. Cao L, Ren L. Acute disseminated encephalomyelitis after severe acute respiratory syndrome coronavirus 2 vaccination: a case report. Acta Neurol Belg. 2021;1:1–3. doi: 10.1007/s13760-021-01608-2. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

72. Raknuzzaman M, Jannaty T, Hossain MB, Saha B, Dey SK, Shahidullah M. 2021 Post Covid 19 vaccination acute disseminated encephalomyelitis: a case report in Bangladesh. Int J Med Sci Clin Res Studies 3. 10.47191/ijmscrs/v1-i3-01

73. Torrealba-Acosta G, Martin JC, Huttenbach Y, et al. Acute encephalitis, myoclonus and Sweet syndrome after mRNA-1273 vaccine. BMJ Case Rep. 2021;14(7):e243173. doi: 10.1136/bcr-2021-243173. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

74. Vogrig A, Janes F, Gigli GL. Acute disseminated encephalomyelitis after SARS-CoV-2 vaccination. Clin Neurol Neurosurg. 2021;208:106839. doi: 10.1016/j.clineuro.2021.106839. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

75. Zuhorn F, Graf T, Klingebiel R, Schäbitz WR, Rogalewski A. Postvaccinal encephalitis after ChAdOx1 nCov-19. Ann Neurol. 2021;90(3):506–511. doi: 10.1002/ana.26182. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

76. Pellegrino P, Carnovale C, Perrone V, et al. Acute disseminated encephalomyelitis onset: evaluation based on vaccine adverse events reporting systems. PLoS One. 2013;8(10):e77766. doi: 10.1371/journal.pone.0077766. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

77. Malhotra SH, Gupta P, Prabhu V, Garg RK, Dandu H, Agarwal V. COVID-19 vaccination-associated myelitis [published online ahead of print, 2021 Mar 31]. QJM. 2021;hcab069. 10.1093/qjmed/hcab069 [PMC free article] [PubMed]

78. Fitzsimmons, William and Nance, Christopher S., Sudden onset of myelitis after COVID-19 vaccination: an under-recognized severe rare adverse event (May 5, 2021). Available at SSRN: https://ssrn.com/abstract=3841558 or 10.2139/ssrn.3841558

79. Tahir N, Koorapati G, Prasad S, et al. SARS-CoV-2 vaccination-induced transverse myelitis. Cureus. 2021;13(7):e16624. doi: 10.7759/cureus.16624. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

80. Pagenkopf C, Südmeyer M. A case of longitudinally extensive transverse myelitis following vaccination against Covid-19. J Neuroimmunol. 2021;358:577606. doi: 10.1016/j.jneuroim.2021.577606. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

81. Helmchen C, Buttler GM, Markewitz R, Hummel K, Wiendl H, Boppel T. 2021 Acute bilateral optic/chiasm neuritis with longitudinal extensive transverse myelitis in longstanding stable multiple sclerosis following vector-based vaccination against the SARS-CoV-2 [published online ahead of print, Jun 15]. J Neurol. 2021;1–6. 10.1007/s00415-021-10647-x [PMC free article] [PubMed]

82. Havla J, Schultz Y, Zimmermann H, Hohlfeld R, Danek A, Kümpfel T. 2021 First manifestation of multiple sclerosis after immunization with the Pfizer-BioNTech COVID-19 vaccine [published online ahead of print, 2021 Jun 11]. J Neurol. 1–4. 10.1007/s00415-021-10648-w [PMC free article] [PubMed]

83. Chen S, Fan XR, He S, Zhang JW, Li SJ. Watch out for neuromyelitis optica spectrum disorder after inactivated virus vaccination for COVID-19. Neurol Sci. 2021;42(9):3537–3539. doi: 10.1007/s10072-021-05427-4. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

84. Chagla Z. In adults, the Oxford/AstraZeneca vaccine had 70% efficacy against COVID-19 >14 d after the 2nd dose. Ann Intern Med. 2021;174(3):JC29. doi: 10.7326/ACPJ202103160-029. [PubMed] [CrossRef] [Google Scholar]

85. Knoll MD, Wonodi C. Oxford-AstraZeneca COVID-19 vaccine efficacy. Lancet. 2021;397(10269):72–74. doi: 10.1016/S0140-6736(20)32623-4. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

86. Román GC, Gracia F, Torres A, Palacios A, Gracia K, Harris D. Acute transverse myelitis (ATM):clinical review of 43 patients with COVID-19-associated ATM and 3 post-vaccination ATM serious adverse events with the ChAdOx1 nCoV-19 vaccine (AZD1222) Front Immunol.  2021;26(12):653786. doi: 10.3389/fimmu.2021.6537

86. PMID:33981305;PMCID:PMC8107358. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

87. Shemer A, Pras E, Hecht I. Peripheral facial nerve palsy following BNT162b2 (COVID-19) vaccination. Isr Med Assoc J. 2021;23(3):143–144. [PubMed] [Google Scholar]

88. Repajic M, Lai XL, Xu P, Liu A. Bell’s Palsy after second dose of Pfizer COVID-19 vaccination in a patient with history of recurrent Bell’s palsy. Brain Behav Immun Health. 2021;13:100217. doi: 10.1016/j.bbih.2021.100217. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

89. Colella G, Orlandi M, Cirillo N. 2021 Bell’s palsy following COVID-19 vaccination [published online ahead of print, 2021 Feb 21]. J Neurol. 1–3. doi:10.1007/s00415-021-10462-4 [PMC free article] [PubMed]

90. Martin-Villares C, Vazquez-Feito A, Gonzalez-Gimeno MJ, de la Nogal-Fernandez B. 2021 Bell’s palsy following a single dose of mRNA SARS-CoV-2 vaccine: a case report [published online ahead of print, 2021 May 25]. J Neurol. 1–2. doi:10.1007/s00415-021-10617-3 [PMC free article] [PubMed]

91. Nishizawa Y, Hoshina Y, Baker V. 2021 Bell’s palsy following the Ad26.COV2.S COVID-19 vaccination [published online ahead of print, 2021 May 20]. QJM.;hcab143. doi:10.1093/qjmed/hcab143 [PMC free article] [PubMed]

92. Gómez de Terreros Caro G, Díaz SG, Alé MP, Gimeno LM. 2021 PARÁLISIS DE BELL TRAS VACUNACIÓN COVID19: A PROPÓSITO DE UN CASO [BELL´S PALSY FOLLOWING COVID-19 VACCINATION: A CASE REPORT] [published online ahead of print, 2021 Apr 12]. Neurologia (Engl Ed). 10.1016/j.nrl.2021.04.004. [PMC free article] [PubMed]

93. Burrows A, Bartholomew T, Rudd J, Walker D. Sequential contralateral facial nerve palsies following COVID-19 vaccination first and second doses. BMJ Case Rep. 2021;14(7):e243829. doi: 10.1136/bcr-2021-243829. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

94. Obermann M, Krasniqi M, Ewers N, Fayad J, Haeberle U. Bell’s palsy following COVID-19 vaccination with high CSF antibody response. Neurol Sci. 2021;42(11):4397–4399. doi: 10.1007/s10072-021-05496-5. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

95. Iftikhar H, Noor SU, Masood M, et al. Bell’s palsy after 24 hours of mRNA-1273 SARS-CoV-2 vaccine. Cureus. 2021;13(6):e15935. doi: 10.7759/cureus.15935. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

96. Ozonoff A, Nanishi E, Levy O. 2021 Bell’s palsy and SARS-CoV-2 vaccines-an unfolding story – authors’ reply [published online ahead of print, 2021 Jun 7]. Lancet Infect Dis S1473–3099(21)00323–6. doi:10.1016/S1473-3099(21)00323-6 [PMC free article] [PubMed]

97. Shemer A, Pras E, Einan-Lifshitz A, Dubinsky-Pertzov B, Hecht I. Association of COVID-19 vaccination and facial nerve palsy: a case-control study. JAMA Otolaryngol Head Neck Surg. 2021;147(8):739–743. doi: 10.1001/jamaoto.2021.1259. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

98. Ozonoff A, Nanishi E, Levy O. Bell’s palsy and SARS-CoV-2 vaccines. Lancet Infect Dis. 2021;21(4):450–452. doi: 10.1016/S1473-3099(21)00076-1. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

99. Konstantinidis I, Tsakiropoulou E, Hähner A, de With K, Poulas K, Hummel T. 2021 Olfactory dysfunction after coronavirus disease 2019 (COVID-19) vaccination [published online ahead of print, 2021 May 28]. Int Forum Allergy Rhinol. 10.1002/alr.22809. [PMC free article] [PubMed]

100. Keir G, Maria NI, Kirsch CFE. Unique imaging findings of neurologic phantosmia following Pfizer-BioNtech COVID-19 vaccination: a case report. Top Magn Reson Imaging. 2021;30(3):133–137. doi: 10.1097/RMR.0000000000000287. [PubMed] [CrossRef] [Google Scholar]

101. Reyes-Capo DP, Stevens SM, Cavuoto KM. 2021 Acute abducens nerve palsy following COVID-19 vaccination [published online ahead of print, 2021 May 24]. J AAPOS S1091–8531(21)00109–9. doi:10.1016/j.jaapos.2021.05.003 [PMC free article] [PubMed]

102. Parrino D, Frosolini A, Gallo C, De Siati RD, Spinato G, de Filippis C. Tinnitus following COVID-19 vaccination: report of three cases. Int J Audiol. 2021;13:1–4. doi: 10.1080/ 14992027.2021.1931969. [PubMed] [CrossRef] [Google Scholar]

103. Tseng PT, Chen TY, Sun YS, Chen YW, Chen JJ. 2021 The reversible tinnitus and cochleopathy followed first-dose AstraZeneca COVID-19 vaccination [published online ahead of print, 2021 Jul 23]. QJM hcab210. doi:10.1093/qjmed/hcab210 [PMC free article] [PubMed]

104. Narasimhalu K, Lee WC, Salkade PR, De Silva DA. Trigeminal and cervical radiculitis after tozinameran vaccination against COVID-19. BMJ Case Rep. 2021;14(6):e242344. doi: 10.1136/bcr-2021-242344. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

105. Wichova H, Miller ME, Derebery MJ. Otologic manifestations after COVID-19 vaccination: the house ear clinic experience. Otol Neurotol. 2021;42(9):e1213–e1218. doi: 10.1097/MAO.0000000000003275. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

106. Santovito LS, Pinna G. Acute reduction of visual acuity and visual field after Pfizer-BioNTech COVID-19 vaccine 2nd dose: a case report. Inflamm Res. 2021;70(9):931–933. doi: 10.1007/s00011-021-01476-9. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

107. Dyer O. Covid-19: Regulators warn that rare Guillain-Barré cases may link to J&J and AstraZeneca vaccines. BMJ. 2021;374:n1786. doi: 10.1136/bmj.n1786. [PubMed] [CrossRef] [Google Scholar]

108. Márquez Loza AM, Holroyd KB, Johnson SA, Pilgrim DM, Amato AA. Guillain- Barré syndrome in the placebo and active arms of a COVID-19 vaccine clinical trial: temporal associations do not imply causality [published online ahead of print, 2021 Apr 6]. Neurology. 2021. 10.1212/WNL.0000000000011881. [PubMed]

109. FDA Briefing Document Janssen Ad26.COV2.S Vaccine for the prevention of COVID-1.26 February 2021. Vaccines and Related Biological Products Advisory Committee Meeting. &It; https://www.fda.gov/media/146217/download. Accessed 24 June 2021

110. Waheed S, Bayas A, Hindi F, Rizvi Z, Espinosa PS. Neurological complications of COVID-19: Guillain-Barre syndrome following Pfizer COVID-19 vaccine. Cureus. 2021;13(2):e13426. doi: 10.7759/cureus.13426. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

111. Márquez Loza AM, Holroyd KB, Johnson SA, Pilgrim DM, Amato AA. 2021 Guillain-Barré syndrome in the placebo and active arms of a COVID-19 vaccine clinical trial: temporal associations do not imply causality [published online ahead of print, 2021 Apr 6]. Neurology. 10.1212/WNL.0000000000011881. [PubMed]

112. Patel SU, Khurram R, Lakhani A, Quirk B. Guillain-Barre syndrome following the first dose of the chimpanzee adenovirus-vectored COVID-19 vaccine, ChAdOx1. BMJ Case Rep. 2021;14(4):e242956. doi: 10.1136/bcr-2021-242956. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

113. Razok A, Shams A, Almeer A et al. 2021 Post-COVID-19 vaccine Guillain-Barré syndrome; first reported case from Qatar. Authorea. May 07,. DOI: 10.22541/au.162041666.65803989/v1 [PMC free article] [PubMed]

114. Ogbebor O, Seth H, Min Z, Bhanot N. Guillain-Barré syndrome following the first dose of SARS-CoV-2 vaccine: a temporal occurrence, not a causal association. IDCases. 2021;24:e01143. doi: 10.1016/j.idcr.2021.e01143. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

115. Finsterer J. Exacerbating Guillain-Barré syndrome eight days after vector-based COVID-19 vaccination. Case Rep Infect Dis. 2021;2021:3619131. doi: 10.1155/2021/3619131. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

116. Maramattom BV, Krishnan P, Paul R, et al. Guillain-Barré syndrome following ChAdOx1-S/nCoV-19 vaccine. Ann Neurol. 2021;90(2):312–314. doi: 10.1002/ana.26143. [PubMed] [CrossRef] [Google Scholar]

117. Allen CM, Ramsamy S, Tarr AW, Tighe PJ, Irving WL, Tanasescu R, Evans JR. Guillain-Barré syndrome variant occurring after SARS-CoV-2 vaccination. Ann Neurol. 2021 doi: 10.1002/ ana.26144. [PubMed] [CrossRef] [Google Scholar]

118. Kohli S, Varshney M, Mangla S, Jaiswal B, Chhabra PH. Guillain-Barré syndrome after COVID-19 vaccine: should we assume a causal Link? International Journal of Medical and Pharmaceutical Case Reports. 2021;14(1):20–24. doi: 10.9734/ijmpcr/2021/ v14i130124. [CrossRef] [Google Scholar]

119. Azam S, Khalil A, Taha A. Guillain-Barré syndrome in a 67-year-old male post COVID-19 vaccination (Astra Zeneca) American Journal of Medical Case Reports. 2021;9(8):424–427. doi: 10.12691/ajmcr-9-8-10. [CrossRef] [Google Scholar]

120. Hasan T, Khan M, Khan F, Hamza G. Case of Guillain-Barré syndrome following COVID-19 vaccine. BMJ Case Rep. 2021;14(6):e243629. doi: 10.1136/bcr-2021-243629. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

121. Theuriet J, Richard C, Becker J, Pegat A, Bernard E, Vukusic S. 2021 Guillain-Barré syndrome following first injection of ChAdOx1 nCoV-19 vaccine: First report. Rev Neurol (Paris) S0035–3787(21)00585–3 doi:10.1016/j.neurol.2021.04.005 [PubMed]

122. Bonifacio GB, Patel D, Cook S, et al. 2021 Bilateral facial weakness with paraesthesia variant of Guillain-Barré syndrome following Vaxzevria COVID-19 vaccine [published online ahead of print, 2021 Jul 14]. J Neurol Neurosurg Psychiatry jnnp-2021–327027. doi:10.1136/jnnp-2021-327027 [PubMed]

123. Nasuelli NA, De Marchi F, Cecchin M, et al. A case of acute demyelinating polyradiculoneuropathy with bilateral facial palsy after ChAdOx1 nCoV-19 vaccine. Neurol Sci. 2021;42(11):4747–4749. doi: 10.1007/s10072-021-05467-w. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

124. Jain E, Pandav K, Regmi P, et al. Facial diplegia: a rare, atypical variant of Guillain-Barré syndrome and Ad26.COV2.S Vaccine. Cureus. 2021;13(7):e16612. doi: 10.7759/cureus.16612. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

125. McKean N, Chircop C. Guillain-Barré syndrome after COVID-19 vaccination. BMJ Case Rep. 2021;14(7):e244125. doi: 10.1136/bcr-2021-244125. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

126. Bonifacio GB, Patel D, Cook S, et al. 2021 Bilateral facial weakness with paraesthesia variant of Guillain-Barré syndrome following Vaxzevria COVID-19 vaccine [published online ahead of print, 2021 Jul 14]. J Neurol Neurosurg Psychiatry jnnp-2021–327027. doi:10.1136/jnnp-2021-327027 [PubMed]

127. Waheed W, Carey ME, Tandan SR, Tandan R. Post COVID-19 vaccine small fiber neuropathy. Muscle Nerve. 2021;64(1):E1–E2. doi: 10.1002/mus.27251. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

128. Mahajan S, Zhang F, Mahajan A, Zimnowodzki S. Parsonage Turner syndrome after COVID-19 vaccination. Muscle Nerve. 2021;64(1):E3–E4. doi: 10.1002/mus.27255. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

129. Diaz-Segarra N, Edmond A, Gilbert C, Mckay O, Kloepping C, Yonclas P. 2021 Painless idiopathic neuralgic amyotrophy after COVID-19 vaccination: a case report [published online ahead of print, 2021 Apr 22]. PM R.;10.1002/pmrj.12619 [PMC free article] [PubMed]

130. Antonio Crespo Burillo J, Martínez CL, Arguedas CG, Pueyo FJM. Neuralgia amiotrófica secundaria a vacuna contra COVID-19 Vaxzevria (AstraZeneca) [Amyotrophic neuralgia secondary to Vaxzevria (AstraZeneca) COVID-19 vaccine] Neurologia. 2021;36(7):571–572. doi: 10.1016/j.nrl.2021.05.007. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

131. McMahon DE, Amerson E, Rosenbach M, et al. Cutaneous reactions reported after Moderna and Pfizer COVID-19 vaccination: a registry-based study of 414 cases. J Am Acad Dermatol. 2021;85(1):46–55. doi: 10.1016/j.jaad.2021.03.092. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

132. Arora P, Sardana K, Mathachan SR, Malhotra P. 2021 Herpes zoster after inactivated COVID-19 vaccine: a cutaneous adverse effect of the vaccine [published online ahead of print, 2021 Jun 2]. J Cosmet Dermatol. 10.1111/jocd.14268. [PMC free article] [PubMed]

133. Lladó I, Fernández-Bernáldez A, Rodríguez-Jiménez P 2021. “Varicella zoster virus reactivation and mRNA vaccines as a trigger”. Reply to: Herpes-Zoster reactivation after mRNA-1273 (Moderna) SARS-CoV-2 Vaccination [published online ahead of print, 2021 Jul 22]. JAAD Case Rep. 10.1016/j.jdcr.2021.07.011. [PMC free article] [PubMed]

134. Tessas I, Kluger N. Ipsilateral herpes zoster after the first dose of BNT162b2 mRNA COVID-19 vaccine. J Eur Acad Dermatol Venereol. 2021;35(10):e620–e622. doi: 10.1111/jdv.17422. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

135. Rodríguez-Jiménez P, Chicharro P, Cabrera LM, et al. Varicella-zoster virus reactivation after SARS-CoV-2 BNT162b2 mRNA vaccination: Report of 5 cases. JAAD Case Rep. 2021;12:58–59. doi: 10.1016/j.jdcr.2021.04.014. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

136. Eid E, Abdullah L, Kurban M, Abbas O. Herpes zoster emergence following mRNA COVID-19 vaccine. J Med Virol. 2021 doi: 10.1002/jmv.27036. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

137. Bostan E, Yalici-Armagan B. Herpes zoster following inactivated COVID-19 vaccine: a coexistence or coincidence? J Cosmet Dermatol. 2021;20(6):1566–1567. doi: 10.1111/jocd.14035. [PubMed] [CrossRef] [Google Scholar]

138. Furer V, Zisman D, Kibari A, Rimar D, Paran Y, Elkayam O. 2021 Herpes zoster following BNT162b2 mRNA Covid-19 vaccination in patients with autoimmune inflammatory rheumatic diseases: a case series [published online ahead of print, 2021 Apr 12]. Rheumatology (Oxford) keab345. doi:10.1093/rheumatology/keab345 [PMC free article] [PubMed]

139. Aksu SB, Öztürk GZ. A rare case of shingles after COVID-19 vaccine: is it a possible adverse effect? Clin Exp Vaccine Res. 2021;10(2):198–201. doi: 10.7774/cevr.2021.10.2.198. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

140. Chiu HH, Wei KC, Chen A, Wang WH. 2021 Herpes zoster following COVID-19 vaccine: report of 3 cases [published online ahead of print, 2021 Jul 22]. QJM.;hcab208. 10.1093/qjmed/ hcab208 [PMC free article] [PubMed]

141. Alpalhão M, Filipe P. Herpes Zoster following SARS-CoV-2 vaccination – a series of 4 cases. J Eur Acad Dermatol Venereol. 2021;35(11):e750–e752. doi: 10.1111/jdv.17555. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

142. Channa L, Torre K, Rothe M. Letter to the editor: Herpes-Zoster reactivation after mRNA-1273 (Moderna) SARS-CoV-2 Vaccination. JAAD Case Rep. 2021;15:60–61. doi: 10.1016/j.jdcr.2021.05.042. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

143. Tan A, Stepien KM, Narayana STK. Carnitine palmitoyltransferase II deficiency and post-COVID vaccination rhabdomyolysis. QJM. 2021;19:hcab077. doi: 10.1093/qjmed/hcab077. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

144. Mack M, Nichols L, Guerrero DM. Rhabdomyolysis secondary to COVID-19 vaccination. Cureus. 2021;13(5):e15004. doi: 10.7759/cureus.15004. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

145. Nassar M, Chung H, Dhayaparan Y, et al. COVID-19 vaccine induced rhabdomyolysis: Case report with literature review. Diabetes Metab Syndr. 2021;15(4):102170. doi: 10.1016/j.dsx.2021.06.007. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

146. Theodorou DJ, Theodorou SJ, Axiotis A, Gianniki M, Tsifetaki N. COVID-19 vaccine-related myositis. QJM. 2021;1146(424):425. doi: 10.1093/qjmed/hcab043. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

147. Godoy IRB, Rodrigues TC, Skaf A. Myositis ossificans following COVID-19 vaccination. QJM. 2021;9:hcab161. doi: 10.1093/qjmed/hcab161. [PMC free article] [PubMed] [CrossRef] [Google Scholar]