Dr. Robert Malone: ‘Rotten to the Core’ FDA Knew COVID Vaccines Could Spur Viral Reactivation, But Said Nothing

Authors:  Debra Heine May 17, 2022

American Greatness

The Food and Drug Administration (FDA) was aware early on that the COVID vaccines could spur viral reactivation of diseases like the varicella-zoster virus (shingles) in some people, but chose not to disclose it, according to renowned vaccinologist and physician Dr. Robert Malone.

“They knew about the viral reactivation,” Malone declared during a recent panel discussion hosted by Del Bigtree with fellow Global COVID Summit physicians Dr. Ryan Cole, and Dr. Richard Urso.

Malone, the original inventor of mRNA and DNA vaccination technology, explained that he had been “very actively engaged” with senior personnel at the FDA in the Office of the Commissioner when the vaccines were being rolled out. The group, he noted, included Dr. William DuMouchel, the Chief Statistical Scientist for Oracle Health Sciences.

“We were talking by Zoom on a weekly or twice a week basis,” he said, regarding the early data on what risks were associated with vaccines.

“This is the group that first discovered the signal of the cardiotoxicity, the doctor continued. “They also knew at that time—one of them actually had the adverse event early on of shingles. They knew that the viral reactivation signal—which the CDC has never acknowledged—was one of the major known adverse events.”

Malone told the panel that it was a mistake to assume that the CDC and FDA—because they stayed silent—were unaware of the risk of viral reactivation associated with the vaccines.

“They absolutely did know, and they did not acknowledge it. It’s another one of those things that is inexplicable,” he said.

Malone pointed out that there are supposed to be strict rules in place for clinical researchers developing “these types of products.”

“You have to characterize where it goes, how long it sticks around, and how much protein it makes, or what the active drug product is. None of that stuff was done very well. It wasn’t done rigorously, and there was a series of misrepresentations about what the data were,” he said. “And the thing is, the FDA let them get away with it. They did not perform their function. They’re supposed to be independent gatekeepers.”

Normally, he pointed out, the FDA pays close attention to the the process, and if there are any red flags, the research is halted.

“What happened here is the regulatory bodies gave the pharmaceutical industry a pass,” Dr. Malone said, adding that Big Pharma also “misrepresented key facts about their product.”

“On the basis of that, average docs just assumed that this was something that it wasn’t. They assumed that this was a relatively benign product that didn’t stick around in the body. All of that is false,” he said.

“Many of us have been wracking our brains as you have to understand how this could possibly happen, why it’s possibly happening, and why is our regulatory apparatus, which we as physicians had all come to assume had a function that actually did the job that we could believe in and trust, and what we find out now is the whole house of cards is rotten to the core,” Malone concluded.

On May 11, the Global COVID Summit, a symposium of 17,000 other physicians and medical scientists from around the world, released its fourth declaration demanding that the state of medical emergency be lifted, scientific integrity restored, and crimes against humanity addressed.

COVID policies imposed over the past two years “are the culmination of a corrupt medical alliance of pharmaceutical, insurance, and healthcare institutions, along with the financial trusts which control them,” the signatories declare. “They have infiltrated our medical system at every level, and are protected and supported by a parallel alliance of big tech, media, academics and government agencies who profited from this orchestrated catastrophe.”

This “corrupt alliance” continues, they state,  “to advance unscientific claims by censoring data, and intimidating and firing doctors and scientists for simply publishing actual clinical results or treating their patients with proven, life-saving medicine.”

“These catastrophic decisions came at the expense of the innocent, who are forced to suffer health damage and death caused by intentionally withholding critical and time-sensitive treatments, or as a result of coerced genetic therapy injections, which are neither safe nor effective,” the signatories said.

The Centers for Disease Control and Prevention (CDC) on Friday released new data showing a total of 1,261,149 reports of adverse events following COVID-19 vaccines that were submitted between Dec. 14, 2020, and May 6, 2022, to the Vaccine Adverse Event Reporting System (VAERS).

According to the data, there was a total of 27,968 reports of deaths in that time frame, and 228,477 serious injuries.

Despite these alarming safety signals, the FDA on Tuesday approved of a booster dose of the Pfizer-BioNTech COVID-19 shot for children 5 through 11 years of age, even though research shows that the shots provide no benefit to children, and can, in fact, cause serious adverse effects and death.

Growing Number Of COVID-19 Deaths Among Vaccinated People: Federal Data

Authors: Katabella Roberts via The Epoch Times MY 13, 2022

An increasing number of COVID-19 deaths are occurring among individuals in the United States who have been vaccinated, according to federal data.

In August of 2021, roughly 18.9 percent of COVID-19 deaths happened among individuals who were vaccinated, an ABC News analysis of the data shows. Six months later in February 2022, that figure had risen to over 40 percent as the highly-transmissible Omicron variant made its way across the globe.

Similarly, in September 2021, just 1.1 percent of COVID-19 deaths occurred among Americans who had been fully vaccinated and boosted once. Five months later in February, that percentage had jumped to about 25 percent, according to ABC News.

A separate analysis of federal data by CNN shows that in the second half of September 2021—when the Delta variant was at its peak—less than a quarter of all COVID-19 deaths were among individuals who were vaccinated with at least two doses of the Moderna or Pfizer/BioNTech mRNA vaccines or a single dose of the Johnson & Johnson vaccine. However, just months later in January and February as Omicron surged, that figure had jumped to 40 percent.

Some experts believe the increase in deaths among fully vaccinated people or “breakthrough infections” in those who have received all their shots is not overly concerning, saying it is because while more and more people become fully vaccinated, new variants emerge and vaccine protection begins to wane as fewer people continue to get booster shots.

These data should not be interpreted as vaccines not working. In fact, these real-world analyses continue to reaffirm the incredible protection these vaccines afford especially when up to date with boosters,” said John Brownstein, an epidemiologist at Boston Children’s Hospital and an ABC News contributor.

Despite an increasing number of deaths among the vaccinated, the Centers for Disease Control and Prevention (CDC) states that vaccines are safe and effective. Data from the government agency says that overall, the risk of death from COVID-19 is roughly five times higher in unvaccinated individuals than in those who have had at least their initial dose of a vaccine.

However, in some cases, serious adverse events such as thrombosis with thrombocytopenia syndrome (blood clots), myocarditis (inflammation of the heart muscle), and pericarditis (inflammation of the outer lining of the heart) have been documented.

As of May 4, around 257.9 million people in the United States, or 77.7 percent of the total population in the nation have received at least one dose of vaccine, while roughly 219.9 million people, or 66.2 percent of the total U.S. population, have been fully vaccinated.

Around 100.9 million of those who are fully vaccinated have received a booster shot, while 49.4 percent of those eligible for booster shots have not yet had one.

As the Omicron variant swept through the nation, an increasing number of vulnerable, older populations were being hospitalized, and 73 percent of deaths have been among those 65 and older, despite the fact that 90 percent of seniors have had all of their vaccine shots.

However, a large percentage—a third of them—have not yet had their booster jab.

“This trend in increased risk among the elderly further supports the need for community-wide immunization,” Brownstein said. “Older populations, especially those with underlying conditions, continue to be at great risk of severe complications, especially as immunity wanes. The best way to protect them is to make sure everyone around them is fully immunized.”

The data comes a month after pharmaceutical and biotechnology company Moderna said that preliminary results from its study on a COVID-19 vaccine intended to protect against variants showed that it outperformed the company’s currently authorized booster shot, mRNA-1273.

Moderna said on April 19 that its mRNA-1273.211 shot, its first bivalent booster vaccine candidate, showed “superiority” against the Beta, Delta, and Omicron variants of the virus one month after being administered, compared to the booster shot of its original vaccine currently in use.

The Pfizer Clinical Trial: Is There Evidence of Fraud?

Authors:  Michelle Edwards -May 12, 202

Was the clinical trial for Pfizer’s mRNA-based gene-therapy “vaccine” fraudulent? Many are asking that question, and rightly so. Documents released in Nov. 2021 by the FDA as part of the court-mandated document dump show evidence of clinical trial enrollment at one particular trial site happening rapidly and just in time to meet the safety deadline for the FDA’s VRBPAC meeting on Dec. 10, 2020, to discuss Emergency Use Authorization (EUA) of the Pfizer-BioNTech COVID-19 jab in individuals 16 and older. Presented on Twitter by Jikkyleaks, the report has raised critical questions.  

The allegedly suspicious-looking clinical trial data surrounds “the biggest recruiter by far,” site 1231 (site 4444 was assigned site id 1231) in Argentina. Adding to the confusion, in five short days before the safety deadline (including a Sunday, 9/27/20), the trial recruited 1,275 of the 4,501 people using site number 4444. In just three weeks, the site recruited 4,501 patients—10% of the entire trial at one site. Overall, Pfizer rapidly recruited roughly 44,000 people for their trial, which took place at 152 locations worldwide and was overseen by numerous investigators, including Dr. Fernando Polack, who led the Argentinian study at Hospital Militar Central

As pointed out by Steve Kirsch, Polack is the Scientific Director of the INFANT Foundation in Buenos Aires. The Vanderbilt-affiliated foundation gives participants the opportunity to conduct biomedical translational research or pediatric rotations at hospitals and medical centers in Buenos Aires. Polack coordinates 26 hospitals in Argentina involving 467 doctors who were instantly recruited into the Pfizer trial. Kirsch said the “new data on Site 1231/4444 looks too good to be true,” but he also noted that all things considered, “it’s quite possible they pulled it off” and coordinated the trial in record time. Noting the infrastructure already in place at Hospital Militar Central, Kirsch referenced an article from Sept. 10, 2020, adding: 

“So if all 26 hospitals participated fully then that’s 57 patients per week per hospital which is possible if the sites have done this before and have a coordination framework for getting all 26 sites up and running at the same time. This means that everyone who was doing something else dropped what they were doing to switch over to the trial all at the same time.”

Still, as Professor Norman Fenton of Queen Mary London University pointed out, the circumstances surrounding the trial are remarkable. Fenton refers to a Substack two-part series on the Site 1231/4444 documents by el gato malo, who wrote that it is “basically impossible,” no matter who you are, to run a clinical trial this quickly. Malo added, “if this really happened, it would be a wonder of the world, and they should publish the process with pride and win 27 different prizes for it.” Malo continued, saying:

“They claim to have enrolled seven days a week for three weeks with zero gaps. Each patient requires a 250-page case report form. The lead investigator seems to have been Fernando Polack.

If indeed, the best way to get things done is to give them to busy people, then this was a great choice because, from the look of things, Fernando is one busy fellah and connected up the wazoo to boot. He also works with Vanderbilt, the FDA, and the Infant Foundation, funded by the Gates Foundation and the NIH.”

Kirsch remarked that Polack is the first author in the New England Journal of Medicine’s (NEJM) article on the Pfizer “vaccine,” titled “Safety and Efficacy of the BNT162b2 mRNA COVID-19 Vaccine.” Interestingly, in the disclosure form for the authors of the NEJM paper, Polack reported receiving personal fees from companies including Pfizer, Janssen, Regeneron, and Merck. Likewise, he disclosed grants from Novavax, Inc. Kirsch (who shared a video on Polack, but noticed no real “smoking gun”) highlighted a few exerts from the Dec. 31, 2020 paper, including:

“About 5,800 volunteers were enrolled, half getting the active vaccine. This is almost 4 times more than the next largest centre in this trial. Amazingly 467 doctors were almost instantly signed up and trained as assistant investigators in the study. Fernando was in command as Pfizer’s Principal Investigator.

Neither Augusto’s pericardial effusion, nor another volunteer’s penile vein thrombosis, appear to have found their way into the reported side effects of this trial.”

Exclusive: Pilots Injured by COVID Vaccines Speak Out: ‘I Will Probably Never Fly Again’

Authors: MICHAEL NEVRADAKIS  MAY 8, 2022 The Epoch Times Originally Published Children’s Defense Fund

In interviews with The Defender, pilots injured by COVID-19 vaccines said despite a “culture of fear and intimidation” they are compelled to speak out against vaccine mandates that rob pilots of their careers — and in some cases their lives.

As a commercial pilot, Bob Snow had long looked forward to seeing his daughter follow in his footsteps by helping her learn to fly an airplane.

However, having received the COVID-19 vaccine “under duress,” this dream is no longer a possibility for Snow.

“I will probably never fly again,” Snow said in a video he made about his story. “I was hoping to teach my daughter to fly. She wants to be a pilot. That will probably never happen, all courtesy of the vaccine.”

Snow is one of a growing number of pilots coming forward to share stories of injuries they experienced after getting a COVID-19 vaccine.

Some of these accounts are “hair-raising and deeply disturbing,” according to Maureen Steele, a paralegal and head of media relations for the John Pierce Law Firm.

The firm represents U.S. Freedom Flyers (USFF), an organization opposing vaccine and mask mandates for pilots and airline staff, in a series of legal actions against the U.S. Federal Aviation Administration (FAA) and several airlines.

Josh Yoder, a pilot with a major commercial airline, Army combat veteran and former flight medic, is a co-founder of USFF.

In a recent interview with The Defender, Yoder said the FAA has been aware of cases of pilots suffering vaccine injuries since at least December 2021, when the California-based Advocates for Citizens’ Rights hand-delivered an open letter to the FAA, major airlines and their insurers.

Yoder said USFF “has received hundreds of phone calls from airline employees who are experiencing adverse reactions post COVID-19 vaccination,” describing the stories as “heartbreaking.”

According to Yoder, the warnings contained in the letter, including testimony by “world-renowned experts,” were “completely ignored,” adding that “we are now beginning to see the consequences.”

This is leading an increasing number of pilots to “come forward to expose the truth regarding these toxic injections,” Yoder said.

The Defender recently reported on a series of reports that have been submitted to the Vaccine Adverse Event Reporting System, or VAERS, involving pilots who sustained severe injuries and side effects following the COVID-19 vaccine.

Congressional testimony from Cody Flint, an agricultural pilot who has logged more than 10,000 flight hours, was included in this letter.

“The FAA has created a powder keg and lit the fuse,” Flint said in an interview with The Defender.

“We are now seeing pilots experiencing blood clots, myocarditis, pericarditis, dizziness and confusion at rates never seen before. Pilots are losing their careers and having to call in sick or go on medical leave from medical issues developing almost immediately after vaccination.”

Vaccine-Injured Pilots Share Stories With the Defender

Several pilots, including Bob Snow, shared their stories with The Defender in a recent series of interviews.

Snow, a captain with a major U.S. airline, told The Defender he received the Johnson & Johnson COVID-19 vaccine on Nov. 4, 2021, “as a result of an unambivalent company mandate to receive the vaccine or be terminated.”

According to Snow, he “began experiencing issues a little over two months” after receiving the vaccine. Due to a history of gastroenteritis, he underwent an endoscopy and an abdominal CT scan.

The results of the endoscopy were normal and Snow was awaiting the results of the CT scan when he suffered cardiac arrest on April 9, immediately after landing at Dallas-Forth Worth International Airport.

As Snow described it:

“I was very lucky to have collapsed when and where I did, as the aircraft was shut down at the gate post-flight and care was immediately provided.

“There was absolutely no warning preceding my collapse in the cockpit. It was literally as if someone ‘pulled the plug.’”

After receiving CPR and AED (automated external defibrillator) shocks to be revived, Snow spent almost a week in the hospital, where he was diagnosed with having sustained sudden cardiac arrest (SCA).

Medical studies indicate survival rates for out-of-hospital SCA cases are estimated at 10.8% to 11.4%.

Snow said:

“Needless to say, that’s not an encouraging number and I feel very, very lucky to have survived.

“Had this happened in a hotel, in flight, at home or almost anywhere else, I do not believe I would be here right now.”

Snow said prior to this incident, he had “no history of prior significant cardiac issues,” based on two EKGs (electrocardiograms) per year for each of the previous 10 years — none of which, according to Snow, “provided any indication of incipient issues that might lead to cardiac arrest.”

“I have no known family history to indicate a predisposition to developing significant cardiac issues at this point in my life,” Snow added.

Snow has been recuperating at home since April 15, while awaiting more tests that will provide a prognosis for his long-term survival.

However, it is likely that he will never fly again in any capacity.

Snow said, “[f]or now, it appears my flying career — indeed, likely all flying as a pilot —  has come to a rapid and unexpected conclusion as SCA is a red flag to FAA medical certification.”

This, according to Snow, has resulted “in a significant loss of income and lifestyle,” adding that he has a college student and high school student at home and a non-working spouse who relied on his livelihood.

‘Last Thing I Remember Is . . . Praying I Would Make It’

Like Snow, Cody Flint had no prior medical history to indicate he was at risk.

“I have been extremely healthy my whole life with no underlying conditions,” said Flint, adding:

“As a pilot that held a second-class medical [certification], I was required to get a yearly FAA flight physical to show I was healthy enough to safely operate an airplane.

“I have renewed my medical every year since I was 17. The last FAA medical I received was on January 19, 2021. The medical showed I was perfectly healthy just 10 days before receiving the COVID-19 vaccine.”

Flint got his first (and only) dose of the Pfizer COVID-19 vaccine on Feb. 1, 2021. He told The Defender:

“Within 30 minutes, I developed a severe burning headache at the base of my skull and blurred vision. After a few hours, the pain was constant, but didn’t seem to be getting worse. I thought the pain would go away, eventually. It did not.”

Two days later began his seasonal job as an agricultural pilot, which typically runs from February to October of each year, Flint said.

He said:

“Approximately one hour into my flight, I felt my condition starting to rapidly decline and I was developing severe tunnel vision. I pulled my airplane up to turn around to head home and immediately felt an extreme burst of pressure in my skull and ears.”

Flint initially considered landing on a nearby highway, unsure he’d make it back to the airstrip, but chose not to so as not to put the public in danger.

Instead, according to Flint:

“The last thing I remember is seeing our airstrip from a few miles out and praying I would make it.

“Later, my coworkers told me I landed and immediately stopped my plane. They described me as being unresponsive, shaking and slumped over in my seat … I do not remember landing or being pulled from the plane.”

Flint said various doctors, including his longtime hometown doctor, refused to consider that his recent COVID-19 vaccination caused his symptoms. Instead, he was prescribed Meclizine for vertigo and Xanax for panic attacks.

According to Flint, doctors told him he would be “completely better within two days.” But two days later, Flint “could barely walk without falling over.”

Seeking a second opinion, Flint visited the Ear & Balance Institute in Louisiana, where he was diagnosed with left and right perilymphatic fistulas (a lesion in the inner ear), and highly elevated intracranial pressure due to swelling in his brainstem.

As Flint described it, “[m]y intracranial pressure had risen so high that it caused both of my inner ears to ‘blow out.’” Doctors told him this is usually caused by major head trauma.

“Obviously, I did not have head trauma,” said Flint. “What I did have, though, was an unapproved and experimental ‘vaccine’ just two days prior to suffering this bodily damage.”

“My doctors [at the Ear & Balance Institute] clearly stated my health issues were a direct result of a severe adverse reaction to the Pfizer COVID-19 vaccine,” he added.

Flint says he now cannot receive renewed medical certification from the FAA due to the injuries he sustained, the physical condition he is currently in and “the fact that I will be on the FAA-unapproved medicine Diamox for the foreseeable future.”

Like Snow, Flint believes “it is … highly unlikely that I’ll ever be able to fly again,” adding, “On most days, I am too dizzy to even safely drive a vehicle.”

Greg Pierson, like Snow and Flint, shared a similar story. A commercial pilot with a major U.S. airline that is also a federal contractor, he was mandated to get vaccinated.

Pierson told The Defender:

“I felt extremely pressured to consider getting vaccinated, even though I am adamant against any mandates that violate personal freedom choices.

“I did research and consulted several medical professionals regarding the associated risks.

“I have never had a flu shot in my lifetime, so this was not something I wanted to do. I reluctantly received the first dose of the Pfizer vaccine on August 26, 2021.”

For Pierson, the onset of symptoms was almost immediate, beginning “approximately 14 hours” after receiving the vaccine, when he experienced “an extremely erratic and highly elevated heart rate.”

Pierson visited a local emergency room, where he was diagnosed with atrial fibrillation. His condition was stabilized and he was soon discharged, though he remained on medication to help his heart return to a normal rhythm.

While Pierson says he has not experienced any further episodes, he nevertheless still has not been cleared to return to the cockpit.

“I successfully passed all the required protocols to re-obtain my certification that will allow me to return to work,” he said, adding the FAA has had his records and test results since Feb. 16, but he still hasn’t received a determination.

“I have been on disability since this occurrence, and combined with the leave, the personal and financial impacts have been significant,” Pierson said.

Pierson also described a similar experience to that of Flint, regarding the attitudes of some medical professionals regarding the possibility that his condition was brought on by the COVID-19 vaccine.

“When I brought the subject up to the ER cardiologist, that it was obvious what triggered my onset, she simply stated ‘s*it happens,’” Pierson said.

Widow Describes Husband’s Last Days

Snow, Flint and Pierson are fortunate in that they have managed to survive, even if their flying careers are in jeopardy.

But other pilots have not been so lucky.

American Airlines pilot Wilburn Wolfe suffered a major seizure following his COVID-19 vaccination, which cost him his life. Fortunately, Wolfe was not on duty when his seizure hit.

Claudia Wolfe, his widow, shared her late husband’s story with The Defender.

Wolfe, a former Marine just a few years from retirement, “was definitely against getting this vaccine but was put in the position to take it or lose his job as a captain,” Claudia Wolfe said.

He received the Johnson & Johnson vaccine on Nov. 9, 2021.

Claudia Wolfe told The Defender:

“[The] first 10 days were without any event … [on] day 11, it started with a migraine-like headache which got better that afternoon after taking a couple of aspirin.

“Unfortunately, the migraine came back and he was hoping that it’s nothing else but a migraine.

“On November 22, 13 days after the COVID vaccine, he had a seizure. When paramedics arrived and my husband came out of the seizure, he was paralyzed on his right side, arm and leg, and was taken to the emergency room.”

At the emergency room, a CT scan showed he was experiencing brain bleeding, and he was admitted into intensive care. There, according to Claudia Wolfe, “he continued to have convulsions on his right hand … shortly after he was admitted, he had another seizure and doctors decided to sedate him and put him on a ventilator.”

“That was the last time I talked to my husband, before the seizure in the ICU,” Claudia Wolfe said.

Wolfe never regained consciousness and died on Nov. 26, 2021 — only 17 days after receiving the COVID-19 vaccine. Even if he had survived, he likely would not have been able to work as a pilot again.

As Claudia Wolfe explained:

“Doctors told me that he couldn’t work as a pilot anymore because he would have to be on seizure medication.

“But as the bleeding continued to spread I was told that he probably would not recognize me or his family and he probably would need a 24-hour facility to help him.

“This man was so strong and never needed a doctor, he was never sick enough to need one, and [he] just had a physical a couple months prior for his job as a pilot.”

Pilots Describe Culture of Fear and Reluctance to Come Forward

Pilots who spoke to The Defender described a culture of intimidation that has led to many of their colleagues fearing professional or personal consequences if they speak publicly about injuries following COVID-19 vaccination.

According to Yoder, “Many pilots and other airline employees capitulated to the tactics of threats, harassment and intimidation perpetrated by the very companies they serve.”

Yoder described airlines, as well as aviation industry unions, as “state actors” illegally “working in lockstep with the U.S. government” to “enforce unconstitutional mandates via a culture of fear.”

Snow told The Defender several of his colleagues shared stories of vaccine injuries with him:

“Since my SCA I have heard from several other airline personnel regarding potential vaccine injuries up to and including cardiac issues (chest pain and myocarditis).

“Many crewmembers are very reluctant to divulge potential significant health issues for fear of losing their FAA medical certification and, potentially, their careers.”

According to Snow, such fear exists “due to both concern for one’s career and also the fear of being portrayed as a vaccine skeptic.”

“There seems to be genuine reluctance on the part of corporations, businesses, government and the medical community in general to acknowledge the potential for COVID vaccine injury,” Snow said.

Claudia Wolfe also shared her experience, stating that following her husband’s death, she learned “of others that died after the COVID vaccine,” adding that “not many talk about it or believe this vaccine can harm or kill you.”

Pierson also expressed concerns, telling The Defender, “Some things I have stated publicly could have consequences in this regard.”

This culture of intimidation appears to extend beyond just accusations of being a “vaccine skeptic.”

Steele described incidents of airline employees’ non-work and online activities seemingly being monitored by their employers, who are then using this as a justification to question or harass those employees.

“I believe the airlines have people on staff that must be trolling the social media of employees and when they find a conservative, or someone they believe to be, they attack,” Steele said.

Steele said female employees appear to be particular targets of the airlines, as they “appear to be isolated and intimidated for hours on end.”

Flint connected incidents such as those described above to political interests, telling The Defender the FAA approved COVID-19 vaccines for pilots just two days after the U.S. Food and Drug Administration (FDA) issued its first Emergency Use Authorization (EUA) for such vaccines, on Dec. 10, 2020.

“I thought to myself, how could the FAA analyze the data and determine it was safe for pilots in just two days, when it took the FDA months to go over the trial data?” Flint said.

Flint said that was an especially jarring development, in light of the increased risk that pilots and cabin crew face:

“I was also extremely curious to know how the FAA is so certain that this vaccine will be safe for pilots when it’s obvious that Pfizer did not do a trial solely on pilots to find out if it would cause some of the serious health problems that immediately started to show up once the mass vaccination campaign [began].”

In the process, Flint stated, the FAA violated its own regulations.

Under the Guide for Aviation Medical Examiners: Pharmaceuticals (Therapeutic Medications) Do Not Issue – Do Not Fly, the FAA has a long-standing rule that states:

“FAA requires at least one year of post-marketing experience with a new drug before consideration for aeromedical certification purposes. This observation allows time for uncommon, but aeromedically significant, adverse reactions to manifest themselves.”

Flint said it “became painfully obvious” the FAA issued this guidance based not on science or safety, but political reasons.

“Why did the FAA abandon its own rules by encouraging pilots to take a brand-new experimental drug?” Flint asked. “This action by the FAA was totally unprecedented and extremely dangerous.”

Providing an example of such danger, Flint said, “it is now widely reported that mRNA COVID-19 vaccines can cause blood clots,” adding that several peer-reviewed studies going back more than a decade “show pilots are approximately 60% more likely to experience blood clots due to the ‘nature of the job.’”

Supporting this assertion, on May 5, the FDA announced that it would restrict who could receive doses of the Johnson & Johnson COVID-19 vaccine, due to the risk of blood clots.

Pierson also believes politics are at play in the medical community, telling The Defender even his longtime doctor told the FAA, in paperwork aimed at restoring Pierson’s suspended medical certification, that “it is impossible for the vaccine to have caused” his condition, though “he could not provide any explanation for an alternative hypothesis” — a stance Pierson characterized as “medical malpractice.”

Such politics are also found in professional organizations within the aviation industry, according to Pierson, who described his experience with one such entity:

“I approached the medical division of ALPA, the Air Line Pilots Association, to which I am a member, and presented them with data to substantiate my concerns.

“It was initially seemingly a concerned, open dialogue, which quickly was dismissed at the highest levels.”

Legal Actions to Follow Against the FAA, Federal Agencies, Airlines

The USFF, according to Yoder, is currently pursuing several legal actions related to the vaccine injuries that pilots and air staff are increasingly reporting.

He told The Defender:

“The U.S. Freedom Flyers have always taken a strong stance against the threats of government and corporate totalitarianism.

“We are filing massive, individual plaintiff lawsuits against the FAA, DOT [U.S. Department of Transportation] and commercial airlines to hold them accountable for the criminal and civil atrocities they’ve committed against our members.

“We will not rest until justice is served and constitutional American freedom is restored.”

Steele added:

“We are teeing up lawsuits for all the major airlines, with thousands of potential plaintiffs on our plaintiff lists.

“We also are going to be holding the FAA and the [U.S. Department of Transportation] accountable for their part in this atrocity.”

Steele said USFF “will be seeking retribution and restitution for these crimes against humanity,” mirroring remarks made by Pierson, who described the actions taken in the name of the pandemic as “nothing short of the highest crimes against humanity ever.”

According to Steele, unions are, in part, responsible for the injuries being sustained by pilots and other employees, as a result of their acceptance of vaccine mandates.

“Unfortunately the unions — from all industries — have let their members down,” Steele told The Defender. “They simply are rolling over and are in bed with the state and the corporations.”

Flint, in turn, assigned a significant amount of blame to the federal agencies:

“The FAA has failed at its duties in the most spectacular fashion, causing pilots to lose their lives, livelihoods and careers.

“The federal government, including the FAA, has not helped one single person injured by the COVID-19 vaccine.

“They [the federal agencies] have not publicly acknowledged there is a problem. They haven’t even so much as adjusted their ‘guidance’ to prevent this from happening in the future.”

Are Passengers at Risk From Pilot Vaccine Mandates?

When Snow suffered cardiac arrest, it occurred only a few minutes after he had landed a commercial airliner, full of passengers, at one of the most heavily trafficked airports in the U.S.

This begs the question: Are passengers — and the public at large — at risk due to potential adverse effects that may impact vaccinated pilots during flight?

According to Pierson, there is indeed a risk of a “catastrophic” incident:

“I became an outspoken critic of the vaccines after my injury, and due to becoming much more knowledgeable of all the potential health and safety risks from the vaccines.

“It became very clear to me that the implications of having an immediate, severe adverse reaction could be catastrophic if actively piloting an aircraft.”

Flint believes such a disaster may be an inevitability.

“It is only a matter of time before a pilot has a medically significant event from an adverse reaction to this [COVID-19] vaccine and crashes an airliner, killing a few hundred American citizens in the process.”

He added:

“When will the FAA finally do the right thing by trying to adhere to its own mission statement, which is ‘to provide the safest, most efficient aerospace system in the world’?

“How many more pilots have to die or be severely injured before the FAA acknowledges the horrible and dangerous problem it has created?”

In addition to the risk of a disaster involving casualties among passengers and the general public, the difficulties that pilots are experiencing as a result of vaccine-related adverse reactions are creating other disruptions for the airline industry and the flying public, such as flight cancellations and delays.

Yoder described this as a “ripple effect”:

“Vaccine mandates are having a ripple effect in the aviation industry that will continue for years to come.

“Pilot shortages were a concern pre-mandate, [and] have now been amplified due to early retirements and medical disqualification due to certain adverse vaccine reactions which prohibit pilots from maintaining medical certification.”

Pilots, Advocates Describe Importance of Speaking Out

The pilots, legal professionals and advocates who spoke to The Defender all expressed their hope that by speaking out and sharing their stories and experiences, they will make a difference.

Snow said:

“I hope to shine the spotlight on the potential for significant safety issues that exist within the airlines, commercial vehicles/transportation, and other safety-sensitive work that might be affected by [the] sudden onset of health issues that could be attributed to the COVID vaccines.

“It is in our collective best interest that real research and data analysis be undertaken to address this potentially dangerous situation.

“Why is there such a reluctance to investigate these EUA COVID vaccines which are still being aggressively marketed to, if not outright forced upon, the global public?”

Snow went on to discuss the history of unsafe drugs and therapies that had initially received FDA approval and the importance of “clinical and scientific studies to evaluate the possibility of injuries and deaths” instead of “parroting the marketing mantra ‘safe and effective.’”

Flint described the FAA’s handling of the issue as “one of the most glaring instances of incompetence and corruption I have ever witnessed,” adding that “the Pfizer COVID-19 vaccine has taken nearly everything from myself and my family … my health and my career have been taken from me.”

He added that due to his inability to fly, he is facing mounting debt and unpaid taxes, with an income “20% of what it was before vaccination.”

Steele, who also organized the People’s Convoy, expressed her view that “[t]he only way to push back on the government and corporate overstep is demanding accountability … to hold these policymakers unequivocally accountable.”

She specifically referenced the importance of pursuing legal claims, telling The Defender:

“The only way to ensure it never happens again is to hit them in the pocketbook … In doing so, the awarded damages will also assist the victims of these policies that have been so grievously harmed.”

Yoder described the resistance he has observed to such private and government mandates, saying that “Americans have rallied in defiance to the totalitarian dictators dubbed ‘government,’” adding that “American patriots will never succumb to totalitarianism.”

Steele drew upon her experience with the People’s Convoy to share her own observation of wide public opposition to such mandates, while expressing a message of hope:

“My greatest takeaway and the most refreshing finding on the Convoy was that patriotism is alive and well in our great country.

“The American people have had it with the nonsense with the overstepping, with the ‘PC police,’ the degrading of morality in our country. They are simply over it and looking for actionable items that they can do.

“They want to see accountability. They want to see our country restored … It is important for people to know they are absolutely not alone. In fact, we are the majority.”

Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line

Current Issues In Molecular Biology

Authors: Markus Aldén 1 , Francisko Olofsson Falla 1 , Daowei Yang 1 , Mohammad Barghouth 1 , Cheng Luan 1 , Magnus Rasmussen 2 and Yang De Marinis 1,*

Abstract: Preclinical studies of COVID-19 mRNA vaccine BNT162b2, developed by Pfizer and
BioNTech, showed reversible hepatic effects in animals that received the BNT162b2 injection.
Furthermore, a recent study showed that SARS-CoV-2 RNA can be reverse-transcribed and integrated into the genome of human cells. In this study, we investigated the effect of BNT162b2 on the human liver cell line Huh7 in vitro. Huh7 cells were exposed to BNT162b2, and quantitative PCR was performed on RNA extracted from the cells. We detected high levels of BNT162b2 in Huh7 cells and changes in gene expression of long interspersed nuclear element-1 (LINE-1), which is an endogenous reverse transcriptase. Immunohistochemistry using antibody binding to LINE-1 open reading frame-1 RNA-binding protein (ORFp1) on Huh7 cells treated with BNT162b2 indicated increased nucleus distribution of LINE-1. PCR on genomic DNA of Huh7 cells exposed to BNT162b2 amplified the DNA sequence unique to BNT162b2. Our results indicate a fast up-take of BNT162b2 into human liver cell line Huh7, leading to changes in LINE-1 expression and distribution. We also show that BNT162b2 mRNA is reverse transcribed intracellularly into DNA in as fast as 6 h upon BNT162b2 exposure.

Introduction
Coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2) was announced by the World Health Organization (WHO)
as a global pandemic on 11 March 2020, and it emerged as a devasting health crisis.
As of February 2022, COVID-19 has led to over 430 million reported infection cases and
5.9 million deaths worldwide [1]. Effective and safe vaccines are urgently needed to reduce the morbidity and mortality rates associated with COVID-19. Several vaccines for COVID-19 have been developed, with particular focus on mRNA vaccines (by Pfizer-BioNTech and Moderna), replication-defective recombinant adenoviral vector vaccines (by Janssen-Johnson and Johnson, Astra-Zeneca, Sputnik-V, and CanSino), and inactivated vaccines (by Sinopharm, Bharat Biotech and Sinovac). The mRNA vaccine has the advantages of being flexible and efficient in immunogen design and manufacturing, and currently, numerous vaccine candidates are in various stages of development and application. Specifically, COVID-19 mRNA vaccine BNT162b2 developed by Pfizer and BioNTech has been evaluated in successful clinical trials [2–4] and administered in national COVID-19 vaccination campaigns in different regions around the world [5–8]. BNT162b2 is a lipid nanoparticle (LNP)–encapsulated, nucleoside-modified RNA vaccine (modRNA) and encodes the full-length of SARS-CoV-2 spike (S) protein, modified by two proline mutations to ensure antigenically optimal pre-fusion conformation, which mimics the intact virus to elicit virus-neutralizing antibodies [3]. Consistent with randomized clinical trials, BNT162b2 showed high efficiency in a wide range of COVID-19-related outcomes in a real-world setting [5]. Nevertheless, many challenges remain, including monitoring for long-term safety and efficacy of the vaccine. This warrants further evaluation and investigations. The safety profile of BNT162b2 is currently only available from short-term clinical studies. Less common adverse effects of BNT162b2 have been reported, including pericarditis, arrhythmia, deep-vein thrombosis, pulmonary embolism, myocardial infarction, intracranial hemorrhage, and thrombocytopenia [4,9–20]. There are also studies that report adverse effects observed in other types of vaccines [21–24]. To better understand mechanisms underlying vaccine-related adverse effects, clinical investigations as well as cellular and molecular analyses are needed. A recent study showed that SARS-CoV-2 RNAs can be reverse-transcribed and integrated into the genome of human cells [25]. This gives rise to the question of if this may also occur with BNT162b2, which encodes partial SARS-CoV-2 RNA. In pharmacokinetics data provided by Pfizer to European Medicines Agency (EMA), BNT162b2 biodistribution was studied in mice and rats by intra-muscular injection with radiolabeled LNP and luciferase modRNA. Radioactivity was detected in most tissues from the first time point (0.25 h), and results showed that the injection site and the liver were the major sites of distribution, with maximum concentrations observed at 8–48 h post-dose [26]. Furthermore, in animals that received the BNT162b2 injection, reversible hepatic effects were observed, including enlarged liver, vacuolation, increased gamma glutamyl transferase (γGT) levels, and increased levels of aspartate transaminase (AST) and alkaline phosphatase (ALP) [26]. Transient hepatic effects induced by LNP delivery systems have been reported previously [27–30], nevertheless, it has also been shown that the empty LNP without modRNA alone does not introduce any significant liver injury [27]. Therefore, in this study, we aim to examine the effect of BNT162b2 on a human liver cell line in vitro and investigate if BNT162b2 can be reverse transcribed into DNA through endogenous mechanisms.

Materials and Methods 2.1.

Cell Culture Huh7 cells (JCRB Cell Bank, Osaka, Japan) were cultured in 37 ◦C at 5% CO2 with DMEM medium (HyClone, HYCLSH30243.01) supplemented with 10% (v/v) fetal bovine serum (Sigma-Aldrich, F7524-500ML, Burlington, MA, USA) and 1% (v/v) PenicillinStreptomycin (HyClone, SV30010, Logan, UT, USA). For BNT162b2 treatment, Huh7 cells were seeded with a density of 200,000 cells/well in 24-well plates. BNT162b2 mRNA vaccine (Pfizer BioNTech, New York, NY, USA) was diluted with sterile 0.9% sodium chloride injection, USP into a final concentration of 100 µg/mL as described in the manufacturer’s guideline [31]. BNT162b2 suspension was then added in cell culture media to reach final concentrations of 0.5, 1.0, or 2.0 µg/mL. Huh7 cells were incubated with or without BNT162b2 for 6, 24, and 48 h. Cells were washed thoroughly with PBS and harvested by trypsinization and stored in −80 ◦C until further use. 2.2. REAL-TIME RT-QPCR RNA from the cells was extracted with RNeasy Plus Mini Kit (Qiagen, 74134, Hilden, Germany) following the manufacturer’s protocol. RT-PCR was performed using RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, K1622, Waltham, MA, USA) following the manufacturers protocol. Real-time qPCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, K0222, Waltham, MA, USA) with primers for BNT162b2, LINE-1 and housekeeping genes ACTB and GAPDH (Table 1). Curr. Issues Mol. Biol. 2022, 44 1117 Table 1. Primer sequences of RT-qPCR and PCR. Target Sequence ACTB forward CCTCGCCTTTGCCGATCC ACTB reverse GGATCTTCATGAGGTAGTCAGTC GAPDH forward CTCTGCTCCTCCTGTTCGAC GAPDH reverse TTAAAAGCAGCCCTGGTGAC LINE-1 forward TAACCAATACAGAGAAGTGC LINE-1 reverse GATAATATCCTGCAGAGTGT BNT162b2 forward CGAGGTGGCCAAGAATCTGA BNT162b2 reverse TAGGCTAAGCGTTTTGAGCTG 2.3. Immunofluorescence Staining and Confocal Imaging Huh7 cells were cultured in eight-chamber slides (LAB-TEK, 154534, Santa Cruz, CA, USA) with a density of 40,000 cells/well, with or without BNT162b2 (0.5, 1 or 2 µg/mL) for 6 h. Immunohistochemistry was performed using primary antibody anti-LINE-1 ORF1p mouse monoclonal antibody (Merck, 3574308, Kenilworth, NJ, USA), secondary antibody Cy3 Donkey anti-mouse (Jackson ImmunoResearch, West Grove, PA, USA), and Hoechst (Life technologies, 34850, Carlsbad, CA, USA), following the protocol from Thermo Fisher (Waltham, MA, USA). Two images per condition were taken using a Zeiss LSM 800 and a 63X oil immersion objective, and the staining intensity was quantified on the individual whole cell area and the nucleus area on 15 cells per image by ImageJ 1.53c. LINE-1 staining intensity for the cytosol was calculated by subtracting the intensity of the nucleus from that of the whole cell. All images of the cells were assigned a random number to prevent bias. To mark the nuclei (determined by the Hoechst staining) and the whole cells (determined by the borders of the LINE-1 fluorescence), the Freehand selection tool was used. These areas were then measured, and the mean intensity was used to compare the groups. 2.4. Genomic DNA Purification, PCR Amplification, Agarose Gel Purification, and Sanger Sequencing Genomic DNA was extracted from cell pellets with PBND buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20) according to protocol described previously [32]. To remove residual RNA from the DNA preparation, RNase (100 µg/mL, Qiagen, Hilden, Germany) was added to the DNA preparation and incubated at 37 ◦C for 3 h, followed by 5 min at 95 ◦C. PCR was then performed using primers targeting BNT162b2 (sequences are shown in Table 1), with the following program: 5 min at 95 ◦C, 35 cycles of 95 ◦C for 30 s, 58 ◦C for 30 s, and 72 ◦C for 1 min; finally, 72 ◦C for 5 min and 12 ◦C for 5 min. PCR products were run on 1.4% (w/v) agarose gel. Bands corresponding to the amplicons of the expected size (444 bps) were cut out and DNA was extracted using QIAquick PCR Purification Kit (Qiagen, 28104, Hilden, Germany), following the manufacturer’s instructions. The sequence of the DNA amplicon was verified by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany). Statistics Statistical comparisons were performed using two-tailed Student’s t-test and ANOVA. Data are expressed as the mean ± SEM or ± SD. Differences with p < 0.05 are considered significant. 2.5. Ethical Statements The Huh7 cell line was obtained from Japanese Collection of Research Bioresources (JCRB) Cell Bank.

Results

BNT162b2 Enters Human Liver Cell Line Huh7 Cells at High Efficiency
To determine if BNT162b2 enters human liver cells, we exposed human liver cell
line Huh7 to BNT162b2. In a previous study on the uptake kinetics of LNP delivery in
Huh7 cells, the maximum biological efficacy of LNP was observed between 4–7 h [33].
Therefore, in our study, Huh7 cells were cultured with or without increasing concentrations
of BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6, 24, and 48 h. RNA was extracted from cells
and a real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR)
was performed using primers targeting the BNT162b2 sequence, as illustrated in Figure 1.
The full sequence of BNT162b2 is publicly available [34] and contains a two-nucleotides cap;
50 untranslated region (UTR) that incorporates the 50-UTR of a human α-globin gene; the
full-length of SARS-CoV-2 S protein with two proline mutations; 30-UTR that incorporates
the human mitochondrial 12S rRNA (mtRNR1) segment and human AES/TLE5 gene segment with two C→U mutations; poly(A) tail. Detailed analysis of the S protein sequence in BNT162b2 revealed 124 sequences that are 100% identical to human genomic sequences and three sequences with only one nucleotide (nt) mismatch in 19–26 nts (Table S1, see Supplementary Materials). To detect BNT162b2 RNA level, we designed primers with forward primer located in SARS-CoV-2 S protein regions and reverse primer in 30-UTR,which allows detection of PCR amplicon unique to BNT162b2 without unspecific binding of the primers to human genomic regions.

Discussion
In this study we present evidence that COVID-19 mRNA vaccine BNT162b2 is able
to enter the human liver cell line Huh7 in vitro. BNT162b2 mRNA is reverse transcribed
intracellularly into DNA as fast as 6 h after BNT162b2 exposure. A possible mechanism for reverse transcription is through endogenous reverse transcriptase LINE-1, and the nucleus protein distribution of LINE-1 is elevated by BNT162b2. Intracellular accumulation of LNP in hepatocytes has been demonstrated in vivo [36]. A preclinical study on BNT162b2 showed that BNT162b2 enters the human cell line HEK293T cells and leads to robust expression of BNT162b2 antigen [37]. Therefore, in this study, we first investigated the entry of BNT162b2 in the human liver cell line Huh7 cells. The choice of BNT162b2 concentrations used in this study warrants explanation. BNT162b2 is administered as a series of two doses three weeks apart, and each dose contains 30 µg of BNT162b2 in a volume of 0.3 mL, which makes the local concentration at the injection site at the highest 100 µg/mL [31]. A previous study on mRNA vaccines against H10N8 and H7N9 influenza viruses using a similar LNP delivery system showed that the mRNA vaccine can distribute rather nonspecifically to several organs such as liver, spleen, heart, kidney, lung, and brain, and the concentration in the liver is roughly 100 times lower than that of the intra-muscular injection site [38]. In the assessment report on BNT162b2 provided to EMA by Pfizer, the pharmacokinetic distribution studies in rats demonstrated that a relatively large proportion (up to 18%) of the total dose distributes to the liver [26]. We therefore chose to use 0.5, 1, and 2 µg/mL of vaccine in our experiments on the liver cells. However, the effect of a broader range of lower and higher concentrations of BNT162b2 should also be verified in future studies. In the current study, we employed a human liver cell line for in vitro investigation. It is worth investigating if the liver cells also present the vaccine-derived SARS-CoV-2 spike protein, which could potentially make the liver cells targets for previously primed spike protein reactive cytotoxic T cells. There has been case reports on individuals who developed autoimmune hepatitis [39] after BNT162b2 vaccination. To obtain better under-standing of the potential effects of BNT162b2 on liver function, in vivo models are desired for future studies. In the BNT162b2 toxicity report, no genotoxicity nor carcinogenicity studies have been provided [26]. Our study shows that BNT162b2 can be reverse transcribed to DNA in liver cell line Huh7, and this may give rise to the concern if BNT162b2-derived DNA may be integrated into the host genome and affect the integrity of genomic DNA, which may potentially mediate genotoxic side effects. At this stage, we do not know if DNA reverse transcribed from BNT162b2 is integrated into the cell genome. Further studies are needed to demonstrate the effect of BNT162b2 on genomic integrity, including whole genome sequencing of cells exposed to BNT162b2, as well as tissues from human subjects who received BNT162b2 vaccination. Human autonomous retrotransposon LINE-1 is a cellular endogenous reverse transcriptase and the only remaining active transposon in humans, able to retrotranspose itself and other nonautonomous elements [40,41], and ~17% of the human genome are comprised of LINE-1 sequences [42]. The nonautonomous Alu elements, short, interspersed nucleotide elements (SINEs), variable-number-of-tandem-repeats (VNTR), as well as cellular mRNA-processed pseudogenes, are retrotransposed by the LINE-1 retrotransposition proteins working in trans [43,44]. A recent study showed that endogenous LINE-1 mediates reverse transcription and integration of SARS-CoV-2 sequences in the genomes of infected human cells [25]. Further-more, expression of endogenous LINE-1 is often increased upon viral infection, including SARS-CoV-2 infection [45–47]. Previous studies showed that LINE-1 retrotransposition activity is regulated by RNA metabolism [48,49], DNA damage response [50], and autophagy [51]. Efficient retro-transposition of LINE-1 is often associated with cell cycle and nuclear envelope breakdown during mitosis [52,53], as well as exogenous retroviruses [54,55], which promotes entrance of LINE-1 into the nucleus. In our study, we observed increased LINE-1 ORF1p distribution as determined by immunohistochemistry in the nucleus by BNT162b2 at all concentrations tested (0.5, 1, and 2 µg/mL), while elevated LINE-1 gene expression was detected at the highest BNT162b2 concentration (2 µg/mL). It is worth noting that gene transcription is regulated by chromatin modifications, transcription factor regulation, and the rate of RNA degradation, while translational regulation of protein involves ribosome recruitment on the initiation codon, modulation of peptide elongation, termination of protein synthesis, or ribosome biogenesis. These two processes are controlled by different mechanisms, and therefore they may not always show the same change patterns in response to external challenges. The exact regulation of LINE-1 activity in response to BNT162b2 merits further study. The cell model that we used in this study is a carcinoma cell line, with active DNA replication which differs from non-dividing somatic cells. It has also been shown that Huh7 cells display significant different gene and protein expression including upregulated proteins involved in RNA metabolism [56]. However, cell proliferation is also active in several human tissues such as the bone marrow or basal layers of epithelia as well as during embryogenesis, and it is therefore necessary to examine the effect of BNT162b2 on genomic integrity under such conditions. Furthermore, effective retrotransposition of LINE-1 has also been reported in non-dividing and terminally differentiated cells, such as human neurons [57,58]. The Pfizer EMA assessment report also showed that BNT162b2 distributes in the spleen (<1.1%), adrenal glands (<0.1%), as well as low and measurable radioactivity in the ovaries and testes (<0.1%) [26]. Furthermore, no data on placental transfer of BNT162b2 is available from Pfizer EMA assessment report. Our results showed that BNT162b2 mRNA readily enters Huh7 cells at a concentration (0.5 µg/mL) corresponding to 0.5% of the local injection site concentration, induce changes in LINE-1 gene and protein expression, and within 6 h, reverse transcription of BNT162b2 can be detected. It is therefore important to investigate further the effect of BNT162b2 on other cell types and tissues both in vitro and in vivo. 5. Conclusions Our study is the first in vitro study on the effect of COVID-19 mRNA vaccine BNT162b2 on human liver cell line. We present evidence on fast entry of BNT162b2 into the cells and subsequent intracellular reverse transcription of BNT162b2 mRNA into DNA.

Supplementary Materials: The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/cimb44030073/s1.

Author Contributions: M.A., F.O.F., D.Y., M.B. and C.L. performed in vitro experiments. M.A. and F.O.F. performed data analysis. M.R. and Y.D.M. contributed to the implementation of the research, designed, and supervised the study. Y.D.M. wrote the paper with input from all authors. All authors have read and agreed to the published version of the manuscript.

Funding: This study was supported by the Swedish Research Council, Strategic Research Area Exodiab, Dnr 2009-1039, the Swedish Government Fund for Clinical Research (ALF) and the foundation of Skåne University Hospital. Institutional Review Board Statement: Not applicable.

Informed Consent Statement: Not applicable.

Data Availability Statement: All data supporting the findings of this study are available within the article and supporting information.

Acknowledgments: The authors thank Sven Haidl, Maria Josephson, Enming Zhang, Jia-Yi Li, Caroline Haikal, and Pradeep Bompada for their support to this study

References

  1. World Health Organization. Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on
    22 February 2022).
  2. Mulligan, M.J.; Lyke, K.E.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Raabe, V.; Bailey, R.; Swanson, K.A.; et al.
    Phase I/II study of COVID-19 RNA vaccine BNT162b1 in adults. Nature 2020, 586, 589–593. [CrossRef] [PubMed]
  3. Walsh, E.E.; Frenck, R.W., Jr.; Falsey, A.R.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Mulligan, M.J.;
    Bailey, R.; et al. Safety and Immunogenicity of Two RNA-Based COVID-19 Vaccine Candidates. N. Engl. J. Med. 2020, 383,
    2439–2450. [CrossRef] [PubMed]
  4. Polack, F.P.; Thomas, S.J.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Perez, J.L.; Perez Marc, G.; Moreira, E.D.; Zerbini, C.; et al.
    Safety and Efficacy of the BNT162b2 mRNA COVID-19 Vaccine. N. Engl. J. Med. 2020, 383, 2603–2615. [CrossRef] [PubMed]
  5. Harris, R.J.; Hall, J.A.; Zaidi, A.; Andrews, N.J.; Dunbar, J.K.; Dabrera, G. Effect of Vaccination on Household Transmission of
    SARS-CoV-2 in England. N. Engl. J. Med. 2021, 385, 759–760. [CrossRef]
  6. Butt, A.A.; Omer, S.B.; Yan, P.; Shaikh, O.S.; Mayr, F.B. SARS-CoV-2 Vaccine Effectiveness in a High-Risk National Population in a
    Real-World Setting. Ann. Intern. Med. 2021, 174, 1404–1408. [CrossRef]
  7. Dagan, N.; Barda, N.; Kepten, E.; Miron, O.; Perchik, S.; Katz, M.A.; Hernan, M.A.; Lipsitch, M.; Reis, B.; Balicer, R.D. BNT162b2
    mRNA Covid-19 Vaccine in a Nationwide Mass Vaccination Setting. N. Engl. J. Med. 2021, 384, 1412–1423. [CrossRef]
  8. Rossman, H.; Shilo, S.; Meir, T.; Gorfine, M.; Shalit, U.; Segal, E. COVID-19 dynamics after a national immunization program in
    Israel. Nat. Med. 2021, 27, 1055–1061. [CrossRef]
  9. Fan, B.E.; Shen, J.Y.; Lim, X.R.; Tu, T.M.; Chang, C.C.R.; Khin, H.S.W.; Koh, J.S.; Rao, J.P.; Lau, S.L.; Tan, G.B.; et al. Cerebral venous
    thrombosis post BNT162b2 mRNA SARS-CoV-2 vaccination: A black swan event. Am. J. Hematol. 2021, 96, E357–E361. [CrossRef]
  10. Larson, K.F.; Ammirati, E.; Adler, E.D.; Cooper, L.T., Jr.; Hong, K.N.; Saponara, G.; Couri, D.; Cereda, A.; Procopio, A.; Cavalotti, C.; et al.
    Myocarditis After BNT162b2 and mRNA-1273 Vaccination. Circulation 2021, 144, 506–508. [CrossRef]
  11. Menni, C.; Klaser, K.; May, A.; Polidori, L.; Capdevila, J.; Louca, P.; Sudre, C.H.; Nguyen, L.H.; Drew, D.A.; Merino, J.; et al. Vaccine
    side-effects and SARS-CoV-2 infection after vaccination in users of the COVID Symptom Study app in the UK: A prospective
    observational study. Lancet Infect. Dis. 2021, 21, 939–949. [CrossRef]
  12. Hansen, T.; Titze, U.; Kulamadayil-Heidenreich, N.S.A.; Glombitza, S.; Tebbe, J.J.; Rocken, C.; Schulz, B.; Weise, M.; Wilkens, L.
    First case of postmortem study in a patient vaccinated against SARS-CoV-2. Int. J. Infect. Dis. 2021, 107, 172–175. [CrossRef]
    [PubMed]
  13. Kadali, R.A.K.; Janagama, R.; Peruru, S.; Malayala, S.V. Side effects of BNT162b2 mRNA COVID-19 vaccine: A randomized,
    cross-sectional study with detailed self-reported symptoms from healthcare workers. Int. J. Infect. Dis. 2021, 106, 376–381.
    [CrossRef] [PubMed]
  14. Parkash, O.; Sharko, A.; Farooqi, A.; Ying, G.W.; Sura, P. Acute Pancreatitis: A Possible Side Effect of COVID-19 Vaccine. Cureus
    2021, 13, e14741. [CrossRef] [PubMed]
  15. Mazzatenta, C.; Piccolo, V.; Pace, G.; Romano, I.; Argenziano, G.; Bassi, A. Purpuric lesions on the eyelids developed after
    BNT162b2 mRNA COVID-19 vaccine: Another piece of SARS-CoV-2 skin puzzle? J. Eur. Acad. Dermatol. Venereol. 2021, 35,
    e543–e545. [CrossRef]
  16. Lee, E.J.; Cines, D.B.; Gernsheimer, T.; Kessler, C.; Michel, M.; Tarantino, M.D.; Semple, J.W.; Arnold, D.M.; Godeau, B.;
    Lambert, M.P.; et al. Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination. Am. J. Hematol. 2021, 96, 534–537.
    [CrossRef]
  17. Ishay, Y.; Kenig, A.; Tsemach-Toren, T.; Amer, R.; Rubin, L.; Hershkovitz, Y.; Kharouf, F. Autoimmune phenomena following
    SARS-CoV-2 vaccination. Int. Immunopharmacol. 2021, 99, 107970. [CrossRef]
  18. Das, B.B.; Kohli, U.; Ramachandran, P.; Nguyen, H.H.; Greil, G.; Hussain, T.; Tandon, A.; Kane, C.; Avula, S.; Duru, C.; et al.
    Myopericarditis following mRNA COVID-19 Vaccination in Adolescents 12 through 18 Years of Age. J. Pediatr. 2021, 238, 26–32.e1.
    [CrossRef]
  19. McLaurin-Jiang, S.; Garner, C.D.; Krutsch, K.; Hale, T.W. Maternal and Child Symptoms Following COVID-19 Vaccination Among
    Breastfeeding Mothers. Breastfeed. Med. 2021, 16, 702–709. [CrossRef]
  20. Barda, N.; Dagan, N.; Ben-Shlomo, Y.; Kepten, E.; Waxman, J.; Ohana, R.; Hernan, M.A.; Lipsitch, M.; Kohane, I.; Netzer, D.; et al.
    Safety of the BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Setting. N. Engl. J. Med. 2021, 385, 1078–1090. [CrossRef]
  21. Baden, L.R.; El Sahly, H.M.; Essink, B.; Kotloff, K.; Frey, S.; Novak, R.; Diemert, D.; Spector, S.A.; Rouphael, N.; Creech, C.B.; et al.
    Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N. Engl. J. Med. 2021, 384, 403–416. [CrossRef]
  22. Sadoff, J.; Gray, G.; Vandebosch, A.; Cardenas, V.; Shukarev, G.; Grinsztejn, B.; Goepfert, P.A.; Truyers, C.; Fennema, H.;
    Spiessens, B.; et al. Safety and Efficacy of Single-Dose Ad26.COV2.S Vaccine against Covid-19. N. Engl. J. Med. 2021, 384,
    2187–2201. [CrossRef] [PubMed]
  23. Eichinger, S.; Warkentin, T.E.; Greinacher, A. Thrombotic Thrombocytopenia after ChAdOx1 nCoV-19 Vaccination. Reply. N. Engl.
    J. Med. 2021, 385, e11. [CrossRef] [PubMed]
  24. Doroftei, B.; Ciobica, A.; Ilie, O.D.; Maftei, R.; Ilea, C. Mini-Review Discussing the Reliability and Efficiency of COVID-19 Vaccines.
    Diagnostics 2021, 11, 579. [CrossRef]Zhang, L.; Richards, A.; Barrasa, M.I.; Hughes, S.H.; Young, R.A.; Jaenisch, R. Reverse-transcribed SARS-CoV-2 RNA can integrate
  25. into the genome of cultured human cells and can be expressed in patient-derived tissues. Proc. Natl. Acad. Sci. USA 2021, 118,
  26. e2105968118. [CrossRef] [PubMed]
  27. Available online: https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_
  28. en.pdf (accessed on 24 February 2022).
  29. Tanaka, H.; Takata, N.; Sakurai, Y.; Yoshida, T.; Inoue, T.; Tamagawa, S.; Nakai, Y.; Tange, K.; Yoshioka, H.; Maeki, M.; et al.
  30. Delivery of Oligonucleotides Using a Self-Degradable Lipid-Like Material. Pharmaceutics 2021, 13, 544. [CrossRef]
  31. Sedic, M.; Senn, J.J.; Lynn, A.; Laska, M.; Smith, M.; Platz, S.J.; Bolen, J.; Hoge, S.; Bulychev, A.; Jacquinet, E.; et al. Safety
  32. Evaluation of Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat and Cynomolgus Monkey. Vet. Pathol.
  33. 2018, 55, 341–354. [CrossRef]
  34. Sato, Y.; Matsui, H.; Yamamoto, N.; Sato, R.; Munakata, T.; Kohara, M.; Harashima, H. Highly specific delivery of siRNA to
  35. hepatocytes circumvents endothelial cell-mediated lipid nanoparticle-associated toxicity leading to the safe and efficacious
  36. decrease in the hepatitis B virus. J. Control. Release 2017, 266, 216–225. [CrossRef]
  37. Heidel, J.D.; Yu, Z.; Liu, J.Y.; Rele, S.M.; Liang, Y.; Zeidan, R.K.; Kornbrust, D.J.; Davis, M.E. Administration in non-human
  38. primates of escalating intravenous doses of targeted nanoparticles containing ribonucleotide reductase subunit M2 siRNA. Proc.
  39. Natl. Acad. Sci. USA 2007, 104, 5715–5721. [CrossRef]
  40. Available online: https://www.cvdvaccine-us.com/ (accessed on 24 February 2022).
  41. Available online: http://bridgeslab.sph.umich.edu/protocols/index.php/Preparation_of_Tail_Samples_(for_Genotyping)
  42. (accessed on 24 February 2022).
  43. Gallud, A.; Munson, M.J.; Liu, K.; Idstrom, A.; Barriga, H.M.; Tabaei, S.; Aliakbarinodehi, N.; Ojansivu, M.; Lubart, Q.;
  44. Doutch, J.J.; et al. Time evolution of PEG-shedding and serum protein coronation determines the cell uptake kinetics and delivery
  45. of lipid nanoparticle. bioRxiv 2021. [CrossRef]
  46. World Health Organization Messenger RNA Encoding the Full-Length SARS-CoV-2 Spike Glycoprotein. 2020. Available
  47. online: https://web.archive.org/web/20210105162941/https://mednet-communities.net/inn/db/media/docs/11889.doc
  48. (accessed on 24 February 2022).
  49. Mita, P.; Wudzinska, A.; Sun, X.; Andrade, J.; Nayak, S.; Kahler, D.J.; Badri, S.; LaCava, J.; Ueberheide, B.; Yun, C.Y.; et al. LINE-1
  50. protein localization and functional dynamics during the cell cycle. Elife 2018, 7, e30058. [CrossRef]
  51. Sato, Y.; Kinami, Y.; Hashiba, K.; Harashima, H. Different kinetics for the hepatic uptake of lipid nanoparticles between the
  52. apolipoprotein E/low density lipoprotein receptor and the N-acetyl-d-galactosamine/asialoglycoprotein receptor pathway. J.
  53. Control. Release 2020, 322, 217–226. [CrossRef]
  54. Vogel, A.B.; Kanevsky, I.; Che, Y.; Swanson, K.A.; Muik, A.; Vormehr, M.; Kranz, L.M.; Walzer, K.C.; Hein, S.; Guler, A.; et al.
  55. BNT162b vaccines protect rhesus macaques from SARS-CoV-2. Nature 2021, 592, 283–289. [CrossRef] [PubMed]
  56. Bahl, K.; Senn, J.J.; Yuzhakov, O.; Bulychev, A.; Brito, L.A.; Hassett, K.J.; Laska, M.E.; Smith, M.; Almarsson, O.; Thompson, J.; et al.
  57. Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses. Mol. Ther.
  58. 2017, 25, 1316–1327. [CrossRef] [PubMed]
  59. Bril, F.; Al Diffalha, S.; Dean, M.; Fettig, D.M. Autoimmune hepatitis developing after coronavirus disease 2019 (COVID-19)
  60. vaccine: Causality or casualty? J. Hepatol. 2021, 75, 222–224. [CrossRef]
  61. Kazazian, H.H., Jr.; Moran, J.V. Mobile DNA in Health and Disease. N. Engl. J. Med. 2017, 377, 361–370. [CrossRef] [PubMed]
  62. Coffin, J.M.; Fan, H. The Discovery of Reverse Transcriptase. Annu. Rev. Virol. 2016, 3, 29–51. [CrossRef]
  63. Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al.
  64. Initial sequencing and analysis of the human genome. Nature 2001, 409, 860–921. [CrossRef]
  65. Ostertag, E.M.; Goodier, J.L.; Zhang, Y.; Kazazian, H.H., Jr. SVA elements are nonautonomous retrotransposons that cause disease
  66. in humans. Am. J. Hum. Genet. 2003, 73, 1444–1451. [CrossRef]
  67. Hancks, D.C.; Kazazian, H.H., Jr. Active human retrotransposons: Variation and disease. Curr. Opin. Genet. Dev. 2012, 22, 191–203.
  68. [CrossRef]
  69. Jones, R.B.; Song, H.; Xu, Y.; Garrison, K.E.; Buzdin, A.A.; Anwar, N.; Hunter, D.V.; Mujib, S.; Mihajlovic, V.; Martin, E.; et al.
  70. LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells. J. Virol. 2013, 87, 13307–13320. [CrossRef]
  71. Macchietto, M.G.; Langlois, R.A.; Shen, S.S. Virus-induced transposable element expression up-regulation in human and mouse
  72. host cells. Life Sci. Alliance 2020, 3, e201900536. [CrossRef] [PubMed]
  73. Yin, Y.; Liu, X.Z.; He, X.; Zhou, L.Q. Exogenous Coronavirus Interacts With Endogenous Retrotransposon in Human Cells. Front.
  74. Cell Infect. Microbiol. 2021, 11, 609160. [CrossRef] [PubMed]
  75. Belancio, V.P.; Roy-Engel, A.M.; Deininger, P. The impact of multiple splice sites in human L1 elements. Gene 2008, 411, 38–45.
  76. [CrossRef] [PubMed]
  77. Dai, L.; Taylor, M.S.; O’Donnell, K.A.; Boeke, J.D. Poly(A) binding protein C1 is essential for efficient L1 retrotransposition and
  78. affects L1 RNP formation. Mol. Cell Biol. 2012, 32, 4323–4336. [CrossRef]
  79. Servant, G.; Streva, V.A.; Derbes, R.S.; Wijetunge, M.I.; Neeland, M.; White, T.B.; Belancio, V.P.; Roy-Engel, A.M.; Deininger, P.L.
  80. The Nucleotide Excision Repair Pathway Limits L1 Retrotransposition. Genetics 2017, 205, 139–153. [CrossRef]
  81. Guo, H.; Chitiprolu, M.; Gagnon, D.; Meng, L.; Perez-Iratxeta, C.; Lagace, D.; Gibbings, D. Autophagy supports genomic stability
  82. by degrading retrotransposon RNA. Nat. Commun. 2014, 5, 5276. [CrossRef]Xie, Y.; Mates, L.; Ivics, Z.; Izsvak, Z.; Martin, S.L.; An, W. Cell division promotes efficient retrotransposition in a stable L1 reporter
  83. cell line. Mob. DNA 2013, 4, 10. [CrossRef]
  84. Shi, X.; Seluanov, A.; Gorbunova, V. Cell divisions are required for L1 retrotransposition. Mol. Cell Biol. 2007, 27, 1264–1270.
  85. [CrossRef]
  86. Goff, S.P. Host factors exploited by retroviruses. Nat. Rev. Microbiol 2007, 5, 253–263. [CrossRef]
  87. Suzuki, Y.; Craigie, R. The road to chromatin—Nuclear entry of retroviruses. Nat. Rev. Microbiol. 2007, 5, 187–196. [CrossRef]
  88. Shi, J.; Wang, X.; Lyu, L.; Jiang, H.; Zhu, H.J. Comparison of protein expression between human livers and the hepatic cell lines
  89. HepG2, Hep3B, and Huh7 using SWATH and MRM-HR proteomics: Focusing on drug-metabolizing enzymes. Drug Metab.
  90. Pharmacokinet. 2018, 33, 133–140. [CrossRef] [PubMed]
  91. Kubo, S.; Seleme, M.C.; Soifer, H.S.; Perez, J.L.; Moran, J.V.; Kazazian, H.H., Jr.; Kasahara, N. L1 retrotransposition in nondividing
  92. and primary human somatic cells. Proc. Natl. Acad. Sci. USA 2006, 103, 8036–8041. [CrossRef] [PubMed]
  93. Macia, A.; Widmann, T.J.; Heras, S.R.; Ayllon, V.; Sanchez, L.; Benkaddour-Boumzaouad, M.; Munoz-Lopez, M.; Rubio, A.;
  94. Amador-Cubero, S.; Blanco-Jimenez, E.; et al. Engineered LINE-1 retrotransposition in nondividing human neurons. Genome Res.
  95. 2017, 27, 335–348. [CrossRef] [PubMed]

Complications From Taking COVID Vaccine Is 40 Times Higher Than Previously Recorded

Authors:  Jim Hoft Published May 3, 2022 

A new German study with around 40,000 participants concluded that severe complications after receiving the COVID vaccine.

The study found that those suffering serious complications is 40 times higher than previously recorded.

“The number of severe complications after vaccination against Sars-CoV-2 is 40 times higher than previously recorded by the Paul Ehrlich Institute (PEI),” a study with around 40,000 participants by the Berlin Charité concludes.

A study on side effects after corona vaccinations is being carried out at the Charite in Berlin. Professor Harald Matthes is leading the study and is calling for more contact points for those affected.

The number of serious complications after vaccinations against Sars-CoV-2 is 40 times higher than previously recorded by the Paul Ehrlich Institute (PEI). This is one of the results of a long-term observational study by the Berlin Charité. Study director Professor Harald Matthes is now calling for more contact points for those affected.

Study with around 40,000 participants
The study “Safety Profile of Covid-19 Vaccines” (“ImpfSurv” for short), which focuses on the effects and side effects of the various vaccines, has been running for a year. Around 40,000 vaccinated people are interviewed at regular intervals throughout Germany. Participation in the study is voluntary and independent of how the vaccines work in the subjects.

One result: eight out of 1,000 vaccinated people struggle with serious side effects. “The number is not surprising,” explains Prof. Dr. Harald Matthes, head of the study: “It corresponds to what is known from other countries such as Sweden, Israel or Canada. Incidentally, even the manufacturers of the vaccines had already determined similar values ​​in their studies.” With conventional vaccines, such as against polio or measles, the number of serious side effects is significantly lower.

Vaccinated Up to 15X MORE LIKELY Than Unvaxxed to Develop Heart Inflammation Requiring Hospitalization: Peer Reviewed Study

Authors:  Julian Conradson Published April 25, 2022 at 4:14pm

A new study out of Europe has revealed that cases of heart inflammation that required hospitalization were much more common among vaccinated individuals compared to the unvaccinated.

A team of researchers from health agencies in Finland, Denmark, Sweden, and Norway found that rates of myocarditis and pericarditis, two forms of potentially life-threatening heart inflammation, were higher in those who had received one or two doses of either mRNA-based vaccine – Pfizer’s or Moderna’s.

In all, researchers studied a total of 23.1 million records on individuals aged 12 or older between December 2020 and October 2021. In addition to the increased rate overall, the massive study confirmed the chances of developing the heart condition increased with a second dose, which mirrors other data that has been uncovered in recent months.

From the *peer-reviewed study, which was published by the Journal of the American Medical Association (JAMA):

“Results of this large cohort study indicated that both first and second doses of mRNA vaccines were associated with increased risk of myocarditis and pericarditis. For individuals receiving 2 doses of the same vaccine, risk of myocarditis was highest among young males (aged 16-24 years) after the second dose. These findings are compatible with between 4 and 7 excess events in 28 days per 100 000 vaccinees after BNT162b2, and between 9 and 28 excess events per 100 000 vaccinees after mRNA-1273.

The risks of myocarditis and pericarditis were highest within the first 7 days of being vaccinated, were increased for all combinations of mRNA vaccines, and were more pronounced after the second dose.”

Also mirroring other data, the study confirmed that young people, especially young males, are the ones who are suffering the worst effects of the experimental jab. Young men, aged 16-24 were an astounding 5-15X more likely to be hospitalized with heart inflammation than their unvaccinated peers.

But it isn’t just young men, all age groups across both sexes – except for men over 40 and girls aged 12-15 – experienced a higher rate of heart inflammation post-vaccination when compared to the unvaxxed.

From The Epoch Times, who spoke with one of the study’s main researchers, Dr. Rickard Ljung:

“‘These extra cases among men aged 16–24 correspond to a 5 times increased risk after Comirnaty and 15 times increased risk after Spikevax compared to unvaccinated,’ Dr. Rickard Ljung, a professor and physician at the Swedish Medical Products Agency and one of the principal investigators of the study, told The Epoch Times in an email.

Comirnaty is the brand name for Pfizer’s vaccine while Spikevax is the brand name for Moderna’s jab.

Rates were also higher among the age group for those who received any dose of the Pfizer or Moderna vaccines, both of which utilize mRNA technology. And rates were elevated among vaccinated males of all ages after the first or second dose, except for the first dose of Moderna’s shot for those 40 or older, and females 12- to 15-years-old.”

Although the peer-reviewed study found a direct link between mRNA based vaccines and increased incident rate of heart inflammation, the researchers claimed that the “benefits” of the experimental vaccines still “outweigh the risks of side effects,” because cases of heart inflammation are “very rare,” in a press conference about their findings earlier this month.

However, while overall case numbers may be low in comparison to the raw numbers and thus technically “very rare,” the rate at which individuals are developing this serious condition has increased by a whopping amount. When considering the fact that 5-15X more, otherwise healthy, young men will come down with the condition – especially since the chances of Covid-19 killing them at that age are effectively zero (99.995% recovery rate) – it’s downright criminal for governments across the world to continue pushing mass vaccinations for everyone.

Dr. Peter McCullough, a world-renowned Cardiologist who has been warning about the long-term horror show that is vaccine-induced myocarditis in young people, certainly thinks so. In his expert opinion, the study does anything but give confidence that the benefits of the vaccine outweigh the risks. In “no way” is that the case, he says. Actually, it’s quite the opposite.

From McCullough, via The Epoch Times:

“In cardiology we spend our entire career trying to save every bit of heart muscle. We put in stents, we do heart catheterization, we do stress tests, we do CT angiograms. The whole game of cardiology is to preserve heart muscle. Under no circumstances would we accept a vaccine that causes even one person to stay sustain heart damage. Not one. And this idea that ‘oh, we’re going to ask a large number of people to sustain heart damage for some other theoretical benefit for a viral infection,’ which for most is less than a common cold, is untenable. The benefits of the vaccines in no way outweigh the risks.”

It’s also worth pointing out that the new study’s findings could be an indicator as to what is driving the massive spike in the excess death rates in the United States and across the world. Correlating exactly with the rollout of the experimental mRNA Covid-19 vaccines, people have been dying at record-breaking rates, especially millennials, who experienced a jaw-dropping 84% increase in excess deaths (compared to pre-pandemic) in the final four months of 2021.

With all the data that has been made available up to this point, there is no denying that the vaccine is at least partially to blame for the spike in severe illness and death, if not entirely. Nevertheless, the CDC, Fauci, Biden, and the rest of the corrupt establishment continue to push mass vaccines, just approved another booster jab (with plans for another already in the works), and are licking their chops to unleash another round of Covid hysteria and crippling restrictions come this fall.

HHS Secretary Becerra Claims COVID Vaccines ‘Kill People Of Color’ At ‘Twice The Rate Of Whites,’ Vows To ‘Work’ Harder To Get More People Vaccinated

Authors: Alicia Powe Published April 19, 2022

After months of mandates forcing people to get two and three doses of COVID-19 vaccines to keep their jobs attend, school, travel and enter indoor venues, the federal government admits the experimental gene modification shots are killing people.

While vowing to ramp up biomedical tyranny and the effort to get more Americans vaccinated, U.S. Health and Human Services Director Xavier Becerra Experimental claimed the “safe and effective” mRNA shots are killing people with dark skin at a much higher rate than those with light skin.

“By the way, we know that vaccines are killing people of color — blacks, Latinos, indigenous people — at about two times the rate of white Americans,” Becerra explained during a digital “White House Convening on Equity” seminar on April 14.

After months of mandates forcing people to get two and three doses of COVID-19 vaccines to keep their jobs attend, school, travel and enter indoor venues, the federal government admits the experimental gene modification shots are killing people.

While vowing to ramp up biomedical tyranny and the effort to get more Americans vaccinated, U.S. Health and Human Services Director Xavier Becerra Experimental claimed the “safe and effective” mRNA shots are killing people with dark skin at a much higher rate than those with light skin.

“By the way, we know that vaccines are killing people of color — blacks, Latinos, indigenous people — at about two times the rate of white Americans,” Becerra explained during a digital “White House Convening on Equity” seminar on April 14.

After acknowledging the lethality of COVID shots, Becerra explained that approximately 80 percent of the American public is vaccinated.

But the government needs to “work” harder to vaccinate Americans who have refrained from getting inoculated, he argued.

“So, on vaccines, last year, we saw that about two-thirds of white American adults had received at least one shot of vaccine,” Becerra said. “That was just barely over 50 percent for black Americans and Latinos at that particular time. So, again, we’ve got to work.

“Today, a year later, over 80 percent of white American adults have received at least one shot. Over 80% of black American adults have received at least one shot. Over 80 percent of Latino Americans have received at least one vaccine shot.”

While HHS acknowledges the deadly effects COVID vaccines have on minority communities, the Center for Disease Control and Prevention’s Vaccine Adverse Effects System confirms the COVID shots are killing more people than any other vaccine in history.

According to VAERS, only 421 vaccine-related deaths in 2020 prior to the administration of the mRNA shots. In 2021, the number of people who dies after getting vaccinated precipitously spiked with at least 21,914 people died after receiving the COVID shots.

As yet, 5689 people died after receiving a COVID vaccine in 2022.

Meanwhile, the CDC is deploying fleets of federally funded “pandemic” buses to minority communities across the nation to persuade unvaccinated Americans into getting jabbed.

As reported, the CDC’s PANDEMIC (Program to Alleviate National Disparities in Ethnic and Minority Immunizations in the Community) deploys teams of health care workers into minority communities to educate people about why they need to be vaccinated.

According to PANDEMIC grant program materials, PANDEMIC’s goal is to reach groups that may experience “immunization disparities” in racial and ethnic minorities, residents of rural communities, migrant farmworkers, Native Americans, Hispanics, Blacks, and people identifying as part of the LGBTQ community and boost vaccination rates in areas chosen for having “high vaccine-hesitancy rate. ”

“If people aren’t sure [that they want the vaccine], then we have educational materials, and our community health workers and the extension agents will talk to them about their particular questions and try to answer their questions and their concerns. And then…[we] immediately give them the vaccine,” explained Catherine Striley of the University of Florida, who helps oversee the PANDEMIC project.

Worse Than the Disease? Reviewing Some Possible Unintended Consequences of the mRNA Vaccines Against COVID-19

Authors: Stephanie Seneff Computer Science and Artificial Intelligence Laboratory, MIT, Cambridge MA, 02139, USA, Greg Nigh Naturopathic Oncology, Immersion Health, Portland, OR 97214, USA International Journal of Vaccine Theory, Practice, and Research

Abstract

Operation Warp Speed brought to market in the United States two mRNA vaccines, produced by Pfizer and Moderna. Interim data suggested high efficacy for both of these vaccines, which helped legitimize Emergency Use Authorization (EUA) by the FDA. However, the exceptionally rapid movement of these vaccines through controlled trials and into mass deployment raises multiple safety concerns. In this review we first describe the technology underlying these vaccines in detail. We then review both components of and the intended biological response to these vaccines, including production of the spike protein itself, and their potential relationship to a wide range of both acute and long-term induced pathologies, such as blood disorders, neurodegenerative diseases and autoimmune diseases. Among these potential induced pathologies, we discuss the relevance of prion-protein-related amino acid sequences within the spike protein. We also present a brief review of studies supporting the potential for spike protein “shedding”, transmission of the protein from a vaccinated to an unvaccinated person, resulting in symptoms induced in the latter. We finish by addressing a common point of debate, namely, whether or not these vaccines could modify the DNA of those receiving the vaccination. While there are no studies demonstrating definitively that this is happening, we provide a plausible scenario, supported by previously established pathways for transformation and transport of genetic material, whereby injected mRNA could ultimately be incorporated into germ cell DNA for transgenerational transmission. We conclude with our recommendations regarding surveillance that will help to clarify the long-term effects of these experimental drugs and allow us to better assess the true risk/benefit ratio of these novel technologies.