Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line

Current Issues In Molecular Biology

Authors: Markus Aldén 1 , Francisko Olofsson Falla 1 , Daowei Yang 1 , Mohammad Barghouth 1 , Cheng Luan 1 , Magnus Rasmussen 2 and Yang De Marinis 1,*

Abstract: Preclinical studies of COVID-19 mRNA vaccine BNT162b2, developed by Pfizer and
BioNTech, showed reversible hepatic effects in animals that received the BNT162b2 injection.
Furthermore, a recent study showed that SARS-CoV-2 RNA can be reverse-transcribed and integrated into the genome of human cells. In this study, we investigated the effect of BNT162b2 on the human liver cell line Huh7 in vitro. Huh7 cells were exposed to BNT162b2, and quantitative PCR was performed on RNA extracted from the cells. We detected high levels of BNT162b2 in Huh7 cells and changes in gene expression of long interspersed nuclear element-1 (LINE-1), which is an endogenous reverse transcriptase. Immunohistochemistry using antibody binding to LINE-1 open reading frame-1 RNA-binding protein (ORFp1) on Huh7 cells treated with BNT162b2 indicated increased nucleus distribution of LINE-1. PCR on genomic DNA of Huh7 cells exposed to BNT162b2 amplified the DNA sequence unique to BNT162b2. Our results indicate a fast up-take of BNT162b2 into human liver cell line Huh7, leading to changes in LINE-1 expression and distribution. We also show that BNT162b2 mRNA is reverse transcribed intracellularly into DNA in as fast as 6 h upon BNT162b2 exposure.

Introduction
Coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2) was announced by the World Health Organization (WHO)
as a global pandemic on 11 March 2020, and it emerged as a devasting health crisis.
As of February 2022, COVID-19 has led to over 430 million reported infection cases and
5.9 million deaths worldwide [1]. Effective and safe vaccines are urgently needed to reduce the morbidity and mortality rates associated with COVID-19. Several vaccines for COVID-19 have been developed, with particular focus on mRNA vaccines (by Pfizer-BioNTech and Moderna), replication-defective recombinant adenoviral vector vaccines (by Janssen-Johnson and Johnson, Astra-Zeneca, Sputnik-V, and CanSino), and inactivated vaccines (by Sinopharm, Bharat Biotech and Sinovac). The mRNA vaccine has the advantages of being flexible and efficient in immunogen design and manufacturing, and currently, numerous vaccine candidates are in various stages of development and application. Specifically, COVID-19 mRNA vaccine BNT162b2 developed by Pfizer and BioNTech has been evaluated in successful clinical trials [2–4] and administered in national COVID-19 vaccination campaigns in different regions around the world [5–8]. BNT162b2 is a lipid nanoparticle (LNP)–encapsulated, nucleoside-modified RNA vaccine (modRNA) and encodes the full-length of SARS-CoV-2 spike (S) protein, modified by two proline mutations to ensure antigenically optimal pre-fusion conformation, which mimics the intact virus to elicit virus-neutralizing antibodies [3]. Consistent with randomized clinical trials, BNT162b2 showed high efficiency in a wide range of COVID-19-related outcomes in a real-world setting [5]. Nevertheless, many challenges remain, including monitoring for long-term safety and efficacy of the vaccine. This warrants further evaluation and investigations. The safety profile of BNT162b2 is currently only available from short-term clinical studies. Less common adverse effects of BNT162b2 have been reported, including pericarditis, arrhythmia, deep-vein thrombosis, pulmonary embolism, myocardial infarction, intracranial hemorrhage, and thrombocytopenia [4,9–20]. There are also studies that report adverse effects observed in other types of vaccines [21–24]. To better understand mechanisms underlying vaccine-related adverse effects, clinical investigations as well as cellular and molecular analyses are needed. A recent study showed that SARS-CoV-2 RNAs can be reverse-transcribed and integrated into the genome of human cells [25]. This gives rise to the question of if this may also occur with BNT162b2, which encodes partial SARS-CoV-2 RNA. In pharmacokinetics data provided by Pfizer to European Medicines Agency (EMA), BNT162b2 biodistribution was studied in mice and rats by intra-muscular injection with radiolabeled LNP and luciferase modRNA. Radioactivity was detected in most tissues from the first time point (0.25 h), and results showed that the injection site and the liver were the major sites of distribution, with maximum concentrations observed at 8–48 h post-dose [26]. Furthermore, in animals that received the BNT162b2 injection, reversible hepatic effects were observed, including enlarged liver, vacuolation, increased gamma glutamyl transferase (γGT) levels, and increased levels of aspartate transaminase (AST) and alkaline phosphatase (ALP) [26]. Transient hepatic effects induced by LNP delivery systems have been reported previously [27–30], nevertheless, it has also been shown that the empty LNP without modRNA alone does not introduce any significant liver injury [27]. Therefore, in this study, we aim to examine the effect of BNT162b2 on a human liver cell line in vitro and investigate if BNT162b2 can be reverse transcribed into DNA through endogenous mechanisms.

Materials and Methods 2.1.

Cell Culture Huh7 cells (JCRB Cell Bank, Osaka, Japan) were cultured in 37 ◦C at 5% CO2 with DMEM medium (HyClone, HYCLSH30243.01) supplemented with 10% (v/v) fetal bovine serum (Sigma-Aldrich, F7524-500ML, Burlington, MA, USA) and 1% (v/v) PenicillinStreptomycin (HyClone, SV30010, Logan, UT, USA). For BNT162b2 treatment, Huh7 cells were seeded with a density of 200,000 cells/well in 24-well plates. BNT162b2 mRNA vaccine (Pfizer BioNTech, New York, NY, USA) was diluted with sterile 0.9% sodium chloride injection, USP into a final concentration of 100 µg/mL as described in the manufacturer’s guideline [31]. BNT162b2 suspension was then added in cell culture media to reach final concentrations of 0.5, 1.0, or 2.0 µg/mL. Huh7 cells were incubated with or without BNT162b2 for 6, 24, and 48 h. Cells were washed thoroughly with PBS and harvested by trypsinization and stored in −80 ◦C until further use. 2.2. REAL-TIME RT-QPCR RNA from the cells was extracted with RNeasy Plus Mini Kit (Qiagen, 74134, Hilden, Germany) following the manufacturer’s protocol. RT-PCR was performed using RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, K1622, Waltham, MA, USA) following the manufacturers protocol. Real-time qPCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, K0222, Waltham, MA, USA) with primers for BNT162b2, LINE-1 and housekeeping genes ACTB and GAPDH (Table 1). Curr. Issues Mol. Biol. 2022, 44 1117 Table 1. Primer sequences of RT-qPCR and PCR. Target Sequence ACTB forward CCTCGCCTTTGCCGATCC ACTB reverse GGATCTTCATGAGGTAGTCAGTC GAPDH forward CTCTGCTCCTCCTGTTCGAC GAPDH reverse TTAAAAGCAGCCCTGGTGAC LINE-1 forward TAACCAATACAGAGAAGTGC LINE-1 reverse GATAATATCCTGCAGAGTGT BNT162b2 forward CGAGGTGGCCAAGAATCTGA BNT162b2 reverse TAGGCTAAGCGTTTTGAGCTG 2.3. Immunofluorescence Staining and Confocal Imaging Huh7 cells were cultured in eight-chamber slides (LAB-TEK, 154534, Santa Cruz, CA, USA) with a density of 40,000 cells/well, with or without BNT162b2 (0.5, 1 or 2 µg/mL) for 6 h. Immunohistochemistry was performed using primary antibody anti-LINE-1 ORF1p mouse monoclonal antibody (Merck, 3574308, Kenilworth, NJ, USA), secondary antibody Cy3 Donkey anti-mouse (Jackson ImmunoResearch, West Grove, PA, USA), and Hoechst (Life technologies, 34850, Carlsbad, CA, USA), following the protocol from Thermo Fisher (Waltham, MA, USA). Two images per condition were taken using a Zeiss LSM 800 and a 63X oil immersion objective, and the staining intensity was quantified on the individual whole cell area and the nucleus area on 15 cells per image by ImageJ 1.53c. LINE-1 staining intensity for the cytosol was calculated by subtracting the intensity of the nucleus from that of the whole cell. All images of the cells were assigned a random number to prevent bias. To mark the nuclei (determined by the Hoechst staining) and the whole cells (determined by the borders of the LINE-1 fluorescence), the Freehand selection tool was used. These areas were then measured, and the mean intensity was used to compare the groups. 2.4. Genomic DNA Purification, PCR Amplification, Agarose Gel Purification, and Sanger Sequencing Genomic DNA was extracted from cell pellets with PBND buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20) according to protocol described previously [32]. To remove residual RNA from the DNA preparation, RNase (100 µg/mL, Qiagen, Hilden, Germany) was added to the DNA preparation and incubated at 37 ◦C for 3 h, followed by 5 min at 95 ◦C. PCR was then performed using primers targeting BNT162b2 (sequences are shown in Table 1), with the following program: 5 min at 95 ◦C, 35 cycles of 95 ◦C for 30 s, 58 ◦C for 30 s, and 72 ◦C for 1 min; finally, 72 ◦C for 5 min and 12 ◦C for 5 min. PCR products were run on 1.4% (w/v) agarose gel. Bands corresponding to the amplicons of the expected size (444 bps) were cut out and DNA was extracted using QIAquick PCR Purification Kit (Qiagen, 28104, Hilden, Germany), following the manufacturer’s instructions. The sequence of the DNA amplicon was verified by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany). Statistics Statistical comparisons were performed using two-tailed Student’s t-test and ANOVA. Data are expressed as the mean ± SEM or ± SD. Differences with p < 0.05 are considered significant. 2.5. Ethical Statements The Huh7 cell line was obtained from Japanese Collection of Research Bioresources (JCRB) Cell Bank.

Results

BNT162b2 Enters Human Liver Cell Line Huh7 Cells at High Efficiency
To determine if BNT162b2 enters human liver cells, we exposed human liver cell
line Huh7 to BNT162b2. In a previous study on the uptake kinetics of LNP delivery in
Huh7 cells, the maximum biological efficacy of LNP was observed between 4–7 h [33].
Therefore, in our study, Huh7 cells were cultured with or without increasing concentrations
of BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6, 24, and 48 h. RNA was extracted from cells
and a real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR)
was performed using primers targeting the BNT162b2 sequence, as illustrated in Figure 1.
The full sequence of BNT162b2 is publicly available [34] and contains a two-nucleotides cap;
50 untranslated region (UTR) that incorporates the 50-UTR of a human α-globin gene; the
full-length of SARS-CoV-2 S protein with two proline mutations; 30-UTR that incorporates
the human mitochondrial 12S rRNA (mtRNR1) segment and human AES/TLE5 gene segment with two C→U mutations; poly(A) tail. Detailed analysis of the S protein sequence in BNT162b2 revealed 124 sequences that are 100% identical to human genomic sequences and three sequences with only one nucleotide (nt) mismatch in 19–26 nts (Table S1, see Supplementary Materials). To detect BNT162b2 RNA level, we designed primers with forward primer located in SARS-CoV-2 S protein regions and reverse primer in 30-UTR,which allows detection of PCR amplicon unique to BNT162b2 without unspecific binding of the primers to human genomic regions.

Discussion
In this study we present evidence that COVID-19 mRNA vaccine BNT162b2 is able
to enter the human liver cell line Huh7 in vitro. BNT162b2 mRNA is reverse transcribed
intracellularly into DNA as fast as 6 h after BNT162b2 exposure. A possible mechanism for reverse transcription is through endogenous reverse transcriptase LINE-1, and the nucleus protein distribution of LINE-1 is elevated by BNT162b2. Intracellular accumulation of LNP in hepatocytes has been demonstrated in vivo [36]. A preclinical study on BNT162b2 showed that BNT162b2 enters the human cell line HEK293T cells and leads to robust expression of BNT162b2 antigen [37]. Therefore, in this study, we first investigated the entry of BNT162b2 in the human liver cell line Huh7 cells. The choice of BNT162b2 concentrations used in this study warrants explanation. BNT162b2 is administered as a series of two doses three weeks apart, and each dose contains 30 µg of BNT162b2 in a volume of 0.3 mL, which makes the local concentration at the injection site at the highest 100 µg/mL [31]. A previous study on mRNA vaccines against H10N8 and H7N9 influenza viruses using a similar LNP delivery system showed that the mRNA vaccine can distribute rather nonspecifically to several organs such as liver, spleen, heart, kidney, lung, and brain, and the concentration in the liver is roughly 100 times lower than that of the intra-muscular injection site [38]. In the assessment report on BNT162b2 provided to EMA by Pfizer, the pharmacokinetic distribution studies in rats demonstrated that a relatively large proportion (up to 18%) of the total dose distributes to the liver [26]. We therefore chose to use 0.5, 1, and 2 µg/mL of vaccine in our experiments on the liver cells. However, the effect of a broader range of lower and higher concentrations of BNT162b2 should also be verified in future studies. In the current study, we employed a human liver cell line for in vitro investigation. It is worth investigating if the liver cells also present the vaccine-derived SARS-CoV-2 spike protein, which could potentially make the liver cells targets for previously primed spike protein reactive cytotoxic T cells. There has been case reports on individuals who developed autoimmune hepatitis [39] after BNT162b2 vaccination. To obtain better under-standing of the potential effects of BNT162b2 on liver function, in vivo models are desired for future studies. In the BNT162b2 toxicity report, no genotoxicity nor carcinogenicity studies have been provided [26]. Our study shows that BNT162b2 can be reverse transcribed to DNA in liver cell line Huh7, and this may give rise to the concern if BNT162b2-derived DNA may be integrated into the host genome and affect the integrity of genomic DNA, which may potentially mediate genotoxic side effects. At this stage, we do not know if DNA reverse transcribed from BNT162b2 is integrated into the cell genome. Further studies are needed to demonstrate the effect of BNT162b2 on genomic integrity, including whole genome sequencing of cells exposed to BNT162b2, as well as tissues from human subjects who received BNT162b2 vaccination. Human autonomous retrotransposon LINE-1 is a cellular endogenous reverse transcriptase and the only remaining active transposon in humans, able to retrotranspose itself and other nonautonomous elements [40,41], and ~17% of the human genome are comprised of LINE-1 sequences [42]. The nonautonomous Alu elements, short, interspersed nucleotide elements (SINEs), variable-number-of-tandem-repeats (VNTR), as well as cellular mRNA-processed pseudogenes, are retrotransposed by the LINE-1 retrotransposition proteins working in trans [43,44]. A recent study showed that endogenous LINE-1 mediates reverse transcription and integration of SARS-CoV-2 sequences in the genomes of infected human cells [25]. Further-more, expression of endogenous LINE-1 is often increased upon viral infection, including SARS-CoV-2 infection [45–47]. Previous studies showed that LINE-1 retrotransposition activity is regulated by RNA metabolism [48,49], DNA damage response [50], and autophagy [51]. Efficient retro-transposition of LINE-1 is often associated with cell cycle and nuclear envelope breakdown during mitosis [52,53], as well as exogenous retroviruses [54,55], which promotes entrance of LINE-1 into the nucleus. In our study, we observed increased LINE-1 ORF1p distribution as determined by immunohistochemistry in the nucleus by BNT162b2 at all concentrations tested (0.5, 1, and 2 µg/mL), while elevated LINE-1 gene expression was detected at the highest BNT162b2 concentration (2 µg/mL). It is worth noting that gene transcription is regulated by chromatin modifications, transcription factor regulation, and the rate of RNA degradation, while translational regulation of protein involves ribosome recruitment on the initiation codon, modulation of peptide elongation, termination of protein synthesis, or ribosome biogenesis. These two processes are controlled by different mechanisms, and therefore they may not always show the same change patterns in response to external challenges. The exact regulation of LINE-1 activity in response to BNT162b2 merits further study. The cell model that we used in this study is a carcinoma cell line, with active DNA replication which differs from non-dividing somatic cells. It has also been shown that Huh7 cells display significant different gene and protein expression including upregulated proteins involved in RNA metabolism [56]. However, cell proliferation is also active in several human tissues such as the bone marrow or basal layers of epithelia as well as during embryogenesis, and it is therefore necessary to examine the effect of BNT162b2 on genomic integrity under such conditions. Furthermore, effective retrotransposition of LINE-1 has also been reported in non-dividing and terminally differentiated cells, such as human neurons [57,58]. The Pfizer EMA assessment report also showed that BNT162b2 distributes in the spleen (<1.1%), adrenal glands (<0.1%), as well as low and measurable radioactivity in the ovaries and testes (<0.1%) [26]. Furthermore, no data on placental transfer of BNT162b2 is available from Pfizer EMA assessment report. Our results showed that BNT162b2 mRNA readily enters Huh7 cells at a concentration (0.5 µg/mL) corresponding to 0.5% of the local injection site concentration, induce changes in LINE-1 gene and protein expression, and within 6 h, reverse transcription of BNT162b2 can be detected. It is therefore important to investigate further the effect of BNT162b2 on other cell types and tissues both in vitro and in vivo. 5. Conclusions Our study is the first in vitro study on the effect of COVID-19 mRNA vaccine BNT162b2 on human liver cell line. We present evidence on fast entry of BNT162b2 into the cells and subsequent intracellular reverse transcription of BNT162b2 mRNA into DNA.

Supplementary Materials: The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/cimb44030073/s1.

Author Contributions: M.A., F.O.F., D.Y., M.B. and C.L. performed in vitro experiments. M.A. and F.O.F. performed data analysis. M.R. and Y.D.M. contributed to the implementation of the research, designed, and supervised the study. Y.D.M. wrote the paper with input from all authors. All authors have read and agreed to the published version of the manuscript.

Funding: This study was supported by the Swedish Research Council, Strategic Research Area Exodiab, Dnr 2009-1039, the Swedish Government Fund for Clinical Research (ALF) and the foundation of Skåne University Hospital. Institutional Review Board Statement: Not applicable.

Informed Consent Statement: Not applicable.

Data Availability Statement: All data supporting the findings of this study are available within the article and supporting information.

Acknowledgments: The authors thank Sven Haidl, Maria Josephson, Enming Zhang, Jia-Yi Li, Caroline Haikal, and Pradeep Bompada for their support to this study

References

  1. World Health Organization. Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on
    22 February 2022).
  2. Mulligan, M.J.; Lyke, K.E.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Raabe, V.; Bailey, R.; Swanson, K.A.; et al.
    Phase I/II study of COVID-19 RNA vaccine BNT162b1 in adults. Nature 2020, 586, 589–593. [CrossRef] [PubMed]
  3. Walsh, E.E.; Frenck, R.W., Jr.; Falsey, A.R.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Mulligan, M.J.;
    Bailey, R.; et al. Safety and Immunogenicity of Two RNA-Based COVID-19 Vaccine Candidates. N. Engl. J. Med. 2020, 383,
    2439–2450. [CrossRef] [PubMed]
  4. Polack, F.P.; Thomas, S.J.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Perez, J.L.; Perez Marc, G.; Moreira, E.D.; Zerbini, C.; et al.
    Safety and Efficacy of the BNT162b2 mRNA COVID-19 Vaccine. N. Engl. J. Med. 2020, 383, 2603–2615. [CrossRef] [PubMed]
  5. Harris, R.J.; Hall, J.A.; Zaidi, A.; Andrews, N.J.; Dunbar, J.K.; Dabrera, G. Effect of Vaccination on Household Transmission of
    SARS-CoV-2 in England. N. Engl. J. Med. 2021, 385, 759–760. [CrossRef]
  6. Butt, A.A.; Omer, S.B.; Yan, P.; Shaikh, O.S.; Mayr, F.B. SARS-CoV-2 Vaccine Effectiveness in a High-Risk National Population in a
    Real-World Setting. Ann. Intern. Med. 2021, 174, 1404–1408. [CrossRef]
  7. Dagan, N.; Barda, N.; Kepten, E.; Miron, O.; Perchik, S.; Katz, M.A.; Hernan, M.A.; Lipsitch, M.; Reis, B.; Balicer, R.D. BNT162b2
    mRNA Covid-19 Vaccine in a Nationwide Mass Vaccination Setting. N. Engl. J. Med. 2021, 384, 1412–1423. [CrossRef]
  8. Rossman, H.; Shilo, S.; Meir, T.; Gorfine, M.; Shalit, U.; Segal, E. COVID-19 dynamics after a national immunization program in
    Israel. Nat. Med. 2021, 27, 1055–1061. [CrossRef]
  9. Fan, B.E.; Shen, J.Y.; Lim, X.R.; Tu, T.M.; Chang, C.C.R.; Khin, H.S.W.; Koh, J.S.; Rao, J.P.; Lau, S.L.; Tan, G.B.; et al. Cerebral venous
    thrombosis post BNT162b2 mRNA SARS-CoV-2 vaccination: A black swan event. Am. J. Hematol. 2021, 96, E357–E361. [CrossRef]
  10. Larson, K.F.; Ammirati, E.; Adler, E.D.; Cooper, L.T., Jr.; Hong, K.N.; Saponara, G.; Couri, D.; Cereda, A.; Procopio, A.; Cavalotti, C.; et al.
    Myocarditis After BNT162b2 and mRNA-1273 Vaccination. Circulation 2021, 144, 506–508. [CrossRef]
  11. Menni, C.; Klaser, K.; May, A.; Polidori, L.; Capdevila, J.; Louca, P.; Sudre, C.H.; Nguyen, L.H.; Drew, D.A.; Merino, J.; et al. Vaccine
    side-effects and SARS-CoV-2 infection after vaccination in users of the COVID Symptom Study app in the UK: A prospective
    observational study. Lancet Infect. Dis. 2021, 21, 939–949. [CrossRef]
  12. Hansen, T.; Titze, U.; Kulamadayil-Heidenreich, N.S.A.; Glombitza, S.; Tebbe, J.J.; Rocken, C.; Schulz, B.; Weise, M.; Wilkens, L.
    First case of postmortem study in a patient vaccinated against SARS-CoV-2. Int. J. Infect. Dis. 2021, 107, 172–175. [CrossRef]
    [PubMed]
  13. Kadali, R.A.K.; Janagama, R.; Peruru, S.; Malayala, S.V. Side effects of BNT162b2 mRNA COVID-19 vaccine: A randomized,
    cross-sectional study with detailed self-reported symptoms from healthcare workers. Int. J. Infect. Dis. 2021, 106, 376–381.
    [CrossRef] [PubMed]
  14. Parkash, O.; Sharko, A.; Farooqi, A.; Ying, G.W.; Sura, P. Acute Pancreatitis: A Possible Side Effect of COVID-19 Vaccine. Cureus
    2021, 13, e14741. [CrossRef] [PubMed]
  15. Mazzatenta, C.; Piccolo, V.; Pace, G.; Romano, I.; Argenziano, G.; Bassi, A. Purpuric lesions on the eyelids developed after
    BNT162b2 mRNA COVID-19 vaccine: Another piece of SARS-CoV-2 skin puzzle? J. Eur. Acad. Dermatol. Venereol. 2021, 35,
    e543–e545. [CrossRef]
  16. Lee, E.J.; Cines, D.B.; Gernsheimer, T.; Kessler, C.; Michel, M.; Tarantino, M.D.; Semple, J.W.; Arnold, D.M.; Godeau, B.;
    Lambert, M.P.; et al. Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination. Am. J. Hematol. 2021, 96, 534–537.
    [CrossRef]
  17. Ishay, Y.; Kenig, A.; Tsemach-Toren, T.; Amer, R.; Rubin, L.; Hershkovitz, Y.; Kharouf, F. Autoimmune phenomena following
    SARS-CoV-2 vaccination. Int. Immunopharmacol. 2021, 99, 107970. [CrossRef]
  18. Das, B.B.; Kohli, U.; Ramachandran, P.; Nguyen, H.H.; Greil, G.; Hussain, T.; Tandon, A.; Kane, C.; Avula, S.; Duru, C.; et al.
    Myopericarditis following mRNA COVID-19 Vaccination in Adolescents 12 through 18 Years of Age. J. Pediatr. 2021, 238, 26–32.e1.
    [CrossRef]
  19. McLaurin-Jiang, S.; Garner, C.D.; Krutsch, K.; Hale, T.W. Maternal and Child Symptoms Following COVID-19 Vaccination Among
    Breastfeeding Mothers. Breastfeed. Med. 2021, 16, 702–709. [CrossRef]
  20. Barda, N.; Dagan, N.; Ben-Shlomo, Y.; Kepten, E.; Waxman, J.; Ohana, R.; Hernan, M.A.; Lipsitch, M.; Kohane, I.; Netzer, D.; et al.
    Safety of the BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Setting. N. Engl. J. Med. 2021, 385, 1078–1090. [CrossRef]
  21. Baden, L.R.; El Sahly, H.M.; Essink, B.; Kotloff, K.; Frey, S.; Novak, R.; Diemert, D.; Spector, S.A.; Rouphael, N.; Creech, C.B.; et al.
    Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N. Engl. J. Med. 2021, 384, 403–416. [CrossRef]
  22. Sadoff, J.; Gray, G.; Vandebosch, A.; Cardenas, V.; Shukarev, G.; Grinsztejn, B.; Goepfert, P.A.; Truyers, C.; Fennema, H.;
    Spiessens, B.; et al. Safety and Efficacy of Single-Dose Ad26.COV2.S Vaccine against Covid-19. N. Engl. J. Med. 2021, 384,
    2187–2201. [CrossRef] [PubMed]
  23. Eichinger, S.; Warkentin, T.E.; Greinacher, A. Thrombotic Thrombocytopenia after ChAdOx1 nCoV-19 Vaccination. Reply. N. Engl.
    J. Med. 2021, 385, e11. [CrossRef] [PubMed]
  24. Doroftei, B.; Ciobica, A.; Ilie, O.D.; Maftei, R.; Ilea, C. Mini-Review Discussing the Reliability and Efficiency of COVID-19 Vaccines.
    Diagnostics 2021, 11, 579. [CrossRef]Zhang, L.; Richards, A.; Barrasa, M.I.; Hughes, S.H.; Young, R.A.; Jaenisch, R. Reverse-transcribed SARS-CoV-2 RNA can integrate
  25. into the genome of cultured human cells and can be expressed in patient-derived tissues. Proc. Natl. Acad. Sci. USA 2021, 118,
  26. e2105968118. [CrossRef] [PubMed]
  27. Available online: https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_
  28. en.pdf (accessed on 24 February 2022).
  29. Tanaka, H.; Takata, N.; Sakurai, Y.; Yoshida, T.; Inoue, T.; Tamagawa, S.; Nakai, Y.; Tange, K.; Yoshioka, H.; Maeki, M.; et al.
  30. Delivery of Oligonucleotides Using a Self-Degradable Lipid-Like Material. Pharmaceutics 2021, 13, 544. [CrossRef]
  31. Sedic, M.; Senn, J.J.; Lynn, A.; Laska, M.; Smith, M.; Platz, S.J.; Bolen, J.; Hoge, S.; Bulychev, A.; Jacquinet, E.; et al. Safety
  32. Evaluation of Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat and Cynomolgus Monkey. Vet. Pathol.
  33. 2018, 55, 341–354. [CrossRef]
  34. Sato, Y.; Matsui, H.; Yamamoto, N.; Sato, R.; Munakata, T.; Kohara, M.; Harashima, H. Highly specific delivery of siRNA to
  35. hepatocytes circumvents endothelial cell-mediated lipid nanoparticle-associated toxicity leading to the safe and efficacious
  36. decrease in the hepatitis B virus. J. Control. Release 2017, 266, 216–225. [CrossRef]
  37. Heidel, J.D.; Yu, Z.; Liu, J.Y.; Rele, S.M.; Liang, Y.; Zeidan, R.K.; Kornbrust, D.J.; Davis, M.E. Administration in non-human
  38. primates of escalating intravenous doses of targeted nanoparticles containing ribonucleotide reductase subunit M2 siRNA. Proc.
  39. Natl. Acad. Sci. USA 2007, 104, 5715–5721. [CrossRef]
  40. Available online: https://www.cvdvaccine-us.com/ (accessed on 24 February 2022).
  41. Available online: http://bridgeslab.sph.umich.edu/protocols/index.php/Preparation_of_Tail_Samples_(for_Genotyping)
  42. (accessed on 24 February 2022).
  43. Gallud, A.; Munson, M.J.; Liu, K.; Idstrom, A.; Barriga, H.M.; Tabaei, S.; Aliakbarinodehi, N.; Ojansivu, M.; Lubart, Q.;
  44. Doutch, J.J.; et al. Time evolution of PEG-shedding and serum protein coronation determines the cell uptake kinetics and delivery
  45. of lipid nanoparticle. bioRxiv 2021. [CrossRef]
  46. World Health Organization Messenger RNA Encoding the Full-Length SARS-CoV-2 Spike Glycoprotein. 2020. Available
  47. online: https://web.archive.org/web/20210105162941/https://mednet-communities.net/inn/db/media/docs/11889.doc
  48. (accessed on 24 February 2022).
  49. Mita, P.; Wudzinska, A.; Sun, X.; Andrade, J.; Nayak, S.; Kahler, D.J.; Badri, S.; LaCava, J.; Ueberheide, B.; Yun, C.Y.; et al. LINE-1
  50. protein localization and functional dynamics during the cell cycle. Elife 2018, 7, e30058. [CrossRef]
  51. Sato, Y.; Kinami, Y.; Hashiba, K.; Harashima, H. Different kinetics for the hepatic uptake of lipid nanoparticles between the
  52. apolipoprotein E/low density lipoprotein receptor and the N-acetyl-d-galactosamine/asialoglycoprotein receptor pathway. J.
  53. Control. Release 2020, 322, 217–226. [CrossRef]
  54. Vogel, A.B.; Kanevsky, I.; Che, Y.; Swanson, K.A.; Muik, A.; Vormehr, M.; Kranz, L.M.; Walzer, K.C.; Hein, S.; Guler, A.; et al.
  55. BNT162b vaccines protect rhesus macaques from SARS-CoV-2. Nature 2021, 592, 283–289. [CrossRef] [PubMed]
  56. Bahl, K.; Senn, J.J.; Yuzhakov, O.; Bulychev, A.; Brito, L.A.; Hassett, K.J.; Laska, M.E.; Smith, M.; Almarsson, O.; Thompson, J.; et al.
  57. Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses. Mol. Ther.
  58. 2017, 25, 1316–1327. [CrossRef] [PubMed]
  59. Bril, F.; Al Diffalha, S.; Dean, M.; Fettig, D.M. Autoimmune hepatitis developing after coronavirus disease 2019 (COVID-19)
  60. vaccine: Causality or casualty? J. Hepatol. 2021, 75, 222–224. [CrossRef]
  61. Kazazian, H.H., Jr.; Moran, J.V. Mobile DNA in Health and Disease. N. Engl. J. Med. 2017, 377, 361–370. [CrossRef] [PubMed]
  62. Coffin, J.M.; Fan, H. The Discovery of Reverse Transcriptase. Annu. Rev. Virol. 2016, 3, 29–51. [CrossRef]
  63. Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al.
  64. Initial sequencing and analysis of the human genome. Nature 2001, 409, 860–921. [CrossRef]
  65. Ostertag, E.M.; Goodier, J.L.; Zhang, Y.; Kazazian, H.H., Jr. SVA elements are nonautonomous retrotransposons that cause disease
  66. in humans. Am. J. Hum. Genet. 2003, 73, 1444–1451. [CrossRef]
  67. Hancks, D.C.; Kazazian, H.H., Jr. Active human retrotransposons: Variation and disease. Curr. Opin. Genet. Dev. 2012, 22, 191–203.
  68. [CrossRef]
  69. Jones, R.B.; Song, H.; Xu, Y.; Garrison, K.E.; Buzdin, A.A.; Anwar, N.; Hunter, D.V.; Mujib, S.; Mihajlovic, V.; Martin, E.; et al.
  70. LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells. J. Virol. 2013, 87, 13307–13320. [CrossRef]
  71. Macchietto, M.G.; Langlois, R.A.; Shen, S.S. Virus-induced transposable element expression up-regulation in human and mouse
  72. host cells. Life Sci. Alliance 2020, 3, e201900536. [CrossRef] [PubMed]
  73. Yin, Y.; Liu, X.Z.; He, X.; Zhou, L.Q. Exogenous Coronavirus Interacts With Endogenous Retrotransposon in Human Cells. Front.
  74. Cell Infect. Microbiol. 2021, 11, 609160. [CrossRef] [PubMed]
  75. Belancio, V.P.; Roy-Engel, A.M.; Deininger, P. The impact of multiple splice sites in human L1 elements. Gene 2008, 411, 38–45.
  76. [CrossRef] [PubMed]
  77. Dai, L.; Taylor, M.S.; O’Donnell, K.A.; Boeke, J.D. Poly(A) binding protein C1 is essential for efficient L1 retrotransposition and
  78. affects L1 RNP formation. Mol. Cell Biol. 2012, 32, 4323–4336. [CrossRef]
  79. Servant, G.; Streva, V.A.; Derbes, R.S.; Wijetunge, M.I.; Neeland, M.; White, T.B.; Belancio, V.P.; Roy-Engel, A.M.; Deininger, P.L.
  80. The Nucleotide Excision Repair Pathway Limits L1 Retrotransposition. Genetics 2017, 205, 139–153. [CrossRef]
  81. Guo, H.; Chitiprolu, M.; Gagnon, D.; Meng, L.; Perez-Iratxeta, C.; Lagace, D.; Gibbings, D. Autophagy supports genomic stability
  82. by degrading retrotransposon RNA. Nat. Commun. 2014, 5, 5276. [CrossRef]Xie, Y.; Mates, L.; Ivics, Z.; Izsvak, Z.; Martin, S.L.; An, W. Cell division promotes efficient retrotransposition in a stable L1 reporter
  83. cell line. Mob. DNA 2013, 4, 10. [CrossRef]
  84. Shi, X.; Seluanov, A.; Gorbunova, V. Cell divisions are required for L1 retrotransposition. Mol. Cell Biol. 2007, 27, 1264–1270.
  85. [CrossRef]
  86. Goff, S.P. Host factors exploited by retroviruses. Nat. Rev. Microbiol 2007, 5, 253–263. [CrossRef]
  87. Suzuki, Y.; Craigie, R. The road to chromatin—Nuclear entry of retroviruses. Nat. Rev. Microbiol. 2007, 5, 187–196. [CrossRef]
  88. Shi, J.; Wang, X.; Lyu, L.; Jiang, H.; Zhu, H.J. Comparison of protein expression between human livers and the hepatic cell lines
  89. HepG2, Hep3B, and Huh7 using SWATH and MRM-HR proteomics: Focusing on drug-metabolizing enzymes. Drug Metab.
  90. Pharmacokinet. 2018, 33, 133–140. [CrossRef] [PubMed]
  91. Kubo, S.; Seleme, M.C.; Soifer, H.S.; Perez, J.L.; Moran, J.V.; Kazazian, H.H., Jr.; Kasahara, N. L1 retrotransposition in nondividing
  92. and primary human somatic cells. Proc. Natl. Acad. Sci. USA 2006, 103, 8036–8041. [CrossRef] [PubMed]
  93. Macia, A.; Widmann, T.J.; Heras, S.R.; Ayllon, V.; Sanchez, L.; Benkaddour-Boumzaouad, M.; Munoz-Lopez, M.; Rubio, A.;
  94. Amador-Cubero, S.; Blanco-Jimenez, E.; et al. Engineered LINE-1 retrotransposition in nondividing human neurons. Genome Res.
  95. 2017, 27, 335–348. [CrossRef] [PubMed]

SARS-CoV-2 and the Vaccination Hype

Authors: Piero Sangaletti Edge-Institute Austria at ER-System Mechatronics, Golling, Austria, Advisory Board of Concerned Scientists, Tampa, Florida USA, Antonietta GattiCofounder and Principal Investigator of Nanodiagnostics, SRL (Società a Responsabilità Limitata), Italy. Clemens Arvay Independent scientist and textbook author in Health Ecology, Vienna and Graz,

Abstract

The engineered spike protein of SARS-COV-2, and the corresponding infectious disease COVID-19 attributed to it, hold in their grip a large portion of humanity. The global race for a counter strategy quickly turned into a search for a vaccine as the preferred means to contain the virus. An unusually rapid development of different and completely new classes of experimental therapies that would widely be referred to as “vaccines” raised questions about safety, especially with regard to emergency use approval (EUA) being granted with unprecedented urgency and hardly any critical scrutiny. At present, independent researchers, even some former proponents and insiders, of the currently ongoing global experiment represented as a “vaccination” campaign point primarily to the lack of public safety studies based on empirical datasets that should be obtainable for the tens of millions, even hundreds of millions, of doses of mRNA and DNA vector therapeutics being distributed as “vaccines”. Studies regarding efficacy and “side effects” (sometimes fatalities or permanent iatrogenic injuries) of these experimental therapies have been by-passed in favor of short-term field data from real patients which inevitably raises scientific and ethical questions particularly in view of the fact that the persons and entities responsible for public safety hold deep financial and other vested interests in speeding along the distribution of the experimental pharmaceutical products. The lack of an open discussion about the experimental therapies for COVID-19 now being applied across all age groups, even children hardly impacted by COVID-19, is worrying. The core principle of open debate without pre-conceptions or vested interests in outcomes has been and continues to be utterly ignored. We hope to engage scientific discussion with the hope of helping decision-makers, the general public, and the media alike to consider the subject-matter of what is at stake in a context of reason rather than panic.

References

Adiguzel, Y., (2021). Molecular mimicry between SARS-CoV-2 and human proteins. Autoimmunity Reviews, 20(4), 102791. https://doi.org/10.1016/j.autrev.2021.102791

Agmon-Levin, N., Paz, Z., Israeli, E., & Shoenfeld Y. (2009) Vaccines and autoimmunity. Nat Rev Rheumatol, 5(11):648-52. https://doi.org/10.1038/nrrheum.2009.196

Alwan, N.A., Burgess, R.A., Ashworth, S., Beale, R., Bhadelia, N., Bogaert, D., Dowd, J., Eckerle, I., Goldman, L.R., Greenhalgh, T., Gurdasani, D., Hamdy, A., Hanage, W.P., Hodcroft, E.B., Hyde, Z., Kellam, P., Kelly-Irving, M., Krammer, F., Lipsitch, M., McNally, A., McKee, M., Nouri, A., Pimenta, D., Priesemann, V., Rutter, H., Silver, J., Sridhar, D., Swanton, C., Walensky, R.P., Yamey, G., & Ziauddeen, H. (2020). Scientific consensus on the COVID-19 pandemic: we need to act now. Lancet 396(10260): e71-e72. https://doi.org/10.1016/S0140-6736(20)32153-X. The corresponding “John Snow Memorandum” is available online https://www.johnsnowmemo.com/john-snow-memo.html (accessed: Feb. 2021)

Andeweg, S.P., Vennema, H., Veldhuijzen, I.K., Smorenburg, N., Schmitz, D., Zwagemaker, F., SeqNeth, Molecular surveillance group, RIVM COVID-19 Molecular epidemiology group, van Gageldonk-Lafeber, A.B., Chantal, S.H., Reusken REM, Knol, M.J., & Eggink, D. (2021). Increased risk of infection with SARS-CoV-2 Beta, Gamma, and Delta variant compared to Alpha variant in vaccinated individuals. medRxiv: 244530109. https://doi.org/10.1101/2021.11.24.21266735

Andrews, N., Stowe, J., Kirsebom, F., Toffa, S., Rickeard, T., Gallagher, E., Gower, C., Kall, M., Groves, N., O’Connell, A., Simons, D., Blomquist, P.B., Dabrera, G., Myers, R., Ladhani, S.N., Amirthalingam, G., Gharbia, S., Barrett, J.C., Elson, R., Ferguson, N., Zambon, M., Campbell, C.N.J., Brown, K., Hopkins, S., Chand, M., Ramsay, M., & Lopez Bernal, J. (2021). Effectiveness of COVID-19 vaccines against the Omicron (B.1.1.529) variant of concern. medRxiv, 2021.12.14.21267615. https://doi.org/10.1101/2021.12.14.21267615

Aubrit, F., Perugi, F., Léon, A., Guéhenneux, F., Champion-Arnaud, P., Lahmar, M., & Schwamborn K (2015). Cell substrates for the production of viral vaccines. Vaccine, 33(44): 5905-5912. https://doi.org/10.1016/j.vaccine.2015.06.110

Arvay, C. (2020). Genetische Impfstoffe gegen COVID-19: Hoffnung oder Risiko? [Genetic Vaccines Against COVID-19: Hope Or Risk?] Schweiz Ärztezeitung, 101(2728): 862-864. https://doi.org/10.4414/saez.2020.18982

Avci, E., & Abasiyanik, F. (2021). Autoimmune hepatitis after SARS-CoV-2 vaccine: New-onset or flare-up? J Autoimmun 125: 102745. https://doi.org/10.1016/j.jaut.2021.102745

Bahl, K., Senn, J.J., Yuzhakov, O., Bulychev, A., Brito, L.A., Hassett, K.J., Laska, M.E., Smith, M., Almarsson, Ö., Thompson, J., Ribeiro, A.M., Watson, M., Zaks, T., & Ciaramella, G. (2017). Preclinical and clinical demonstration of immunogenicity by mRNA vaccines against H10N8 and H7N9 influenza viruses. Mol Ther, 25(6):1316-1327. https://doi.org/10.1016/j.ymthe.2017.03.035

Baum, C., Kustikova, O., Modlich, U., Li, Z.X., & Fehse, B. (2006). Mutagenesis and oncogenesis by chromosomal insertion of gene transfer vectors. Hum Gene Ther , 17(3): 253-263. https://doi.org/10.1089/hum.2006.17.253

Birnhack, M. (2021). Who Controls COVID-Related Medical Data? Copyright and Personal Data. IIC 52: 821–824. Doi: 10.1007/s40319-021-01067-5; related source file: https://govextra.gov.il/media/30806/11221-moh-pfizer-collaboration-agreement-redacted.pdf (accessed: Feb. 2021)

BL, (2020). Dr. Kary Mullis—Inventor of PCR. Benevolent Lite. https://www.youtube.com/watch?v=7j8STZQWFi4 (accessed: Dec. 2021)

Blankenhorn, D. (2021). Novavax Stock Needs a Longer Pandemic as Investor Patience Wears Thin. Investor Place (accessed: Sept. 2021): https://markets.businessinsider.com/news/stocks/novavax-stock-needs-a-longer-pandemic-as-investor-patience-wears-thin-1030833455

Blaylock, R.L. (2021). Excitotoxicity (immunoexcitotoxicity) as a critical component of the cytokine storm reaction in pulmonary viral infections, including SARS-CoV-2. International Journal of Vaccine Theory, Practice, and Research, 1(2), 223–242. https://ijvtpr.com/index.php/IJVTPR/article/view/14

Bock, J. (2021). Vaccinating people who have had COVID-19: why doesn’t natural immunity count in the US? BMJ, 374: n2101. https://doi.org/10.1136/bmj.n2101

BN, (2019a). Vaccino antiinfluenzale: a Bergamo ordinate 185 000 dosi. Bergamo News. https://www.bergamonews.it/2019/10/21/vaccinazione-antinfluenzale-a-bergamo-ordinate-185-000-dosi-di-vaccino/332164/?fbclid=IwAR1glyhj6RQOqOp8YbBf5oLMrknl8P4DyQ-k_GsVicLA-vWuTFwiITSUnzM (accessed: May 2020)

BN, (2019b). Emergenza Meningite, Vaccinate 34mila persone tra Brescia e Bergamo. Bergamo News. https://www.bsnews.it/2020/01/18/meningite-vaccinate-34mila-persone-tra-brescia-e-bergamo/?fbclid=IwAR1bsaQy4Ppd21k4WLPkYYMnpiBY5tEtdk5gEH25rZfrGjTDyI_RnxNytNU (accessed: May 2020)

Bresalier, R.S., Sandler, R.S., Quan, H., Bolognese, J.A., Oxenius, B., Horgan, K., Lines, C., Riddell, R., Morton, D., Lanas, A., Konstam, M.A., & Baron, J.A. (2005). Adenomatous polyp prevention on Vioxx (APPROVe) trial investigators. Cardiovascular events associated with rofecoxib in a colorectal adenoma chemoprevention trial. N Engl J Med. 352(11): 1092-1102. https://doi.org/10.1056/NEJMoa050493

Broudy, D. (2021). Vaccine development and social control: A psychopathology of impaired reasoning in the global push for mass compliance. International Journal of Vaccine Theory, Practice, and Research, 2(1), 93–124. https://ijvtpr.com/index.php/IJVTPR/article/view/23

Broudy, D., & Arakaki, M. (2020). Who wants to be a slave? The technocratic convergence of humans and data. Frontiers in Communication, 5. https://doi.org/10.3389/fcomm.2020.00037

Broudy, D., & Hoop, D. (2021). Messianic mad men, medicine, and the media war on empirical reality: Discourse analysis of mainstream COVID-19 propaganda. International Journal of Vaccine Theory, Practice, and Research, 2(1), 1–24. https://ijvtpr.com/index.php/IJVTPR/article/view/22

Broudy, D., & Kyrie, V. (2021). Syllogistic reasoning demystifies evidence of COVID-19 vaccine constituents. International Journal of Vaccine Theory, Practice, and Research, 2(1), 149–172. https://ijvtpr.com/index.php/IJVTPR/article/view/23

Bruno, R., McCullough, P.A.I., Villa. T,F., Henrion-Caude A, García-Gasca, T., Zaitzeva, G.P., Priester, S., Albarracín, M.J.M., Sousa-Escandon, A., Mirones, F.L., Payeras-Cifre, B., Zaragoza-Velilla, A., Borini, L.M., Mas, M., Salazar, R., Schinder, E., Yahbes, E.A., Witt, M., Salmeron, M., Fernández, P., Marchesini, M.M., Kajihara, A.J., De La Riva, M.V., Chimeno, P.J., Grellet, P.A., Lisdero, M., Mas, P., Baudo, A.J.G., Retamoza, E., Botta, O., Brandolino, C.C., Sciuto, J., Avivar, M.C., Castillo, M., Villarroel, P., Poblete-Rojas, E.P., Aguayo, B., Macías-Flores, D.I., Rossell, J.V., Sarmiento, J.C., Andrade-Sotomayor, V., Stokes-Baltazar, W.R., Cedeño-Escobar, V., Arrúa, U., Farina del Río, A., Campos-Esquivel, T., Callisperis, P., Barrientos, M.E., Fiala, C., & Acevedo-Whitehouse, K. (2021). SARS-CoV-2 mass vaccination: Urgent questions on vaccine safety that demand answers from international health agencies, regulatory authorities, governments and vaccine developers. Authorea, preprint. https://doi.org/10.22541/au.162136772.22862058/v1

Buchbinder, S.P., McElrath, M.J., Dieffenbach, C., & Corey, L. (2020). Use of adenovirus type-5 vectored vaccines: a cautionary tale. Lancet, 396(10260):e68-e69. https://doi.org/10.1016/S0140-6736(20)32156-5

Buda, S., Preuss, U., Wedde, M., & Duerrwald, R. (2019). Effectiveness of vaccination against seasonal influenza — vaccine effectiveness (Wirksamkeit der Impfung gegen saisonale Influenza – Impfeffektivität), In: Report on the Epidemiology of Influenza in Germany, Season 2018/19 (Bericht zur Epidemiologie der Influenza in Deutschland, Saison 2018/19), Robert Koch-Institut, Berlin (FRG). https://doi.org/10.25646/6232; https://influenza.rki.de/Saisonberichte/2018.pdf (accessed: July 2020)

Burrell, S.A.M., & Exley, C. (2010). There is (still) too much aluminium in infant formulas. BMC Pediatrics, 10, 63. https://doi.org/10.1186/1471-2431-10-63

Burrell, C.J., Howard, C.R., & Murphy, F.A. (2016) Fenner and White’s Medical Virology, 5th ed. Academic Press Elsevier Publisher, San Diego (CA). ISBN 978-0-12-375156-0

Butnaru, D., & Shoenfeld, Y. (2015). Adjuvants and lymphoma risk as part of the ASIA spectrum. Immunologic Research, 61(1–2), 79–89. https://doi.org/10.1007/s12026-014-8622-0

Cabanillas, B., Akdis, C., & Novak, N. (2020). Allergic reactions to the first COVID‐19 vaccine: a potential role of Polyethylene glycol? Allergy 14711. https://doi.org/10.1111/all.14711

Cao, W., He, L., Cao, W., Huang, X., Jia, K., & Dai, J. (2020). Recent progress of graphene oxide as a potential vaccine carrier and adjuvant. Acta Biomater, 112:14-28. https://doi.org/10.1016/j.actbio.2020.06.009

Cappello, F., Gammazza, A.M., Dieli, F., de Macario E.C., Macario, A.J. (2020). Does SARS-CoV-2 Trigger Stress-Induced Autoimmunity by Molecular Mimicry? A Hypothesis. J Clin Med, 9(7): 2038. https://doi.org/10.3390/jcm9072038

CDC, (2020). Weekly Updates by Select Demographic and Geographic Characteristics – Provisional Death Counts for Coronavirus Disease 2019 (COVID-19). Center for Disease Control. Centers for Disease and Control Prevention. https://www.cdc.gov/nchs/nvss/vsrr/COVID_weekly/index.htm (accessed: June 2020).

CDC, (2021a). Emerging SARS-CoV-2 Variants” Centers for Disease Control and Prevention. https://www.cdc.gov/coronavirus/2019-ncov/more/science-and-research/scientific-brief-emerging-variants.html (accessed: Jan. 2020)

CDC, (2021b). Development of Antibodies and Immunity. https://www.cdc.gov/coronavirus/2019-ncov/lab/resources/antibody-tests-guidelines.html (accessed: Sept. 2021)

CDC, (2021c). Interim Guidelines for COVID-19 Antibody Testing. https://www.cdc.gov/coronavirus/2019-ncov/lab/resources/antibody-tests-guidelines.html (accessed: Sept. 2021)

Chang, M.C., Hur, J., & Park, D. (2020). Interpreting the COVID-19 Test Results: A Guide for Physiatrists. Am J Phys Med Rehabil, 99(7): 583-585. https://doi.org/10.1097/PHM.0000000000001471

Chau, N.V.V., Ngoc, N.M., Nguyet, L.A., Quang, V.M., Ny, N.T.H., Khoa, D.B., Phong, N.T., Toan, L.M., Hong, N.T.T., Tuyen, N.T.K., Phat, V.V., Nhu, L.N.T., Truc, N.H.T., That, B.T.T., Thao, H.P., Thao, T.N.P., Vuong, V.T., Tam, T.T.T., Tai, N.T., Bao, H.T., Nhung, H.T.K., Minh, N.T.N., Tien, N.T.M., Huy, N.C., Choisy, M., Man, D.N.H., Ty, D.T.B., Anh, N.T., Uyen, L.T.T., Tu, T.N.H., Yen, L.M., Dung, N.T., Hung, L.M., Truong, N.T., Thanh, T.T., Thwaites, G., & Tan, L.V. (2021). An observational study of breakthrough SARS-CoV-2 Delta variant infections among vaccinated healthcare workers in Vietnam. E-Clinical Medicine, 41: 101143. https://doi.org/10.1016/j.eclinm.2021.101143

CHD (2021). Ending childhood health epidemics. Children’s Health Defense. https://childrenshealthdefense.org/ (accessed: Dec. 2021)

Chen YY, Syed AM, MacMillan P, Rocheleau JV, Chan WCW (2020) Flow rate affects nanoparticle uptake into endothelial cells. Adv Mater, 32(24): e1906274. https://doi.org/10.1002/adma.201906274

Chen, Y., Xu, Z., Wang, P., Li, X.M., Shuai, Z.W., Ye, D.Q., & Pan, H.F. (2021) New-onset autoimmune phenomena post-COVID-19 vaccination. Immunology, [ahead of print]. https://doi.org/10.1111/imm.13443

Chung, Y.H., Beiss, V., Fiering, S.N., & Steinmetz, N.F. (2020). COVID-19 vaccine frontrunners and their nanotechnology design. ACS Nano, 14(10), 12522–12537. https://doi.org/10.1021/acsnano.0c07197 Full text PDF 2021 available at https://pubs.acs.org/doi/pdf/10.1021/acsnano.0c07197

Cerpa-Cruz, S., Paredes-Casillas, P., Landeros-Navarro, E., Bernard-Medina, A.G., Martínez-Bonilla, G., & Gutiérrez-Ureña, S. (2013). Adverse events following immunization with vaccines containing adjuvants. Immunol Res,. 56(2-3): 299-303. https://doi.org/10.1007/s12026-013-8400-4

Worse Than the Disease? Reviewing Some Possible Unintended Consequences of the mRNA Vaccines Against COVID-19

Authors: Stephanie Seneff Computer Science and Artificial Intelligence Laboratory, MIT, Cambridge MA, 02139, USA, Greg Nigh Naturopathic Oncology, Immersion Health, Portland, OR 97214, USA International Journal of Vaccine Theory, Practice, and Research

Abstract

Operation Warp Speed brought to market in the United States two mRNA vaccines, produced by Pfizer and Moderna. Interim data suggested high efficacy for both of these vaccines, which helped legitimize Emergency Use Authorization (EUA) by the FDA. However, the exceptionally rapid movement of these vaccines through controlled trials and into mass deployment raises multiple safety concerns. In this review we first describe the technology underlying these vaccines in detail. We then review both components of and the intended biological response to these vaccines, including production of the spike protein itself, and their potential relationship to a wide range of both acute and long-term induced pathologies, such as blood disorders, neurodegenerative diseases and autoimmune diseases. Among these potential induced pathologies, we discuss the relevance of prion-protein-related amino acid sequences within the spike protein. We also present a brief review of studies supporting the potential for spike protein “shedding”, transmission of the protein from a vaccinated to an unvaccinated person, resulting in symptoms induced in the latter. We finish by addressing a common point of debate, namely, whether or not these vaccines could modify the DNA of those receiving the vaccination. While there are no studies demonstrating definitively that this is happening, we provide a plausible scenario, supported by previously established pathways for transformation and transport of genetic material, whereby injected mRNA could ultimately be incorporated into germ cell DNA for transgenerational transmission. We conclude with our recommendations regarding surveillance that will help to clarify the long-term effects of these experimental drugs and allow us to better assess the true risk/benefit ratio of these novel technologies.

Pfizer’s COVID-19 Vaccine Goes Into Liver Cells And Is Converted To DNA: Study

Authors Meiling Lee THURSDAY, MAR 03, 2022 – 07:40 PM

The messenger RNA (mRNA) from Pfizer’s COVID-19 vaccine is able to enter human liver cells and is converted into DNA, according to Swedish researchers at Lund University.

A nurse prepares the Pfizer COVID-19 vaccine in Southfield, Mich., on Nov. 5, 2021. (Jeff Kowalsky/AFP via Getty Images)

The researchers found that when the mRNA vaccine enters the human liver cells, it triggers the cell’s DNA, which is inside the nucleus, to increase the production of the LINE-1 gene expression to make mRNA.

The mRNA then leaves the nucleus and enters the cell’s cytoplasm, where it translates into LINE-1 protein. A segment of the protein called the open reading frame-1, or ORF-1, then goes back into the nucleus, where it attaches to the vaccine’s mRNA and reverse transcribes into spike DNA.

Reverse transcription is when DNA is made from RNA, whereas the normal transcription process involves a portion of the DNA serving as a template to make an mRNA molecule inside the nucleus.

In this study we present evidence that COVID-19 mRNA vaccine BNT162b2 is able to enter the human liver cell line Huh7 in vitro,” the researchers wrote in the study, published in Current Issues of Molecular Biology. “BNT162b2 mRNA is reverse transcribed intracellularly into DNA as fast as 6 [hours] after BNT162b2 exposure.”

BNT162b2 is another name for the Pfizer-BioNTech COVID-19 vaccine that is marketed under the brand name Comirnaty.

The whole process occurred rapidly within six hours. The vaccine’s mRNA converting into DNA and being found inside the cell’s nucleus is something that the Centers for Disease Control and Prevention (CDC) said would not happen.

The genetic material delivered by mRNA vaccines never enters the nucleus of your cells,” the CDC said on its web page titled “Myths and Facts about COVID-19 Vaccines.”

This is the first time that researchers have shown in vitro or inside a petri dish how an mRNA vaccine is converted into DNA on a human liver cell line, and is what health experts and fact-checkers said for over a year couldn’t occur.

The CDC says that the “COVID-19 vaccines do not change or interact with your DNA in any way,” claiming that all of the ingredients in both mRNA and viral vector COVID-19 vaccines (administered in the United States) are discarded from the body once antibodies are produced. These vaccines deliver genetic material that instructs cells to begin making spike proteins found on the surface of SARS-CoV-2 that causes COVID-19 to produce an immune response.

Pfizer didn’t comment on the findings of the Swedish study and said only that its mRNA vaccine does not alter the human genome.

Our COVID-19 vaccine does not alter the DNA sequence of a human cell,” a Pfizer spokesperson told The Epoch Times in an email. “It only presents the body with the instructions to build immunity.

More than 215 million or 64.9 percent of Americans are fully vaccinated as of Feb. 28, with 94 million having received a booster dose.

Autoimmune Disorders

The Swedish study also found spike proteins expressed on the surface of the liver cells that researchers say may be targeted by the immune system and possibly cause autoimmune hepatitis, as “there [have] been case reports on individuals who developed autoimmune hepatitis after BNT162b2 vaccination.”

The authors of the first reported case of a healthy 35-year-old female who developed autoimmune hepatitis a week after her first dose of the Pfizer COVID-19 vaccine said that there is a possibility that “spike-directed antibodies induced by vaccination may also trigger autoimmune conditions in predisposed individuals” as it has been shown that “severe cases of SARS-CoV-2 infection are characterized by an autoinflammatory dysregulation that contributes to tissue damage,” which the virus’s spike protein appears to be responsible for.

Spike proteins may circulate in the body after an infection or injection with a COVID-19 vaccine. It was assumed that the vaccine’s spike protein would remain mostly at the injection site and last up to several weeks like other proteins produced in the body. But studies are showing that is not the case.

The Japanese regulatory agency’s biodistribution study (pdf) of the Pfizer vaccine showed that some of the mRNAs moved from the injection site and through the bloodstream, and were found in various organs such as the liver, spleen, adrenal glands, and ovaries of rats 48 hours following injection.

In a different study, the spike proteins made in the body after receiving a Pfizer COVID-19 shot have been found on tiny membrane vesicles called exosomes—that mediate cell-to-cell communication by transferring genetic materials to other cells—for at least four months after the second vaccine dose.

The persistence of the spike protein in the body “raises the prospect of sustained inflammation within and damage to organs which express the spike protein,” according to experts at Doctors for COVID Ethics, an organization consisting of physicians and scientists “seeking to uphold medical ethics, patient safety, and human rights in response to COVID-19.”

“As long as the spike protein can be detected on cell-derived membrane vesicles, the immune system will be attacking the cells that release these vesicles,” they said.

Dr. Peter McCullough, an internist, cardiologist, and epidemiologist, wrote on Twitter that the Swedish study’s findings have “enormous implications of permanent chromosomal change and long-term constitutive spike synthesis driving the pathogenesis of a whole new genre of chronic disease.”

Whether the findings of the study will occur in living organisms or if the DNA converted from the vaccine’s mRNA will integrate with the cell’s genome is unknown. The authors said more investigations are needed, including in whole living organisms such as animals, to better understand the potential effects of the mRNA vaccine.

At this stage, we do not know if DNA reverse transcribed from BNT162b2 is integrated into the cell genome. Further studies are needed to demonstrate the effect of BNT162b2 on genomic integrity, including whole genome sequencing of cells exposed to BNT162b2, as well as tissues from human subjects who received BNT162b2 vaccination,” the authors said.

Antibody dependent enhancement: Unavoidable problems in vaccine development

Authors: Lele XuZhiqian MaYang LiZhaoxia Pang, and Shuqi Xiao*

Adv Immunol. 2021; 151: 99–133.Published online 2021 Sep 4. doi: 10.1016/bs.ai.2021.08.003 PMCID: PMC8438590PMID: 34656289

Abstract

In some cases, antibodies can enhance virus entry and replication in cells. This phenomenon is called antibody-dependent infection enhancement (ADE). ADE not only promotes the virus to be recognized by the target cell and enters the target cell, but also affects the signal transmission in the target cell. Early formalin-inactivated virus vaccines such as aluminum adjuvants (RSV and measles) have been shown to induce ADE. Although there is no direct evidence that there is ADE in COVID-19, this potential risk is a huge challenge for prevention and vaccine development. This article focuses on the virus-induced ADE phenomenon and its molecular mechanism. It also summarizes various attempts in vaccine research and development to eliminate the ADE phenomenon, and proposes to avoid ADE in vaccine development from the perspective of antigens and adjuvants.

Keywords: Coronavirus, Antibody-dependent infection enhancement, Vaccine.

1. Introduction

In 1967 Hawkes first confirmed that IgG in serum can induce ADE (Lafferty, 1967). Many viruses have been proven to have ADE effects, such as Arthropod borne viruses (ABV), Dengue virus (DENV), Respiratory syncytial virus (RSV), Human Immunodeficiency virus (HIV), Feline infectious perionitis virus (FIPV), Coronaviruses (CoV). For many viruses (including DENV, HIV) that pose a major threat to human health, the presence of ADE is considered to be a major obstacle to vaccine development.

Fc receptor (FcR)-mediated ADE is the most common form of ADE, which was first discovered by Halstead (1977). At first, it was thought that the antigen antibody immune complex formed by virus and specific antibody combined with the host cell with the help of FcR on the cell surface, which was more conducive to the entry of virus, and increased the infection amount and infection rate of virus, finally led to the increase of infection and replication of virus. By phagocytosing immune complexes, the cells expressing FcR on the surface, such as monocytes, macrophages, dendritic cells, and certain granulocytes, can produce ADE. This kind of ADE is mainly mediated by IgG antibody, but IgM, IgE and IgA antibody have also shown the ability of ADE (Janoff, Wahl, Kelly, & Smith, 1995Shi et al., 2018Takada, Ebihara, Feldmann, Geisbert, & Kawaoka, 2007).

Complement mediated ADE(C-ADE) refers to the combination of virus and antibody to form an immune complex, which activates the complement and combines with the complement to form a complex, and then enters the cell through the complement receptor on the cell surface. After the complement inactivation, the ability of the serum to mediate the enhancement of viral infection decreased. However, the enhanced effect of virus infection returned to normal after the addition of excessive complement which indicated that C-ADE needed the participation of complement and antibody. The antibody of CR3 can block ADE infection of West Nile virus on cells expressing FcR, while the antibody of FcR receptor cannot block ADE infection, indicating that ADE infection can also be mediated by complement alone (Gordon, 1983).

With the research on ADE, the concept of intrinsic antibody-dependent enhancement(iADE) was proposed (Chareonsirisuthigul, Kalayanarooj, & Ubol, 2007Halstead, Mahalingam, Marovich, Ubol, & Mosser, 2010). Combining Fc and FcR also changes intracellular signaling pathways, causing them to shift from antiviral mode to viral promotion mode. This process is called iADE. In other words, ADE changes the innate immune response in cells and inhibits the antiviral response in cells, thus enhancing the virus infection. iADE infection can change some molecular signal transduction pathways in the process of immune cell response, especially the changes in the expression of IFN-β and IL-10, the changes in the phosphorylation levels of key molecules in signal transduction (NF-κB, STAT and IRF, etc.) (Patro et al., 2019Taylor et al., 2015Tsai et al., 2014Ubol, Phuklia, & Kalayanarooj, 2010). iADE could be the key to tackling the dangers of ADE in the future.

The mechanism or interaction of ADE is not fully understood. It is necessary to understand the upstream and downstream molecular signal events of ADE. In the development of vaccines for a variety of viral diseases, ADE needs to be overcome.

2. ADE of representative virus

2.1. Coronavirus

The mechanism of MERS ADE was mediated by neutralizing MAb targeting the coronavirus S protein RBD (Wan et al., 2020). ADE of MERS-CoV followed the same entry pathway as that of DPP4-dependent MERS-CoV. RBD specific neutralizing monoclonal antibody mediates coronavirus entry into ADE by functionally mimicking viral receptors. If other parts of the targeted neutralizing antibody do not trigger the conformational change of the spike, they are unlikely to mediate ADE. Similar findings have been found in SARS-CoV. The monoclonal antibody specific to SARS-CoV RBD (S230) binds to ACE2 in SARS-CoV RBD, triggering the conformational change of SARS-CoV. S230 can block the connection with DPP4 or ACE2 through the competitive mechanism, respectively. The antibody attributes membrane fusion by mimicking the action of the receptor (Walls et al., 2019). Therefore, SARS-CoV is likely to have ADE mechanism similar to MERS-CoV.

In the acidic pH environment of the endosome leads to the aggravation of antibody mediated infection, which is the opposite of SARS-CoV infection mediated by ACE2 receptor. Virus particles that infect cells via ADE pathway may still be trapped in acid compartment, and inhibition of internal acidification will prevent its degradation. It was also found that the sera induced by ADE did not contain anti-Spike IgG2a antibody, while the two neutralized/non-enhanced sera did (Jaume et al., 2011). IgG2a is a marker of Th1 type response, and Th2 type is more prone to induce ADE. Whether this phenomenon is related to the preference for Th1 type response and whether the deficiency of IgG2a has a causal relationship with the occurrence of ADE infection needs further research.

Daniel found two VHH (variable domain of the heavy-chain of heavy chain antibody) targeting SARS-CoV and MERS-CoV RBD, which neutralizes SARS-CoV and MERS-CoV and interferes with receptor binding (Wrapp et al., 2020). The possible mechanisms of neutralization are the blocking of the receptor binding interface and the capture of the up-conformation of RBDs, acting as receptor simulators that trigger the premature transition from the prefusion-to-post fusion conformation. The author did not discuss the possibility of this antibody ADE, but according to Wan’s results mentioned above (Wan et al., 2020), it is likely to have the phenomenon of ADE. It should be noted that the VHH directed by SARS-CoV RBD reacts with SARS-CoV-2 RBD, and can block receptor binding. SARS-CoV-2 and SARS-CoV have 79.6% sequence identity (Zhou et al., 2020). They use the same receptor ACE2 and cause similar acute respiratory syndrome. There is a cross reaction between SARS-CoV-2 and SARS-CoV S protein antibody, but cross neutralization reaction is rare (Lv et al., 2020).The key epitope of ADE induced by SARS-CoV S protein has been identified (LYQDANC), which is highly similar in SARS-CoV-2 region (Wang & Zand, 2020Wang et al., 2016). 48 kinds of SARS-CoV-2 antibodies were isolated by Zhou, 11 (23%) of which significantly increased the level of SARS-CoV-2 ADE in vitro, and 9 of them were RBD binding antibodies. It was further confirmed that the epitope of RBD was related to SARS-CoV-2 ADE in vitro (Zhou et al., 2021). Recent studies have found that antibodies that can promote SARS-CoV-2 infection can bind to specific sites of N-terminal domain(NTD), which leads to the conformational change of RBD and makes it easier to bind to ACE2 (Liu et al., 2021).

Observations in patients with SARS-CoV-2 were similar to those with SARS during the 2003 epidemic (Cheung et al., 2005Tetro, 2020). It is speculated whether individuals with severe disease may have been exposed to one or more coronavirons and are experiencing an ADE due to antigen epitope heterogeneity (Tetro, 2020). ADE has been found in SARS-CoV, and is believed to be one of the reasons for such a high mortality rate (Ho et al., 2005). High concentration of anti SARS-CoV antiserum neutralized the infection of SARS-CoV, while highly diluted antiserum significantly increased the infection of SARS-CoV and induced a higher level of apoptosis (Wang et al., 2014). Rhesus monkeys immunized with S-glycoprotein of full-length SARS-CoV can cause serious acute lung injury (ALI) when they attack the virus (Chen et al., 2005Liu et al., 2019). All these suggest that the development of SARS-COV vaccine requires special attention to ADE. The SARS-CoV S protein trimer-immunized hamster serum mediated the ADE of SARS-CoV, but the viral load and lung lesions did not increase in the vaccinated animals. These data indicate that the enhancement of virus entry into cells in vitro cannot fully predict the adverse effects in vivo (Arvin, Fink, Schmid, Cathcart, & Virgin, 2020Jaume et al., 2011). Therefore, more in-depth research is needed to correlate in vitro laboratory test results with clinical results, so as to provide a reference for the SARS-CoV-2 ADE study.

At present, the clinical experience is not enough to prove the existence or non-existent of ADE in SARS-CoV-2 (Arvin et al., 2020). Without the support of data to believe that ADE will definitely hinder the development of SARS-CoV-2 vaccine. However, the experience of dengue fever vaccine and RSV vaccine reminds us that if there is a risk of ADE in the COVID-19 vaccine, special attention should be paid to the safety of any candidate SARS-CoV-2 vaccine (Coish & MacNeil, 2020Sharma, 2020). The good news is that immunity to SARS-CoV-2 RBD or inactivated SARS-CoV-2 vaccine can cause a strong neutralizing antibody response in rodents, and antiserum does not mediate ADE (Gao et al., 2020Quinlan et al., 2020). Even though some antibodies can enhance virus infection in cell experiments, they have not been shown to enhance virus infection in vitro experiments by mice and monkeys (Li, Edwards, Manne, Martinez, & Saunders, 2021).

2.2. Flaviviruses

Perhaps the most famous example of ADE infection is the virus-specific antibody enhanced DENV (Izmirly, Alturki, Alturki, Connors, & Haddad, 2020). The main representative viruses include Moray Valley encephalitis virus (MVEV), West Nile virus (WNV), Japanese encephalitis virus (JEV) and DENV(Schweitzer, Chapman, & Iwen, 2009Weaver & Barrett, 2004).

Dengvaxia (CYD-TDV) is first licensed vaccine. This vaccine is only approved in dengue-endemic countries and only dengue seropositive people. CYD-TDV has shown a powerful effect in preventing serious diseases. But it increases the risk of severe dengue fever in seronegative patients. The potential risk of ADE is undoubtedly the difficulty of dengue fever vaccine development (Izmirly et al., 2020Sridhar et al., 2018). DENV has four different serotypes (DENV1-4), ADE is easily caused between different serotypes (Heinz & Stiasny, 2012). Global epidemiological studies show that the vast majority of DHF/ DSS cases occur after the secondary infection of DENV. In addition, it has been proposed that ADE is also triggered by sub-neutralization concentrations DENV antibodies. From the perspective of mechanism, antibody mediated DENV entry into cells expressing FcR, such as monocytes, leads to increased viral replication, which triggers the release of inflammatory and vasoactive mediators, thus aggravating the severity of the disease. The critical time for DHF/DSS is approximately 2 months after degrade below a protective level of maternal dengue 2 neutralizing antibodies, maternally derived DENV-reactive IgG is a determinant of the viral burden in vivo (Chau et al., 2008Chau et al., 2009Kliks, Nimmanitya, Nisalak, & Burke, 1988). ADE can also be reproduced in vitro by primary human monocytes, macrophages, and mature DC, as well as cell lines expressing human and mouse Fc tissues (e.g., U937, K562, THP-1, and P388D1) in the presence of subneutralizing concentrations of antibodies. In addition, the expression of FcγRs can also promote ADE in non Fc cell lines (Goncalvez, Engle, Claire, Purcell, & Lai, 2007Chareonsirisuthigul et al., 2007Halstead, Chow, & Marchette, 1973Littaua, Kurane, & Ennis, 1990Morens, Larsen, & Halstead, 1987).

DENV could be divided into the compact and expanded mature DENV, the fully immature DENV, and the partially mature DENV. Some of these DENV particles are completely infectious, while others need to be infectious by binding with other molecules (Lok, 2016). The prM is a precursor protein of a membrane protein (M), which is present on the surface of immature DENV. The prM forms a heterodimer with the E protein, blocks the fusion peptide of the E protein, and prevents membrane fusion of the virus and the host cell membrane. In the process of virus maturation, prM is cleaved into M protein by furin protease under the induction of low pH, which rearranges E protein, and makes immature virus particles that are not infectious become mature virus and become infectious. Antibodies to prM mediate the binding of immature virus to target cells, thereby enhancing the infectivity of the virus. Using JEV Pr instead of DENV Pr will not change the neutralization ability of anti PrM antibody, and will not enhance the infection of K562 cells with Fc receptor, so as to avoid the ADE of anti prM antibody (Wang et al., 2017). Recent studies have found that the DENV gene for ADE is located at the fifth, sixth, seventh, and sixteenth amino acids of pr4, which can reduce the occurrence of ADE by replacing key amino acids (Cui et al., 2021).

Renner confirmed two neutralizing antibodies of DENV2, 2C8 can induce ADE, while 3H5 does not. Fc region of 3H5 (IgG1 subtype) was switched to Fc region of 2C8 (IgG2a subtype), it did not change this feature, which indicated that the difference was not caused by different IgG subtypes. 2C8: DENV can strongly bind to FcγR, but 3H5: DENV cannot bind to FcγR receptor. The binding of 3H5 antibody may lead to the deformation of virus surface, and the organization of the whole immunoglobulins will be too crowded to allow FcγR to bind. On the contrary, The upright conformation of 2c8 will completely expose the Fc region of the whole immunoglobulin, so that it can combine with FcγR to induce ADE (Morrone & Lok, 2019). 3H5 showed a strong binding force at neutral pH and low pH, while 2C8 showed a significant reduction in binding force at low pH. Due to the low pH value of the late endosomes, 2C8 may dissociate from the surface of the virus, leading to infection, which partly explains the mechanism of ADE in mature dengue granules (Lok, 2016Morrone & Lok, 2019).

It should also be noted that DENV and ZIKV belong to the Flaviviridae genus in the virus classification, and there is a large amount of antigen overlap between them. DENV and ZIKV infection can induce cross-reactive antibody responses (Rathore & St John, 2020). The antibodies of one virus may promote the development of the other virus. Two immunodominant epitopes, the precursor membrane protein (prME) and the envelope (E) protein, can be recognized by cross-reactive antibodies. These antibodies not only neutralize the ills, but also promote viral replication and disease severity through Fc receptor-mediated myeloid cell infection. Serum from patients infected with DENV, as well as DENV-specific human monoclonal antibodies, bind to ZIKV and promote its infection of cells carrying Fc receptors. The broadly neutralizing anti-DENV E protein linear fusion ring epitope (FLE) are not neutralize to ZIKV, but can increase ZIKV infection (Dejnirattisai et al., 2016Paul et al., 2016). Cross-reactive flavivirus antibodies may also cause other harmful effects of ZIKV infection by promoting placental transmission via FcRn-mediated endocytosis (Hermanns et al., 2018Langerak et al., 2019). In the case of ADE, the co-infection of DENV and ZIKV will cause more damage to the host. The initial virus (ZIKV) will produce a higher viral load and a second peak, while the second virus (DENV) will produce a larger peak viral load and an earlier peak. ADE may have a greater impact on the second virus during co-infection (Tang et al., 2020). Antibodies produced against ZIKV or DENV could enhanced the entry of ROCV, SLEV, WNV and ILHV into K562 cells, which may lead to a risk of serious infection (Oliveira et al., 2019). The serum of WNV antibody-positive persons can significantly enhance ZIKV infection in vitro. Considering the prevalence of WNV infection in the United States, this may have a great potential risk. Further research found that the flavivirus E antibody is related to this cross ADE (Garg et al., 2021).

2.3. Porcine reproductive and respiratory syndrome virus (PRRSV)

PRRSV is an arteritis virus with a capsule (Karl-Klaus, Nico, et al., 1993). It is one of the most serious diseases faced by the global pig industry and causes huge losses to the pig industry every year (Li et al., 2021Wang, Yu, Cai, Zhou, & Zimmerman, 2020).

ADE is present in PRRSV infection both in vivo and in vitro. In vitro, PRRSV infection was added with a certain concentration of PRRSV antibodies for 1 hour, and then the mixture was used to infect porcine alveolar macrophages, which was significantly higher than the control group by tens of times (Cancel-Tirado, Evans, & Yoon, 2004). In vivo studies have found that the mean level and duration of vireaemia in pigs treated with PRRSV-specific IgG subneutralization were greater than in control pigs injected with normal serum globulin (Yoon, Wu, Zimmerman, Hill, & Platt, 1996). This suggests that when maternal PRRSV-specific antibody, exposure to wild-type or vaccine PRRSV-induced antibody level decreases, ADE of PRRSV may occur, resulting in increased disease severity and possibly increased susceptibility of pigs to PRRSV infection. FcγR is the main way to mediate PRRSV ADE. FcγRI, FcγRIIb and FcγRIII are all related to ADE (Gu et al., 2015Qiao et al., 2011Shi et al., 2019). After infection with the PRRSV-antibody complex, the transcription level of FcγRI slightly increased, while the transcription level of FcγRIIb (inhibitor receptor) increased significantly. In addition to the receptor of IgG, the receptor FCɛRI of IgE also affects PRRSV infection. FcɛRI may be related to the antigen presenting process and regulation of the inflammatory response, PRRSV reproduction and the regulation of antiviral response during PRRSV infection (Shi et al., 2018).

Cancel-Tirado used a variety of monoclonal antibodies against M/N/GP3/CP5, and found that some monoclonal antibodies not only failed to inhibit virus infection, but also promoted virus replication (Cancel-Tirado et al., 2004). GP5 exists the main neutralizing epitope of the virus. There are two B-cell antigenic sites A and B on the GP5 protein. A epitope is the decoy epitope, and the antibody induced by A epitope has no neutralizing activity. Non-neutralizing antigen site A can be recognized by non-neutralizing antibody, and cannot be recognized by monoclonal antibody ISU25-c1 and pig neutralizing serum antibody. The A epitope is highly variable in the strains and has an immune advantage. Antibodies at this epitope appear early in PRRSV infection. Therefore, the epitope of GP5 antibody that can induce ADE is presumed to be epitope A. The antibody against N protein is the earliest and most common antibody after infection, but the N protein is not exposed on the virus surface. The antibody against N protein ISU15A can promote PRRSV infection. This process should not be an antibody against N that promotes virus adsorption and entry into cells. It is speculated that it may affect the replication of PRRSV in cells. Carmen a. Sautter’s study showed that immunized with the inactivated PRRSV vaccine and then attacked the homologous virulent virus, the vaccine-mediated enhancement of clinical symptoms was observed, but the results showed that it was not neutralizing antibody or other antibody mediated enhanced infection, increased the release of virus or the production of cytokines (Sautter, Trus, Nauwynck, & Summerfield, 2019). However, the heat-inactivated serum used in the test may affect the participation of complement, and the test is the use of monocyte Derived Macrophages. The immune complex enhanced infection may target other cells, such as FcR on monocytes and dendritic cells.

3. The molecular mechanism that produces ADE

3.1. FcγR-mediated ADE

FcγR, also known as IgG Fc receptors for immunoglobulin G, is an important cell surface molecule that is widely expressed on the surface of most immune cells and can specifically bind to the Fc region of immunoglobulin. At present, the identified human FcγR can be divided into three subclasses: FcγRI (CD64), FcγRI (CD32), FcγRIII (CD16). In addition, specific FcRIV was found in mice (Nimmerjahn, Bruhns, Horiuchi, & Ravetch, 2005Taylor et al., 2015). As a bridge between humoral immunity and cellular immunity, FcγR mediates the interaction between immune complex and immune cells through specific binding with Fc region of immunoglobulin, so as to participate in the activation and regulation of various immune effects (de Taeye, Rispens, & Vidarsson, 2019). FcγR can also mediate the interaction between immune cells. The immune response mediated by FcγR includes the elimination of immune complex, the regulation of antibody production, the lysis of tumor cells, antigen processing and presentation, and the regulation of T cell proliferation and differentiation. FcγR plays a role in resisting the invasion of foreign microorganisms by triggering various immune functions of immune cells.

The connection between FcγR and viral immune complex can control ADE through internalization, and the result is the balance of activation and inhibition of FcγR. FcγRI, FcγRII and FcγRIII can all mediate the occurrence of ADE, but their action modes and intensity are different. In the cells expressing FcR, the production of cytokines mediated by FcγR depends on the proportion of activated and inhibited FcγR.

FcγRI is a high affinity receptor and the only FcR binding to IgG monomer. It consists of extracellular regions of three Ig like domains, a transmembrane domain and an intracellular domain (Hanson & Barb, 2015). It is mainly expressed on the surfaces of macrophages, monocytes, polymorphonuclear cells and dendritic cells. FcγRI is mainly involved in the process of antigen intake, processing and presentation in the early stage of immune response.

It has been proved that FcγRI can mediate the ADE of DENV, HIV, PRRSV and other viruses. The extracellular domain of FcγRI is sufficient to internalize the immune complex of infectious dengue virus through a mechanism that does not involve classical ITAM dependent signaling (Schlesinger & Chapman, 1999). Rodrigo found that enhanced immune complex infectivity mediated by FcγRIA was greatest when the receptor was associated with a γ-chain in its native form and that abrogation of γ-chain ITAM signaling capacity by Tyr-to-Phe mutation reduced but did not entirely eliminate this function (Rodrigo, Jin, Blackley, Rose, & Schlesinger, 2006). FcγRIA may have at least two internalization mechanisms of viral immune complexes. The first is γ-chain signal dependence. Aggregates of infectious viral immune complexes of sufficient size trigger the classical phagocytosis entry pathway. The second is a somewhat less efficient entry mechanism that did not require γ-chain activation and relied simply on concentrating partially neutralized virions onto the cell for entry by a parallel endocytosis mechanism (Rodrigo et al., 2006). The study found six different alternatively spliced of porcine FcγRI, and different FcγRI alternatively spliced have different effects on PRRSV ADE. The membrane pCD64-T1 enhances the replication of PRRSV in the form of promoting the endocrine of the PRRSV-antibody complex. Soluble pCD64-T3 exhibits inflammation-enhancing effects. It is speculated that pCD64-T3 can enhance the activation of TLR in ADE mode, and up-regulate the transcription of inflammatory factors such as TNF-α, IL-1β and IFN-β, and negatively regulate PRRSV ADE. Porcine FcγRI plays a dual regulatory role in PRRSV infection and PRRSV inflammation through alternatively spliced mechanism (Shi et al., 2019). Different spliceosomes lead to different viral infection results, which also increase the complexity of PRRSV ADE.

FcγRII is a low-affinity receptor and requires high-affinity binding through IgG immune complexes. Among them, FcγRIIA and FcγRIIC are activated receptors, while FcγRIIB is an inhibitory receptor (Guilliams, Bruhns, Saeys, Hammad, & Lambrecht, 2014). The activated receptor participates in intracellular signal transduction through immunoreceptor tyrosine-based activation motif (ITAM), for example, the combination of the antibody-virus complex of Ebola virus with the cell surface Fc eagerly RIIa will trigger the phosphorylation of Src family PTK and activate the subsequent signal transduction pathway, thereby leading to increased viral uptake through phagocytosis and/or macropinocytosis (Furuyama et al., 2016). The inhibited receptor contains the suppressed motif based on the immunoreceptor tyrosine-based inhibitory motif (ITIM) in its cytoplasmic domain. FcγRIIb mainly exerts its negative regulatory function through a series of cascade reactions generated after phosphorylation of its intracellular ITIM motif.

FcγRIIA is more effective than FcyRIA in enhancing the infectivity of dengue virus immune complexes. FcγRIIA is better equipped than FcγRIA to utilize alternative signaling pathways and entry mechanisms made available by relocation to such sites where weakly bound immune complexes might be more easily transferred to favorable entry pathways. After the immune complex is connected to FcyRIIa, the internalized FcyRIIa-immune complex enters the endosomal compartment, where the low affinity of FcyRIIa promotes the release of the immune complex. The attachment or dissociation of the FcγRIIa-immune complex enables innate immunity from antiviral to immunosuppression, induces the expression of IL-6, TNF and IL-10, and suppresses the expression of type I IFN (Rodrigo et al., 2006).

In vitro studies conducted in the monocyte cell lines U937 and K562 showed that FcγRII-mediated entry occurred through clathrin-coated vesicles, while FcγRI-mediated entry was not related to clathrin. In addition, since FcγRII translocates into lipid rafts after the immune complex is bound, entry through FcγRII is affected by membrane cholesterol levels (Carro, Piccini, & Damonte, 2018).

The activation of FcγR signaling can be blocked by the negative signaling of the inhibitory receptor FcγRIIb on the same cell surface. The destruction of tyrosine residues in ITIM or the removal of the poFcγRIIb cytoplasmic domain eliminates the ability of poFcγRII to mediate PRRSV-infected ADE (Wan, Chen, Li, Pang, & Bao, 2019). FcγRIIa promotes DENV-infected ADE, while FcγRIIb restricts it. By switching between these two isoforms containing the motifs of ITAM and ITIM, it was found that the intracellular part of FcγRII is the main determinant of ADE infection.

FcγRIII can not only significantly inhibit the levels of IFN-α and TNF-α mRNA, but also significantly increase the levels of IL-10 and viral mRNA during PRRSV viral infection. These clarify a mechanism of PRRSV-ADE regulated by poFcγRIII, which may be to increase virus internalization in its host cells and reduce antiviral cytokine levels to promote virus entry and replication (Gu et al., 2015Zhang et al., 2016). FcγRIIIA promotes aggravation of dengue fever. The IgG1 subclass antibodies produced by DHF/DSS patients have a high affinity for the non-fucosylated Fc receptor FcγRIIIA, and the combination of the two induces platelet reduction, which is an important risk factor for thrombocytopenia syndrome, leads to the ADE effect of the disease (Wang, Sewatanon, et al., 2017).

3.2. Complement-mediated ADE

Complement dependent ADE is quite different from FcγR-dependent ADE, Complement can synergize with FCγR or cause ADE alone. High levels of CR2 and CD4 are required to enhance HIV-1 infection in T lymphocyt-like cell lines in the presence of subneutralizing levels of HIV-specific antibodies (Robinson, Montefiori, & Mitchell, 1990). In the absence of antibodies, complement CR3 and CR1 can promote HIV infection. Using antibodies to block CR1 or CR3 functions can completely inhibit complement-mediated enhancement (Thieblemont, 2010). Another independent pathway of complement mediated ADE in HIV-1 infection has been shown to require the complement component C1q. The IgG antibody binds closely to the viral epitope, so that the C1q binds to the Fc part of the antibody, and the immune complex binds to the C1q receptor on the cell surface (Prohászka et al., 1997). Similarly, C1q mediated ADE can enhance the infection of Ebola virus in non-monocytes by promoting the binding or endocytosis of the virus to the target cells (Takada, Feldmann, Ksiazek, & Kawaoka, 2003). Unlike FcR mediated intracellular signaling to promote ADE, C1q mediated ADE is only caused by the increase of virus particles attached to the cell surface (Byrne & Talarico, 2021Furuyama, Nanbo, Maruyama, Marzi, & Takada, 2020). Acute and chronic inflammatory cardiomyopathies have been associated with a high prevalence of B19V DNA in endothelial cells of the myocardium. This may be related to the increased uptake of human parvovirus B19 on myocardial endothelial cells by complement factor C1q and its receptor CD93 mediated ADE. Despite its strong host tropism for erythroid progenitor cells, in the presence of specific antibodies to human parvovirus B19, complement dependent ADE increased the uptake of viral endothelial cells by 4000 times. ADE results in the accumulation of B19V DNA in the nucleus of infected cells, but it has no significant effect on gene expression and genome replication. The enhancement did not depend on the interaction between the virus antibody complex and FcR (von Kietzell et al., 2014).

3.3. Molecular signaling events in ADE

In addition to promoting the entry of viruses, ADE also affects the immune response of cells, inhibiting the antiviral activity of cells and thus promoting infection. The connection or dissociation of FcγR-immune complexes changed the innate response of antiviral and immunosuppression through unknown pathways, induced IL-6, TNF and IL-10, and inhibited the expression of type I IFN (Izmirly et al., 2020Patro et al., 2019).

When immune complex entering the target cell can activates the negative regulator, dihydroxyacetone kinase (DAK) and autophagy-related 5 autophagy-related 12 (Atg5-Atg12), and then disrupts the RIG-I/MDA-5 signal cascade, down-regulating the downstream molecular signal (Ubol & Halstead, 2010Ubol et al., 2010). Meanwhile, the connection between antibody complex and FcR downregulated TLRs gene expression, strongly stimulated the negative regulators of TIR-domain-containing adapter-inducing interferon-β (TRIF) and TNF receptor-associated factor 6 (TRAF-6), Sterile-alpha and Armadillo motif-containing protein (SARM), TRAF family member-associated NF-κB activator (TANK), negative regulators of the NF-κB pathway. Up-regulation of SARM and TANK results in down-regulation of TLR signaling molecules (Modhiran, Kalayanarooj, & Ubol, 2010Taylor et al., 2015). But TLRs express upstream events and how SARM and TANK are activated is not entirely clear. These events lead to inhibition of innate responses mediated through the TLR signaling pathway and increased viral production. Both MyD88-dependent and non-dependent signaling molecules are downregulated during DENV-ADE infection (Kulkarni, 2020Modhiran et al., 2010).

The connection between FcγRIIa and immune complex induced the activation of PI3K/PKB mediated by spleen tyrosine kinase (Syk). Activation of PI3K/PKB phosphorylates and inactivates glycogen synthase kinase (GSK)-3b, resulting in the observed high levels of IL-10. IL-10 can induce the cytokine response of Th2 and inhibit the production of proinflammatory cytokines, such as IFN-γ, IL-12, TNF-α and nitric oxide free radicals (Kuczera, Assolini, Tomiotto-Pellissier, Pavanelli, & Silveira, 2018). PRRSV ADE can up-regulate the production of IL10 through FcγRI and FcγRIII to promote the replication of PRRSV (Zhang et al., 2020).

IL-10 can effectively activate the SOCS system and inhibit Janus kinase/signal transduction and transcriptional activator (JAK/STAT) signal transduction pathways (Sukathida Ubol et al., 2010). The secreted IL10 cytokine binds to the IL10 receptor 1(IL10R1) on the membrane surface, and IL10R1 dimerizes with IL10R2 to play its downstream role. IL10R2 recruited the cytoplasmic protein Jak1, Phosphorylated STAT3 forms homodimers that are then transferred to the nucleus to promote transcriptional regulation of the target genes, thereby inhibiting iNOS gene expression and the production of nitric oxide free radicals (Kulkarni, 2020Taylor et al., 2015). (As shown in Fig. 1 )

Fig 1

Fig. 1

Host innate immune responses during ADE. (i) Dengue fever immune complex can enter target cells through FcR to activate negative regulators, dihydroxyacetone kinase (DAK) and autophagy-related 5 autophagy-related 12(Atg5-Atg12), thereby destroying the RIG-I / MDA-5 signaling pathway. Including beta interferon promoter stimulator 1 (IPS-1), inducible I-kappa B predominate kinase (IKKi), tumor necrosis factor receptor-associated factor 3(TRAF-3), and TANK-binding kinase 1 (TBK-I), etc Eventually inhibit type I IFN production. (ii) The expression of TLR-3, -4, -7 and TLR signal molecules was down regulated when the immune complex entered the target cells, resulting in inhibition of NF-κB activity and negative regulation of TLR signal transduction activity. (iii) The binding of leukocyte immunoglobulin like receptor B1 (LILRB1) with DENV virus inhibited the activation of Syk and eliminated the expression of ISG. Activated Syk upregulates IL10 via PI 3K/PKB, CREB signaling pathwayIL-10 stimulates the expression of SOCS3 and inactivates Janus kinase JAK-STAT signal, thus inhibiting the production of proinflammatory cytokines.IL-10 also inhibits the expression of nitric oxide synthase (iNOS) by inhibiting the activities of STAT-1 and IRF-1, thus inhibiting the production of nitric oxide (NO).

NO inhibits late viral protein synthesis and DNA synthesis, for example viral cysteine proteases are inactivated by NO-dependent s-nitrosoylation, NO inhibits PRRSV infection by cGMP-PKG dependent signaling (Saura et al., 1999Zhang, Duan, Li, Zhao, & Xiao, 2016). The PBMC of DHF patients showed higher NS1 and lower NO serum level in acute fever period (Carvalho et al., 2014). The effect of NO is contradictory. NO is related to the severity of viral haemorrhagic fever. The increase of NO level in blood vessels will lead to the increase of vascular permeability and the damage of homeostasis in vivo. The higher concentration will affect the vascular tension and lead to the shock caused by virus (Thein et al., 2015). NO may play both protective and pathological roles, which depend on the concentration of NO.

The attachment of FcγRIIa to the DENV immune complex and the binding of LILRB1 to the DENV virions can synergistically induce ADE in THP-1 cells. (Cosman et al., 1997Kulkarni, 2020). After Binding to LILRB1 the immunoreceptor tyrosine-based inhibition motif-bearing receptor recruits Src homology phosphatase-1(SHP-1) to dephosphorylate Syk, which leads to the decrease of ISG expression and the enhancement of DENV replication (Chan et al., 2014Kulkarni, 2020).

In theory, DENV immune complex can use the inhibitory ITIM signal of FcγRIIb to destroy the expression of ISG. PoFcγRIIb mediated ADE pathway of PRRSV infection through recruitment of ship-1. The TBK-1-IRF-3-IFN-β signal transduction pathway was further inhibited to enhance PRRSV infection (Wan et al., 2019). In addition, the ability of poFcγRII to mediate PRRSV ADE can be eliminated by interrupting the tyrosine residues in ITIM or removing the cytoplasmic domain of Fc. The connection between immune complex and FcγRIIb can also weaken the activation of NF-κB triggered by TLR4. But ligation of FcγRIIb inhibits antibody-dependent enhancement of dengue virus infection. Antibodies help to form large viral aggregates, which in turn bind to FcγRIIb to inhibit the phagocytosis of monocytes (Chan et al., 2011). Whether there is ADE phenomenon may be related to the cell type and the concentration of antibodies. In cells with FcR, the production of cytokines mediated by FcγR depends on the proportion of activated and inhibited FcγR. Therefore, the simultaneous stimulation of activated and inhibited FcγR may not induce significant cytokine production.

Antibody-dependent DENV entry upregulates a host of host-dependent genes that support DENV infection. Chan found that some host-dependent factors were induced in primary monocytes under ADE conditions. ADE increases the spliceosome gene, so ADE may modify the splicing map of infected cells to produce an intracellular environment that is more conducive to virus replication and packaging. The higher expression of ribosome genes in ADE may explain the increased virus translation compared with DENV infection alone (Chan et al., 2019). In addition, it also includes DENV RNA binding protein, which requires for effective DENV amplification (Chan et al., 2019Viktorovskaya, Greco, Cristea, & Thompson, 2016); ER-Golgi transport protein, which is necessary for viral transport; mitochondrial complex, which is required for ATP synthesis (Chan et al., 2019Savidis et al., 2016).

3.4. Cellular compartmentalization

Cellular compartmentalization is used as a defense against human pathogens in both specialized and nonspecialized phagocytes. The septal boundary limits the entry of pathogens into the cytoplasm, and the expression of pattern recognition receptors is helpful for the detection and elimination of pathogens (Randow, Macmicking, & James, 2013).

In order to cope with the virus-resistant response triggered by the early activation of Fc, during ADE, the antibody-opsonized DENV was co-connected with the LILRB1 with ITIM to change the cellular compartment. Reduced Syk signal transduction not only leads to ISG-induced inhibition, but also downregulates the acidification of phagocytosis, enabling DENV to escape lysosomal degradation. SHP-1 is thought to inhibit phagocytic acidification by acting on membrane fusion during phagocytic transport. LILRB1 signal directly introduced the phagosome containing DENV into the area with lower acidification degree, thus preventing the rapid lysosomal degradation of DENV.

Similarly, inhibition of phagocytic acidification by lysosomal drugs has led to an increase in antibody-dependent infections, suggesting caution in the use of such drugs in the treatment of dengue (Jaume et al., 2011). Although the decrease or slowing down of phagocytic acidification during ADE may delay virus fusion and membrane removal, this may be a necessary trade-off, ultimately allowing DENV to escape lysosomal degradation, which is conducive to intracellular survival. During the ADE process of ACE2 mediated SARS-CoV, most of the virus particles that enter the cells through the ADE pathway are still trapped in the acid compartment and finally degraded. The inhibition of internal acidification can prevent them from degradation (Jaume et al., 2011Ong et al., 2017).

The differential intracellular rate of fusion or compartmentalization could lead to exposure of the virus to a different repertoire of vesicular receptors, including pathogen recognition receptors, resulting in differential cellular responses (Chan et al., 2019). The differentiation compartmentalization of DENV may affect receptor interaction, viral replication and host response, which bring new research direction for the pathogenesis of virus.

4. Development of vaccine to eliminate ADE

Vaccine induced ADE has been found for a long time. Antibodies with poor affinity induced by formalin inactivated virus vaccines (e.g., RSV and measles) with Al adjuvant induced ADE during the initial infection of infants (Anderson et al., 2013). The development of vaccine to eliminate ADE mainly from two aspects: one is to mask or remove the antigen part that produces ADE, so that the antibody produced does not produce ADE effect; the other is to block the combination of antigen antibody complex and receptor, so as to inhibit Fc receptor or other receptor-mediated ADE.

4.1. Mask or remove the antigen part that produces ADE

Screaton developed a stable ZIKV E protein dimer vaccine that has no precursor membrane proteins and does not expose the immunodominant fusion loop epitope. Immunization of mice with ZIKV E dimers induces dimer-specific antibodies, which protect against ZIKV challenge during pregnancy. Importantly, the ZIKV E-dimer-induced response does not cross-react with DENV or induce ADE of DENV infection (Slon-Campos et al., 2019).

The cross reactive antibody of DENV and Zika virus is mainly induced by the DI/ DII region of E protein, especially the highly conserved fusionloop(fl)of DII region, which promotes DENV or ZIKV to enhance infection (Dejnirattisai et al., 2016Priyamvada et al., 2016Screaton, Mongkolsapaya, Yacoub, & Roberts, 2015). Lin showed that the enhanced infection of ij loop mutant of ZIKV E antigen in all four serotypes of DENV was greatly reduced, which indicated that ij loop mutant was a good target of glycan screening strategy, which could shield cross reactive antibody to induce ADE effect against DENV, and also retained the virus neutralization ability. Using ij cyclo-glycan to mask adenovirus vector, and then using DIII of E gene and FLIC of bacteria to express flic-diii fusion protein to enhance immunity, the results showed that the enhanced immunity by tetravalent DENV FLIC-DIII could improve the titer of neutralizing antibody and reduce ADE (Lin et al., 2019).

ZIKV-80E(N-terminal 80% of ZIKV E protein) expressed in yeast can self-assemble into nanoparticles. Nanoparticles without prM retain the antigenic integrity of neutralizing epitopes on E domain III (EDIII). Immunization of BALB/c mice can produce The ZIKV neutralizing antibody of this domain. The most exciting thing is that the antibodies induced by ZIKV-80E NPs did not induce the ADE potential of DENV and ZIKV in vivo (Shukla et al., 2020).

The use of reverse genetics to construct chimeric JEVpr/DENV2 with the Japanese encephalitis virus pr instead of the pr gene showed reduced virulence and good immunogenicity. In addition, anti-JEVpr/DENV2 sera showed extensive cross-reactivity and effective neutralizing activity against all four DENV serotypes and immature DENV2 (ImDENV2), and the ADEV activity of DENV decreased (Wang et al., 2015). Wang replaced DENV pr with JEV pr to construct a novel chimeric protein of JEV pr and DENV2 M peptide (JEVpr/DENV-M). Rabbit anti JEVpr/DENV-m had weak neutralization to both serotype DENV and immature DENV (ImDENV2), which did not change the neutralization ability of anti prM antibody, and did not cause the enhancement of infection of K562 cells with Fc receptor (Wang, Si, et al., 2017).

4.2. Block or interfere with the binding of the antigen-antibody complex to the receptor

Because of its own advantages that monoclonal antibody has become an important direction in the development of new vaccines. In particular, nano antibody does not contain Fc segment of common antibody, thus avoiding complement reaction caused by Fc domains and reducing ADE production. Palivizumab, an antiviral monoclonal antibody against respiratory syncytial virus (RSV) F protein, has significantly reduced RSV hospitalizations in premature infants and infants with chronic lung disease or congenital heart disease. Palizumab is clinically safe that fully demonstrates the development prospect of monoclonal antibody vaccine.

Wan analyzed the difference of ADE of coronavirus in different antibody doses, MERS MAb1 can inhibit virus entry at low concentration (by blocking DPP4 dependent entry pathway), promote virus entry at medium concentration (by enhancing CD32a dependent entry pathway), and inhibit virus entry at high concentration (by blocking DPP4 and CD32a dependent entry pathway), which can also explain why virus ADE only exists at some concentrations, and neither too high nor too low can induce virus entry ADE (Wan et al., 2020).

Widjaja identified eight monoclonal antibodies that bind to non-overlapping epitopes on MERS-S with high affinity and interfere with the three known functions of viral proteins: sialic acid binding, receptor binding, and membrane fusion (Widjaja et al., 2019). At low doses, these antibodies protected mice from the deadly MERS-CoV infection. It is worth noting that there are two mAbs (G2 and G4) do not interfere with receptor binding, but abolish intercellular fusion, which means that they can interfere with spike mediated membrane fusion by blocking the conformational changes required for fusion. The high protective mAb showed only moderate neutralization activity in vitro, indicating that strong neutralization activity was not a prerequisite for protection. This provides us with a huge hint to develop a vaccine to eliminate ADE.

The development of new methods to deliver cross-reactive, neutralizing monoclonal antibodies to the circulatory system could provide rapid, comprehensive and inexpensive protection against related diseases. Flingai using monoclonal antibody DNA encoding antibody (DMAb) encodes for an Fc region-modified with abrogated FcγR binding by way of two leucine-to-alanine (LALA) mutations in the CH2 region and eliminate antibody-dependent enhancement of DENV(Beltramello et al., 2010Flingai et al., 2015). By delivering multiple DENV DMAb plasmids, this increases human IgG levels and the number of targeted serotypes. Injecting the DNA that encodes the antibody produces biologically relevant levels of monoclonal antibodies. The protection provided by DMAb is significantly faster than vaccination protection that takes weeks or months to reach peak effect. Similarly, Elliott uses DMAb technology to encode two monoclonal antibodies with broad cross-protection against influenza A and B (Elliott et al., 2017). It can provide mice with extensive protection against influenza A and B infections.

Zhang made specific antigen peptides, linkers and Fc-III mimetic peptides into Dual-functional Conjugate of Antigenic peptide and Fc-III tag(DCAF) (Zhang et al., 2019). The Fc-III part inhibited the dengue fever ADE process to a certain extent and blocked the antibodies-Virus or antibody-Fc receptor interaction. At the cell level in vitro, DCAF successfully inhibited the ADE effect of dengue fever type 2, indicating that reducing the affinity of Fc region binding to Fc receptor can weaken ADE.

Wang produced anti-idiotypic antibodies against prM antibodies that can cause ADE, and found that they can prevent ADE not only in vitro but also in vivo (Wang et al., 2017). After mice immunized with prM mAb-specific anti-idiotypic antibodies (prM-AID) were infected with DENV-1, interleukin 10 (IL-10) and alanine aminotransferase (ALT) were as low as the negative control level, and the number of platelets increased significantly compared with the control group. It suggesting that anti-idiotypic antibodies may be a new option for treating ADE caused by DENV infection.

Influenza M2 protein extracellular functional area (M2e) has a high degree of conservation which can provide a wide range of protective effects. Antibodies to the influenza M2e protein are well protected by blocking viral ion channel function and mediating ADCC or ADPC action to clear infected cells. Vlieger prepared VHH antibodies against M2e and mouse FcRIV (De Vlieger et al., 2019). Specific antibodies that target only FcRIV may be an advantage because they avoid inhibiting FcRIIb receptor activation in this way. Intranasally administered bi-specific VHH fusion antibodies selectively bind to M2e on infected target cells and activate FcRIV to resist influenza A virus attack. Since antibodies against M2e do not work by neutralizing the virus, this greatly reduces the possibility of ADE. However, the antibody effect of M2e immunization alone is limited, and the development may need to cooperate with neutralization effect for HA to provide a higher protective effect (Wei et al., 2020).

FcγR is highly sensitive to N-linked glycosylation mode of Fc region. Therefore, unique plant N-glycans may affect the characteristics of mAbs produced, including ADE activity (Sun, Chen, & Lai, 2017). E60 (mE60) produced by mammalian cells showed ADE in vivo and in vitro when DENV was infected (Balsitis et al., 2010). E60 produced in plants showed a single predominant expected N-glycoform type with high homogeneity. These E60 glycovariants maintain specific binding to EDII antigen with a kinetics similar to mE60, and showing neutralization activity against a variety of DENV serotypes. Most importantly, E60 produced in plants forwent ADE activity in K562 cells expressing FcγR (Matthew et al., 2016).

5. Effect of adjuvant and inactivation selection on ADE

The choice of adjuvant will also affect the immune effect. The carbonyl group on the vaccine antigen treated with formaldehyde can enhance the T-helper 2 (Th 2) reaction and enhance the respiratory syncytial virus (RSV) disease in mice, which can be partially reversed by the chemical reduction of the carbonyl group (Delgado et al., 2009Moghaddam et al., 2006Ubol & Halstead, 2010).

However, inactivation of RSV by methods other than formalin also makes experimental animals more sensitive to disease. RSV-immunized mice treated with UV-irradiated inactivated purified fusion protein or vaccinia virus RSV replicas developed enhanced diseases after being challenged by wild-type viruses (Delgado et al., 2009Olszewska, Suezer, Sutter, & Openshaw, 2004). Inactivated vaccines have insufficient TLR activation, and adding TLR agonists can prevent ERD. Speculate that this may be related to adjuvant.

Boelen found that unimmunized mice infected with RSV showed a Th1 cell response with mild symptoms; but FI-RSV (formalin inactivated antigen with AL adjuvant added) immunization resulted in aggravated lung histopathology and showed obvious Th2 cellular immune response, although the vaccine is still partially protective, can induce low titer neutralizing antibody response, and virus replication is reduced; Fi-mock (Formalin Inactivated Cell Antigen Negative Control) immunized mice showed increased RSV replication, also manifested by a significant Th2 cell immune response (Boelen et al., 2000). This shows that the Th2 cell immune response induced by the formalin-inactivated vaccine with Al adjuvant seems to be conducive to RSV replication. The combination of Montanide ISA-51 and CpG ODN (oligodeoxynucleotide) has been used in the development of coronavirus vaccine, which can synergistically enhance Th1 immune response (Gupta & Gupta, 2020). Immunization of mice and cynomolgus monkeys with Montanide ISA-51 and CpG emulsified SARS-CoV recombinant N protein can cause a strong Th1 immune response (Liu et al., 2006).

6. Conclusions and future prospects

ADE has been proven in vitro and in animal models for a variety of viruses including DENV, HIV, RSV, SARS-CoV and WNV (Table 1 ).

Table 1

Key characteristics of antibody-dependent enhancement (ADE) infected by different viruses.

VirusMain HostTypes of ADEClinical manifestations of ADEEnhancing epitopes locationImpact of vaccine application
Dengue virusHumans,Primate,Aedes1.FcR mediated virus-antibody immune complexes infect monocytes, macrophages, and dendritic cells
2.Through FcR, LILR-B1 regulates the host’s antiviral response, inhibits the innate response mediated by the TLR signaling pathway, disrupts the RIG-I/MDA-5 signal cascade, and induces IL-10 production
1. Increased susceptibility to other serotypes
2. Increased viral infection and association with severe dengue fever (DHF/DSS)
3. Infants born to dengue fever-immunized mothers, serious diseases that may be infected when maternal antibodies are reduced
prM protein, E protein DII-FL regionVaccine raises the risk of ADE for DENV infection.Sero-negative dengue vaccinators are at increased risk of severe dengue, and WHO recommends vaccination only for sero-positive dengue
SRAS-CoVRhinolophus sinicus,Paguma larvatas,HumansFcR-ADE(mainly mediated by FcγRII)May be related to severe lymphopeniaSpike proteinInfection after immunization may cause severe acute lung injury (ALI)
Influenza virusHumans,Pigs,Birds, FerretsFcR-ADEIncreased risk of a (H1N1) pdm09 diseaseHA,NA1.Trivalent inactivated influenza vaccine (TIV) in 2008-09 increased risk of a (H1N1) pdm09 disease
2. The vaccine may be associated with vaccine associated enhanced respiratory disease (VAERD)
Porcine Reproductive and Respiratory SyndromePigsFcR-ADE (Including FcγRI,FcγRII,FcγRIII, FCɛRI)Promote virus infection and enhance clinical symptoms, Increase the level and duration of viremiaGP5,N ProteinInfected with prrsv after immunization with inactivated vaccine, clinical symptoms increased
Human immunodeficiency virusHumans1.FcR-ADE (Including FcγRI,FcγRII,FcγRIII,FCαR) , FcR promotes virus entry by enhancing adhesion to CD4 receptor
2.CR3, C1q complement mediated ADE
1.ADE and plasma viral load is positive correlation. ADE accelerates immunosuppression and disease progression
2.Enhancing antibodies is beneficial to the emergence of ADE susceptible mutants
N-terminal immune dominant domain of gp41,gp120One of the factors affecting vaccine development,higher rates of infection/risk among vaccinees were observed in RV144 clinical trials, but have not been confirmed to be directly associated with ADE
West nile virusHorses,Humans,Birds1.Fcγ receptor dependent ADE
2.CR3 dependent ADE
Increased viral infectivityDomain I and domain II of the E proteinNo vaccine has been marketed. Plasma samples of human WNV infection during rehabilitation can enhance ZIKV infection in vitro and in vivo
Respiratory syncytial virusHumansFcR mediate the uptake of viruses into monocytes, macrophages, and dendritic cells, leading to enhanced infectionADE infection leads to activation of Th2 response and increased expression of TNF-α and IL-6, resulting in aggravated disease
ADE infection of lung dendritic cells (DCs) can negatively regulate the function of DC cells, resulting in impaired T cell activation
Glycoproteins G and FFormalin inactivated RSV vaccine recipients have increased disease and even led to death

Open in a separate window

The essence of ADE effect is a part of immune regulation. In the next step, we need to clarify the mechanism of ADE and clarify the conditions of ADE occurrence, find out factors that regulate Syk activation and inhibition, the balance between antiviral and inflammatory responses, and upregulation of immunosuppressive IL-10, so as to better block the occurrence of ADE from the perspective of iADE. This will provide ideas and directions for the development of new drugs for infectious diseases such as HIV, DENV, influenza, and even SARS CoV2.

Influenza, SARS-CoV, and PRRSV vaccines all have the potential to cause ADE, or to cause vaccine-related enhanced respiratory disease (VAERD). Although some cannot be directly attributed to ADE, it cannot be denied that ADE is very likely to be one of the potential factors. From the experience of SARS-CoV vaccine development, the development of COIVD-19 vaccines should pay attention to ADE. In the future, it is necessary to identify the antigen epitopes of ADE induced by viruses, effectively avoid them in vaccine design, and further discover effective virus neutralizing epitopes and other non-neutralizing but protective epitopes, which will guide the future design of protective vaccines, therapeutic monoclonal antibodies and nano antibodies.

Activation of the immune system increases the number of activated CD4 (+) T cells, which are more susceptible to infection than inactive T cells (Bukh et al., 2014). Human CMV infection may lead to increased susceptibility to HIV-1 infection. HCMV can preventing antiviral IFN-stimulated gene production by degradation of JAK1, interfering with STAT signaling (Johnson et al., 2018Miller & Boss, 1998Paulus, Krauss, & Nevels, 2006). This is similar to the partially suppressed signal produced by ADE. For the outbreak of COVID-19 worldwide, it is speculated that those individuals with severe illness may have been exposed to one or more previous coronaviruses and are experiencing antibody-dependent enhancement (Tetro, 2020). iADE suppresses the function of the immune system and promotes viral infection or disease. Future research should pay attention to this aspect, that is, whether it will cause the increase of heterologous disease infection when in iADE.

In the experience of RSV vaccine design, especially in the selection of adjuvants in recombinant subunit vaccines, Th1 biased adjuvants should be selected as much as possible, such as poly(I:C) (TLR3),AS04 (TLR4), imiquimod (TLR7/8 ), CpG motifs (TLR9), monophosphoryl lipid A (MPL), and avoid the selection of Th2 biased adjuvants, such as Al adjuvant (Apostolico Jde, Lunardelli, Coirada, Boscardin, & Rosa, 2016Gupta & Gupta, 2020Lindblad, 2004). In the future, the preparation of vaccines also needs to develop new safe and efficient adjuvants to avoid the generation of ADE. Kabir proves that ADE can greatly increase the incidence of new diseases. For multiple serotype infectious diseases such as dengue fever, joint vaccine is more effective. The primary vaccine is a better control tool than the secondary vaccine. In order to suppress secondary infections, secondary vaccinations require high efficiency (Kabir & Tanimoto, 2020). This may be because secondary infections are located further downstream in the dynamic process of infection and require a greater effect to suppress the spread of secondary infections. More rigorous, reasonable and safe immune procedures are also important issues to be solved in future vaccine development.

Acknowledgments

Support for this work was received from the Science Fundation for Distinguished Young Scholars of Shaanxi Province (2021JC-18), the Open Project of the State Key Laboratory of Veterinary Etiological Biology (SKLVEB2020KFKT017), the Youth Innovation Team of Shaanxi Universities, the Science and Technology Extension Project in Northwest A&F University (TGZX2020-24) the Fundamental Research Funds for the Central Universities (2452021154).Go to:

References

  • Anderson L.J., Dormitzer P.R., Nokes D.J., Rappuoli R., Roca A., Graham B.S. Strategic priorities for respiratory syncytial virus (RSV) vaccine development. Vaccine. 2013;31(Suppl 2):B209–B215. doi: 10.1016/j.vaccine.2012.11.106. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Apostolico Jde S., Lunardelli V.A., Coirada F.C., Boscardin S.B., Rosa D.S. Adjuvants: Classification, modus operandi, and licensing. Journal of Immunology Research. 2016;2016:1459394. doi: 10.1155/2016/1459394. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Arvin A.M., Fink K., Schmid M.A., Cathcart A., Spreafico R., Havenar-Daughton C. A perspective on potential antibody-dependent enhancement of SARS-CoV-2. Nature. 2020;584(7821):353–363. doi: 10.1038/s41586-020-2538-8. [PubMed] [CrossRef] [Google Scholar]
  • Arvin A.M., Fink K., Schmid M.A., Cathcart A., Virgin H.W. A perspective on potential antibody-dependent enhancement of SARS-CoV-2. Nature. 2020:1–14. [PubMed] [Google Scholar]
  • Balsitis S.J., Williams K.L., Lachica R., Flores D., Kyle J.L., Mehlhop E. Lethal antibody enhancement of dengue disease in mice is prevented by Fc modification. PLoS Pathogens. 2010;6(2) doi: 10.1371/journal.ppat.1000790. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Beltramello M., Williams K.L., Simmons C.P., Macagno A., Simonelli L., Quyen N.T. The human immune response to Dengue virus is dominated by highly cross-reactive antibodies endowed with neutralizing and enhancing activity. Cell Host & Microbe. 2010;8(3):271–283. doi: 10.1016/j.chom.2010.08.007. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Boelen A., Andeweg A., Kwakkel J., Lokhorst W., Bestebroer T., Dormans J. Both immunisation with a formalin-inactivated respiratory syncytial virus (RSV) vaccine and a mock antigen vaccine induce severe lung pathology and a Th2 cytokine profile in RSV-challenged mice. Vaccine. 2000;19(7):982–991. [PubMed] [Google Scholar]
  • Bukh I., Calcedo R., Roy S., Carnathan D.G., Grant R., Qin Q. Increased mucosal CD4 + T cell activation in rhesus macaques following vaccination with an adenoviral vector. Journal of Virology. 2014;88(15):8468–8478. doi: 10.1128/jvi.03850-13. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Byrne A.B., Talarico L.B. Role of the complement system in antibody-dependent enhancement of flavivirus infections. International Journal of Infectious Diseases. 2021;103:404–411. [PubMed] [Google Scholar]
  • Cancel-Tirado S.M., Evans R.B., Yoon K.J. Monoclonal antibody analysis of porcine reproductive and respiratory syndrome virus epitopes associated with antibody-dependent enhancement and neutralization of virus infection. Veterinary Immunology and Immunopathology. 2004;102(3):249–262. doi: 10.1016/j.vetimm.2004.09.017. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Carro A.C., Piccini L.E., Damonte E.B. Blockade of dengue virus entry into myeloid cells by endocytic inhibitors in the presence or absence of antibodies. PLoS Neglected Tropical Diseases. 2018;12(8) doi: 10.1371/journal.pntd.0006685. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Carvalho D.M., Garcia F.G., Terra A.P., Lopes Tosta A.C., Silva Lde A., Castellano L.R. Elevated dengue virus nonstructural protein 1 serum levels and altered toll-like receptor 4 expression, nitric oxide, and tumor necrosis factor alpha production in dengue hemorrhagic Fever patients. Journal of Tropical Medicine. 2014;2014:901276. doi: 10.1155/2014/901276. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Chan C.Y.Y., Low J.Z.H., Gan E.S., Ong E.Z., Zhang S.L., Tan H.C. Antibody-dependent dengue virus entry modulates cell intrinsic responses for enhanced infection. mSphere. 2019;4(5) doi: 10.1128/mSphere.00528-19. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Chan K.R., Ong E.Z., Tan H.C., Zhang S.L., Zhang Q., Tang K.F. Leukocyte immunoglobulin-like receptor B1 is critical for antibody-dependent dengue. Proceedings of the National Academy of Sciences of the United States of America. 2014;111(7):2722–2727. doi: 10.1073/pnas.1317454111. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Chan K.R., Zhang S.L.-X., Tan H.C., Chan Y.K., Chow A., Lim A.P.C. Ligation of Fc gamma receptor IIB inhibits antibody-dependent enhancement of dengue virus infection. Proceedings of the National Academy of Sciences. 2011 [PMC free article] [PubMed] [Google Scholar]
  • Chareonsirisuthigul T., Kalayanarooj S., Ubol S. Dengue virus (DENV) antibody-dependent enhancement of infection upregulates the production of anti-inflammatory cytokines, but suppresses anti-DENV free radical and pro-inflammatory cytokine production, in THP-1 cells. The Journal of General Virology. 2007;88(Pt 2):365–375. doi: 10.1099/vir.0.82537-0. [PubMed] [CrossRef] [Google Scholar]
  • Chau T.N., Hieu N.T., Anders K.L., Wolbers M., Lien le B., Hieu L.T. Dengue virus infections and maternal antibody decay in a prospective birth cohort study of Vietnamese infants. The Journal of Infectious Diseases. 2009;200(12):1893–1900. doi: 10.1086/648407. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Chau T.N., Quyen N.T., Thuy T.T., Tuan N.M., Hoang D.M., Dung N.T. Dengue in Vietnamese infants—results of infection-enhancement assays correlate with age-related disease epidemiology, and cellular immune responses correlate with disease severity. The Journal of Infectious Diseases. 2008;198(4):516–524. doi: 10.1086/590117. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Chen Z., Zhang L., Qin C., Ba L., Yi C.E., Zhang F. Recombinant modified vaccinia virus Ankara expressing the spike glycoprotein of severe acute respiratory syndrome coronavirus induces protective neutralizing antibodies primarily targeting the receptor binding region. Journal of Virology. 2005;79(5):2678–2688. doi: 10.1128/JVI.79.5.2678-2688.2005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Cheung C.Y., Poon L.L., Ng I.H., Luk W., Sia S.F., Wu M.H. Cytokine responses in severe acute respiratory syndrome coronavirus-infected macrophages in vitro: Possible relevance to pathogenesis. Journal of Virology. 2005;79(12):7819–7826. doi: 10.1128/JVI.79.12.7819-7826.2005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Coish J.M., MacNeil A.J. Out of the frying pan and into the fire? Due diligence warranted for ADE in COVID-19. Microbes and Infection. 2020 doi: 10.1016/j.micinf.2020.06.006. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Cosman D., Fanger N., Borges L., Kubin M., Chin W., Peterson L. A novel immunoglobulin superfamily receptor for cellular and viral MHC class I molecules. Immunity. 1997;7(2):273. [PubMed] [Google Scholar]
  • Cui G., Si L., Wang Y., Zhou J., Yan H., Jiang L. Antibody-dependent enhancement (ADE) of dengue virus: Identification of the key amino acid that is vital in DENV vaccine research. The Journal of Gene Medicine. 2021;23(2) [PMC free article] [PubMed] [Google Scholar]
  • de Taeye S.W., Rispens T., Vidarsson G. The ligands for human IgG and their effector functions. Antibodies (Basel) 2019;8(2) doi: 10.3390/antib8020030. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • De Vlieger D., Hoffmann K., Van Molle I., Nerinckx W., Van Hoecke L., Ballegeer M. Selective engagement of FcgammaRIV by a M2e-specific single domain antibody construct protects against influenza A virus infection. Frontiers in Immunology. 2019;10:2920. doi: 10.3389/fimmu.2019.02920. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Dejnirattisai W., Supasa P., Wongwiwat W., Rouvinski A., Barba-Spaeth G., Duangchinda T. Dengue virus sero-cross-reactivity drives antibody-dependent enhancement of infection with zika virus. Nature Immunology. 2016;17(9):1102–1108. doi: 10.1038/ni.3515. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Delgado M.F., Coviello S., Monsalvo A.C., Melendi G.A., Hernandez J.Z., Batalle J.P. Lack of antibody affinity maturation due to poor Toll-like receptor stimulation leads to enhanced respiratory syncytial virus disease. Nature Medicine. 2009;15(1):34–41. doi: 10.1038/nm.1894. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Elliott S.T.C., Kallewaard N.L., Benjamin E., Wachter-Rosati L., McAuliffe J.M., Patel A. DMAb inoculation of synthetic cross reactive antibodies protects against lethal influenza A and B infections. NPJ Vaccines. 2017;2:18. doi: 10.1038/s41541-017-0020-x. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Flingai S., Plummer E.M., Patel A., Shresta S., Mendoza J.M., Broderick K.E. Protection against dengue disease by synthetic nucleic acid antibody prophylaxis/immunotherapy. Scientific Reports. 2015;5:12616. doi: 10.1038/srep12616. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Furuyama W., Marzi A., Carmody A.B., Maruyama J., Kuroda M., Miyamoto H. Fcγ-receptor IIa-mediated Src Signaling Pathway Is Essential for the Antibody-Dependent Enhancement of Ebola Virus Infection. PLoS Pathogens. 2016;12(12) doi: 10.1371/journal.ppat.1006139. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Furuyama W., Nanbo A., Maruyama J., Marzi A., Takada A. A complement component C1q-mediated mechanism of antibody-dependent enhancement of Ebola virus infection. PLoS Neglected Tropical Diseases. 2020;14(9) doi: 10.1371/journal.pntd.0008602. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Gao Q., Bao L., Mao H., Wang L., Xu K., Yang M. Development of an inactivated vaccine candidate for SARS-CoV-2. Science. 2020;369(6499):77–81. doi: 10.1126/science.abc1932. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Garg H., Yeh R., Watts D.M., Mehmetoglu-Gurbuz T., Resendes R., Parsons B. Enhancement of Zika virus infection by antibodies from West Nile virus seropositive individuals with no history of clinical infection. BMC Immunology. 2021;22(1):5. doi: 10.1186/s12865-020-00389-2. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Goncalvez A.P., Engle R.E., Claire M.S., Purcell R.H., Lai C.-J. Monoclonal antibody-mediated enhancement of dengue virus infection in vitro and in vivo and strategies for prevention. Proceedings. National Academy of Sciences. United States of America. 2007;104(22):9422–9427. [PMC free article] [PubMed] [Google Scholar]
  • Gordon M.J.C.J.S.P.S. Complement receptor mediates enhanced flavivirus replication in macrophages. Journal of Experimental Medicine. 1983;158(1):258–263. [PMC free article] [PubMed] [Google Scholar]
  • Gu W., Guo L., Yu H., Niu J., Huang M., Luo X. Involvement of CD16 in antibody-dependent enhancement of porcine reproductive and respiratory syndrome virus infection. The Journal of General Virology. 2015;96(Pt 7):1712–1722. doi: 10.1099/vir.0.000118. [PubMed] [CrossRef] [Google Scholar]
  • Guilliams M., Bruhns P., Saeys Y., Hammad H., Lambrecht B.N. The function of Fcgamma receptors in dendritic cells and macrophages. Nature Reviews. Immunology. 2014;14(2):94–108. doi: 10.1038/nri3582. [PubMed] [CrossRef] [Google Scholar]
  • Gupta T., Gupta S.K. Potential adjuvants for the development of a SARS-CoV-2 vaccine based on experimental results from similar coronaviruses. International Immunopharmacology. 2020;86:106717. doi: 10.1016/j.intimp.2020.106717. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Halstead S.B., O’Rourke E.J., Allison A.C. Dengue viruses and mononuclear phagocytes. II. Identity of blood and tissue leukocytes supporting in vitro infection. The Journal of Experimental Medicine. 1977;146:218–229. [PMC free article] [PubMed] [Google Scholar]
  • Halstead S.B., Chow J.S., Marchette N.J. Immunological enhancement of dengue virus replication. Nature: New Biology. 1973;243(122):24–26. [PubMed] [Google Scholar]
  • Halstead S.B., Mahalingam S., Marovich M.A., Ubol S., Mosser D.M. Intrinsic antibody-dependent enhancement of microbial infection in macrophages: Disease regulation by immune complexes. Lancet Infectious Diseases. 2010;10(10):712–722. [PMC free article] [PubMed] [Google Scholar]
  • Hanson Q.M., Barb A.W. A perspective on the structure and receptor binding properties of immunoglobulin G Fc. Biochemistry. 2015;54(19):2931–2942. doi: 10.1021/acs.biochem.5b00299. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Heinz F.X., Stiasny K. Flaviviruses and their antigenic structure. Journal of Clinical Virology the Official Publication of the Pan American Society for Clinical Virology. 2012;55(4):289–295. [PubMed] [Google Scholar]
  • Hermanns K., Gohner C., Kopp A., Schmidt A., Merz W.M., Markert U.R. Zika virus infection in human placental tissue explants is enhanced in the presence of dengue virus antibodies in-vitro. Emerging Microbes & Infections. 2018;7(1):198. doi: 10.1038/s41426-018-0199-6. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Ho M.-S., Chen W.-J., Chen H.-Y., Lin S.-F., Wang M.-C., Di J. Neutralizing antibody response and SARS severity. Emerging Infectious Diseases. 2005;11(11):1730–1737. [PMC free article] [PubMed] [Google Scholar]
  • Izmirly A.M., Alturki S.O., Alturki S.O., Connors J., Haddad E.K. Challenges in dengue vaccines development: Pre-existing infections and cross-reactivity. Frontiers in Immunology. 2020;11 doi: 10.3389/fimmu.2020.01055. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Janoff E.N., Wahl S.M., Kelly T., Smith P.D. Modulation of human immunodeficiency virus type 1 infection of human monocytes by IgA. Journal of Infectious Diseases. 1995;3:3. [PubMed] [Google Scholar]
  • Jaume M., Yip M.S., Cheung C.Y., Leung H.L., Li P.H., Kien F. Anti-severe acute respiratory syndrome coronavirus spike antibodies trigger infection of human immune cells via a pH- and cysteine protease-independent FcgammaR pathway. Journal of Virology. 2011;85(20):10582–10597. doi: 10.1128/JVI.00671-11. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Johnson L., Johnson E.L., Boggavarapu S., Johnson E.S., Lal A.A., Agrawal P. Human cytomegalovirus enhances placental susceptibility and replication of human immunodeficiency virus type 1 (HIV-1), which may facilitate in utero HIV-1 transmission. The Journal of Infectious Diseases. 2018 [PMC free article] [PubMed] [Google Scholar]
  • Kabir K.M.A., Tanimoto J. Cost-efficiency analysis of voluntary vaccination against n-serovar diseases using antibody-dependent enhancement: A game approach. Journal of Theoretical Biology. 2020;503:110379. doi: 10.1016/j.jtbi.2020.110379. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Karl-Klaus C., Nico V.…and Molecular Characterization of Porcine Reproductive and Respiratory Syndrome Virus, a Member of the Arterivirus Group. Virology. 1993 [PMC free article] [PubMed] [Google Scholar]
  • Kliks S.C., Nimmanitya S., Nisalak A., Burke D.S. Evidence that maternal antibodies are important in the development of dengue hemorrhagic fever in infants. The American Journal of Tropical Medicine and Hygiene. 1988;38(2):411–419. [PubMed] [Google Scholar]
  • Kuczera D., Assolini J.P., Tomiotto-Pellissier F., Pavanelli W.R., Silveira G.F. Highlights for Dengue Immunopathogenesis: Antibody-Dependent Enhancement, Cytokine Storm, and Beyond. Journal of Interferon & Cytokine Research. 2018;38(2):69–80. [PubMed] [Google Scholar]
  • Kulkarni R. Dynamics of Immune Activation in Viral Diseases. 2020. Antibody-Dependent Enhancement of Viral Infections; pp. 9–41. [Google Scholar]
  • Lafferty R.A.H.A.K.J. The Enhancement of Virus Infectivity by Antibody. Virology. 1967;33:250–261. [PubMed] [Google Scholar]
  • Langerak T., Mumtaz N., Tolk V.I., van Gorp E.C.M., Martina B.E., Rockx B. The possible role of cross-reactive dengue virus antibodies in Zika virus pathogenesis. PLoS Pathogens. 2019;15(4) doi: 10.1371/journal.ppat.1007640. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Li D., Edwards R.J., Manne K., Martinez D.R., Saunders K.O. In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. Cell. 2021 [PMC free article] [PubMed] [Google Scholar]
  • Li Y., Xu G., Du X., Xu L., Ma Z., Li Z. Genomic characteristics and pathogenicity of a new recombinant strain of porcine reproductive and respiratory syndrome virus. Archives of Virology. 2021;166(2):389–402. doi: 10.1007/s00705-020-04917-8. [PubMed] [CrossRef] [Google Scholar]
  • Lin H.H., Yang S.P., Tsai M.J., Lin G.C., Wu H.C., Wu S.C. Dengue and Zika Virus Domain III-Flagellin Fusion and Glycan-Masking E Antigen for Prime-Boost Immunization. Theranostics. 2019;9(16):4811–4826. doi: 10.7150/thno.35919. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Lindblad E.B. Aluminium compounds for use in vaccines. Immunology and Cell Biology. 2004;82(5):497–505. doi: 10.1111/j.0818-9641.2004.01286.x. [PubMed] [CrossRef] [Google Scholar]
  • Littaua R.A., Kurane I., Ennis F.A. Human IgG Fc receptor II mediates antibody dependent enhancement of dengue virus infection. Journal of Immunology. 1990;144(8):3183–3186. [PubMed] [Google Scholar]
  • Liu S.J., Leng C.H., Lien S.P., Chi H.Y., Huang C.Y., Lin C.L. Immunological characterizations of the nucleocapsid protein based SARS vaccine candidates. Vaccine. 2006;24(16):3100–3108. doi: 10.1016/j.vaccine.2006.01.058. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Liu Y., Soh W.T., Kishikawa J.I., Hirose M., Nakayama E.E., Li S. An infectivity-enhancing site on the SARS-CoV-2 spike protein targeted by antibodies. Cell. 2021;184(13) doi: 10.1016/j.cell.2021.05.032. 3452–3466.e3418. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Liu L., Wei Q., Lin Q., Fang J., Wang H., Kwok H. Anti-spike IgG causes severe acute lung injury by skewing macrophage responses during acute SARS-CoV infection. JCI Insight. 2019;4(4) doi: 10.1172/jci.insight.123158. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Lok S.M. The Interplay of Dengue Virus Morphological Diversity and Human Antibodies. Trends in Microbiology. 2016;24(4):284–293. doi: 10.1016/j.tim.2015.12.004. [PubMed] [CrossRef] [Google Scholar]
  • Lv H., Wu N.C., Tsang O.T., Yuan M., Perera R., Leung W.S. Cross-reactive antibody response between SARS-CoV-2 and SARS-CoV infections. bioRxiv. 2020 doi: 10.1101/2020.03.15.993097. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Matthew D., Jonathan H., Paul A.M., Sun H., Lai H., Ming Y. Plant-produced anti-dengue virus monoclonal antibodies exhibit reduced antibody-dependent enhancement of infection activity. Journal of General Virology. 2016;97(12):3280–3290. [PMC free article] [PubMed] [Google Scholar]
  • Miller R., Boss Human cytomegalovirus inhibits major histocompatibility complex class II expression by disruption of the Jak/Stat pathway. Journal of Experimental Medicine. 1998 [PMC free article] [PubMed] [Google Scholar]
  • Modhiran N., Kalayanarooj S., Ubol S. Subversion of innate defenses by the interplay between DENV and pre-existing enhancing antibodies: TLRs signaling collapse. PLoS Neglected Tropical Diseases. 2010;4(12) doi: 10.1371/journal.pntd.0000924. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Moghaddam A., Olszewska W., Wang B., Tregoning J.S., Helson R., Sattentau Q.J. A potential molecular mechanism for hypersensitivity caused by formalin-inactivated vaccines. Nature Medicine. 2006;12(8):905–907. doi: 10.1038/nm1456. [PubMed] [CrossRef] [Google Scholar]
  • Morens D.M., Larsen L.K., Halstead S.B. Study of the distribution of antibody-dependent enhancement determinants on dengue 2 isolates using dengue 2-derived monoclonal antibodies. Journal of Medical Virology. 1987;22(2):163–167. [PubMed] [Google Scholar]
  • Morrone S.R., Lok S.M. Structural perspectives of antibody-dependent enhancement of infection of dengue virus. Current Opinion in Virology. 2019;36:1–8. doi: 10.1016/j.coviro.2019.02.002. [PubMed] [CrossRef] [Google Scholar]
  • Nimmerjahn F., Bruhns P., Horiuchi K., Ravetch J.V. FcγRIV: A Novel FcR with Distinct IgG Subclass Specificity. Immunity. 2005;23(1):41–51. doi: 10.1016/j.immuni.2005.05.010. [PubMed] [CrossRef] [Google Scholar]
  • Oliveira R.A., de Oliveira-Filho E.F., Fernandes A.I., Brito C.A., Marques E.T., Tenorio M.C. Previous dengue or Zika virus exposure can drive to infection enhancement or neutralisation of other flaviviruses. Memórias do Instituto Oswaldo Cruz. 2019;114 doi: 10.1590/0074-02760190098. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Olszewska W., Suezer Y., Sutter G., Openshaw P.J. Protective and disease-enhancing immune responses induced by recombinant modified vaccinia Ankara (MVA) expressing respiratory syncytial virus proteins. Vaccine. 2004;23(2):215–221. doi: 10.1016/j.vaccine.2004.05.015. [PubMed] [CrossRef] [Google Scholar]
  • Ong E.Z., Zhang S.L., Tan H.C., Gan E.S., Chan K.R., Ooi E.E. Dengue virus compartmentalization during antibody-enhanced infection. Scientific Reports. 2017;7:40923. doi: 10.1038/srep40923. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Patro A.R.K., Mohanty S., Prusty B.K., Singh D.K., Gaikwad S., Saswat T. Cytokine signature associated with disease severity in dengue. Viruses. 2019;11(1) doi: 10.3390/v11010034. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Paul L.M., Carlin E.R., Jenkins M.M., Tan A.L., Barcellona C.M., Nicholson C.O. Dengue virus antibodies enhance Zika virus infection. Clinical & Translational Immunology. 2016;5(12) doi: 10.1038/cti.2016.72. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Paulus C., Krauss S., Nevels M. A human cytomegalovirus antagonist of type I IFN-dependent signal transducer and activator of transcription signaling. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(10):3840–3845. doi: 10.1073/pnas.0600007103. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Priyamvada L., Quicke K.M., Hudson W.H., Onlamoon N., Sewatanon J., Edupuganti S. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 2016;113(28):7852–7857. doi: 10.1073/pnas.1607931113. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Prohászka Z., Nemes J., Hidvégi T., Tóth F.D., Kerekes K., Erdei A. Two parallel routes of the complement-mediated antibody-dependent enhancement of HIV-1 infection. AIDS. 1997;11(8):949–958. [PubMed] [Google Scholar]
  • Qiao S., Jiang Z., Tian X., Wang R., Xing G., Wan B. Porcine FcgammaRIIb mediates enhancement of porcine reproductive and respiratory syndrome virus (PRRSV) infection. PLoS One. 2011;6(12) doi: 10.1371/journal.pone.0028721. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Quinlan B.D., Mou H., Zhang L., Guo Y., He W., Ojha A. The SARS-CoV-2 receptor-binding domain elicits a potent neutralizing response without antibody-dependent enhancement. bioRxiv. 2020 doi: 10.1101/2020.04.10.036418. 2020.2004.2010.036418. [CrossRef] [Google Scholar]
  • Randow F., Macmicking J.D., James L.C. Cellular self-defense: How cell-autonomous immunity protects against pathogens. Science. 2013;340(6133):701–706. [PMC free article] [PubMed] [Google Scholar]
  • Rathore A.P.S., St John A.L. Cross-reactive immunity among flaviviruses. Frontiers in Immunology. 2020;11:334. doi: 10.3389/fimmu.2020.00334. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Robinson W.E., Montefiori D.C., Mitchell W.M. Complement-mediated antibody-dependent enhancement of HIV-1 infection requires CD4 and complement receptors. Virology. 1990;175(2):600–604. [PubMed] [Google Scholar]
  • Rodrigo W.W., Jin X., Blackley S.D., Rose R.C., Schlesinger J.J. Differential enhancement of dengue virus immune complex infectivity mediated by signaling-competent and signaling-incompetent human Fcgamma RIA (CD64) or FcgammaRIIA (CD32) Journal of Virology. 2006;80(20):10128–10138. doi: 10.1128/JVI.00792-06. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Saura M., Zaragoza C.A., Quick R., Hohenadl C., Lowenstein J., Lowenstein C. An antiviral mechanism of nitric oxide: Inhibition of a viral protease. Immunity. 1999;10(1):21–28. [PMC free article] [PubMed] [Google Scholar]
  • Sautter C.A., Trus I., Nauwynck H., Summerfield A. No evidence for a role for antibodies during vaccination-induced enhancement of porcine reproductive and respiratory syndrome. Viruses. 2019;11(9) doi: 10.3390/v11090829. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Savidis G., Mcdougall W.M., Meraner P., Perreira J.M., Portmann J.M., Trincucci G. Identification of zika virus and dengue virus dependency factors using functional genomics. Cell Reports. 2016;16(1):232–246. [PubMed] [Google Scholar]
  • Schlesinger J.J., Chapman S.E. Influence of the human high-affinity IgG receptor FcγRI (CD64) on residual infectivity of neutralized dengue virus. Virology. 1999;260(1):84–88. [PubMed] [Google Scholar]
  • Schweitzer B.K., Chapman N.M., Iwen P.C. Overview of the flaviviridae with an emphasis on the japanese encephalitis group viruses. Laboratory Medicine. 2009;40(8):493–499. doi: 10.1309/lm5yws85njpcwesw. [CrossRef] [Google Scholar]
  • Screaton G., Mongkolsapaya J., Yacoub S., Roberts C. New insights into the immunopathology and control of dengue virus infection. Nature Reviews. Immunology. 2015;15(12):745–759. doi: 10.1038/nri3916. [PubMed] [CrossRef] [Google Scholar]
  • Sharma A. It is too soon to attribute ADE to COVID-19. Microbes and Infection. 2020;22(4-5):158. doi: 10.1016/j.micinf.2020.03.005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Shi P., Su Y., Li Y., Zhang L., Lu D., Li R. The alternatively spliced porcine FcgammaRI regulated PRRSV-ADE infection and proinflammatory cytokine production. Developmental and Comparative Immunology. 2019;90:186–198. doi: 10.1016/j.dci.2018.09.019. [PubMed] [CrossRef] [Google Scholar]
  • Shi P., Zhang L., Wang J., Lu D., Li Y., Ren J. Porcine FcepsilonRI mediates porcine reproductive and respiratory syndrome virus multiplication and regulates the inflammatory reaction. Virologica Sinica. 2018;33(3):249–260. doi: 10.1007/s12250-018-0032-3. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Shukla R., Shanmugam R.K., Ramasamy V., Arora U., Batra G., Acklin J.A. Zika virus envelope nanoparticle antibodies protect mice without risk of disease enhancement. eBioMedicine. 2020;54:102738. doi: 10.1016/j.ebiom.2020.102738. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Slon-Campos J.L., Dejnirattisai W., Jagger B.W., Lopez-Camacho C., Wongwiwat W., Durnell L.A. A protective Zika virus E-dimer-based subunit vaccine engineered to abrogate antibody-dependent enhancement of dengue infection. Nature Immunology. 2019;20(10):1291–1298. doi: 10.1038/s41590-019-0477-z. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Sridhar S., Luedtke A., Langevin E., Zhu M., Bonaparte M., Machabert T. Effect of dengue serostatus on dengue vaccine safety and efficacy. The New England Journal of Medicine. 2018;379(4):327–340. doi: 10.1056/NEJMoa1800820. [PubMed] [CrossRef] [Google Scholar]
  • Sun H., Chen Q., Lai H. Development of antibody therapeutics against flaviviruses. International Journal of Molecular Sciences. 2017;19(1) doi: 10.3390/ijms19010054. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Takada A., Ebihara H., Feldmann H., Geisbert T.W., Kawaoka Y. Epitopes required for antibody-dependent enhancement of Ebola virus infection. The Journal of Infectious Diseases. 2007;196(Suppl 2):S347–S356. doi: 10.1086/520581. [PubMed] [CrossRef] [Google Scholar]
  • Takada A., Feldmann H., Ksiazek T.G., Kawaoka Y. Antibody-dependent enhancement of Ebola virus infection. Journal of Virology. 2003;77(13):7539–7544. doi: 10.1128/jvi.77.13.7539-7544.2003. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Tang B., Xiao Y., Sander B., Kulkarni M.A., Radam-Lac Research T., Wu J. Modelling the impact of antibody-dependent enhancement on disease severity of Zika virus and dengue virus sequential and co-infection. Royal Society Open Science. 2020;7(4):191749. doi: 10.1098/rsos.191749. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Taylor A., Foo S.S., Bruzzone R., Vu Dinh L., King N.J.C., Mahalingam S. Fc receptors in antibody-dependent enhancement of viral infections. Immunological Reviews. 2015;268(1):340–364. [PMC free article] [PubMed] [Google Scholar]
  • Tetro J.A. Is COVID-19 receiving ADE from other coronaviruses? Microbes and Infection. 2020;22(2):72–73. doi: 10.1016/j.micinf.2020.02.006. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Thein T.L., Wong J., Leo Y.S., Ooi E.E., Lye D., Yeo T.W. Association between increased vascular nitric oxide bioavailability and progression to dengue hemorrhagic fever in adults. The Journal of Infectious Diseases. 2015;212(5):711–714. doi: 10.1093/infdis/jiv122. [PubMed] [CrossRef] [Google Scholar]
  • Thieblemont N. CR1 (CD35) and CR3 (CD11b/CD18) mediate infection of human monocytes and monocytic cell lines with complement-opsonized HIV independently of CD4. Clinical and Experimental Immunology. 2010;92(1):106–113. doi: 10.1111/j.1365-2249.1993.tb05955.x. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Tsai T.T., Chuang Y.J., Lin Y.S., Chang C.P., Wan S.W., Lin S.H. Antibody-dependent enhancement infection facilitates dengue virus-regulated signaling of IL-10 production in monocytes. PLoS Neglected Tropical Diseases. 2014;8(11) doi: 10.1371/journal.pntd.0003320. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Ubol S., Halstead S.B. How innate immune mechanisms contribute to antibody-enhanced viral infections. Clinical and Vaccine Immunology. 2010;17(12):1829–1835. doi: 10.1128/CVI.00316-10. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Ubol S., Phuklia W., Kalayanarooj S. Mechanisms of immune evasion induced by a complex of dengue virus and preexisting enhancing antibodies. Journal of Infectious Diseases. 2010;201(6):923–935. [PubMed] [Google Scholar]
  • Viktorovskaya O.V., Greco T.M., Cristea I.M., Thompson S.R. Identification of RNA binding proteins associated with dengue virus RNA in infected cells reveals temporally distinct host factor requirements. PLoS Neglected Tropical Diseases. 2016;10(8) doi: 10.1371/journal.pntd.0004921. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • von Kietzell K., Pozzuto T., Heilbronn R., Grossl T., Fechner H., Weger S. Antibody-mediated enhancement of parvovirus B19 uptake into endothelial cells mediated by a receptor for complement factor C1q. Journal of Virology. 2014;88(14):8102–8115. doi: 10.1128/JVI.00649-14. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Walls A.C., Xiong X., Park Y.J., Tortorici M.A., Snijder J., Quispe J. Unexpected receptor functional mimicry elucidates activation of coronavirus fusion. Cell. 2019;176(5):1026–1039. doi: 10.1016/j.cell.2018.12.028. e1015. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Wan B., Chen X., Li Y., Pang M., Bao D. Porcine FcγRIIb mediated PRRSV ADE infection through inhibiting IFN-β by cytoplasmic inhibitory signal transduction. International Journal of Biological Macromolecules. 2019;138 [PubMed] [Google Scholar]
  • Wan Y., Shang J., Sun S., Tai W., Chen J., Geng Q. Molecular mechanism for antibody-dependent enhancement of coronavirus entry. Journal of Virology. 2020;94(5) doi: 10.1128/JVI.02015-19. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Wang T.T., Sewatanon J., Memoli M.J., Wrammert J., Bournazos S., Bhaumik S.K. IgG antibodies to dengue enhanced for Fc gamma RIIIA binding determine disease severity. Science. 2017;355(6323):395–398. [PMC free article] [PubMed] [Google Scholar]
  • Wang Y., Si L.L., Guo X.L., Cui G.H., Fang D.Y., Zhou J.M. Substitution of the precursor peptide prevents anti-prM antibody-mediated antibody-dependent enhancement of dengue virus infection. Virus Research. 2017;229:57–64. doi: 10.1016/j.virusres.2016.12.003. [PubMed] [CrossRef] [Google Scholar]
  • Wang Y., Si L., Luo Y., Guo X., Zhou J., Fang D. Replacement of pr gene with Japanese encephalitis virus pr using reverse genetics reduces antibody-dependent enhancement of dengue virus 2 infection. Applied Microbiology and Biotechnology. 2015;99(22):9685–9698. doi: 10.1007/s00253-015-6819-3. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Wang S.F., Tseng S.P., Yen C.H., Yang J.Y., Tsao C.H., Shen C.W. Antibody-dependent SARS coronavirus infection is mediated by antibodies against spike proteins. Biochemical and Biophysical Research Communications. 2014;451(2):208–214. doi: 10.1016/j.bbrc.2014.07.090. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Wang J., Zand M.S. The potential for antibody-dependent enhancement of SARS-CoV-2 infection: Translational implications for vaccine development. Journal of Clinical and Translational Science. 2020;5(1):1–4. doi: 10.1017/cts.2020.39. [CrossRef] [Google Scholar]
  • Wang M., Yang F., Huang D., Huang Y., Zhang X., Wang C. Anti-Idiotypic antibodies specific to prM monoantibody prevent antibody dependent enhancement of dengue virus infection. Frontiers in Cellular and Infection Microbiology. 2017;7:157. doi: 10.3389/fcimb.2017.00157. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Wang G., Yu Y., Cai X., Zhou E.-M., Zimmerman J.J. Effects of PRRSV infection on the porcine thymus. Trends in Microbiology. 2020;28(3):212–223. [PubMed] [Google Scholar]
  • Wang Q., Zhang L., Kuwahara K., Li L., Liu Z., Li T. Immunodominant SARS coronavirus epitopes in humans elicited both enhancing and neutralizing effects on infection in non-human primates. ACS Infectious Diseases. 2016;2(5):361–376. doi: 10.1021/acsinfecdis.6b00006. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Weaver S.C., Barrett A.D. Transmission cycles, host range, evolution and emergence of arboviral disease. Nature Reviews. Microbiology. 2004;2(10):789–801. doi: 10.1038/nrmicro1006. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Wei C.J., Crank M.C., Shiver J., Graham B.S., Mascola J.R., Nabel G.J. Next-generation influenza vaccines: Opportunities and challenges. Nature Reviews. Drug Discovery. 2020;19(4):239–252. doi: 10.1038/s41573-019-0056-x. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Widjaja I., Wang C., van Haperen R., Gutierrez-Alvarez J., van Dieren B., Okba N.M.A. Towards a solution to MERS: protective human monoclonal antibodies targeting different domains and functions of the MERS-coronavirus spike glycoprotein. Emerging Microbes & Infections. 2019;8(1):516–530. doi: 10.1080/22221751.2019.1597644. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Wrapp D., De Vlieger D., Corbett K.S., Torres G.M., Wang N., Van Breedam W. Structural basis for potent neutralization of betacoronaviruses by single-domain camelid antibodies. Cell. 2020;181(5):1004–1015. doi: 10.1016/j.cell.2020.04.031. e1015. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Yoon K.J., Wu L.L., Zimmerman J.J., Hill H.T., Platt K.B. Antibody-dependent enhancement (ADE) of porcine reproductive and respiratory syndrome virus (PRRSV) infection in pigs. Viral Immunology. 1996;9(1):51–63. [PubMed] [Google Scholar]
  • Zhang L., Chen J., Wang D., Li N., Qin Y., Du D. Ligation of porcine Fc gamma receptor III inhibits levels of antiviral cytokine in response to PRRSV infection in vitro. Research in Veterinary Science. 2016;105:47–52. doi: 10.1016/j.rvsc.2016.01.009. [PubMed] [CrossRef] [Google Scholar]
  • Zhang A., Duan H., Li N., Zhao L., Xiao S. Heme oxygenase-1 metabolite biliverdin, not iron, inhibits porcine reproductive and respiratory syndrome virus replication. Free Radical Biology & Medicine. 2016;102:149–161. [PubMed] [Google Scholar]
  • Zhang L., Li W., Sun Y., Kong L., Xu P., Xia P. Antibody-mediated porcine reproductive and respiratory syndrome virus infection downregulates the production of interferon-α and tumor necrosis factor-α in porcine alveolar macrophages via Fc gamma receptor I and III. Viruses. 2020;12(2) [PMC free article] [PubMed] [Google Scholar]
  • Zhang L., Shen H., Gong Y., Pang X., Yi M., Guo L. Development of a dual-functional conjugate of antigenic peptide and Fc-III mimetics (DCAF) for targeted antibody blocking. Chemical Science. 2019;10(11):3271–3280. doi: 10.1039/c8sc05273e. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Zhou Y., Liu Z., Li S., Xu W., Zhang Q., Silva I.T. Enhancement versus neutralization by SARS-CoV-2 antibodies from a convalescent donor associates with distinct epitopes on the RBD. Cell Reports. 2021;34(5):108699. doi: 10.1016/j.celrep.2021.108699. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Zhou P., Yang X.L., Wang X.G., Hu B., Zhang L., Zhang W. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020;579(7798):270–273. doi: 10.1038/s41586-020-2012-7. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

The novel coronavirus’ spike protein plays additional key role in illness

Salk researchers and collaborators show how the protein damages cells, confirming COVID-19 as a primarily vascular disease

April 30, 2021

LA JOLLA—Scientists have known for a while that SARS-CoV-2’s distinctive “spike” proteins help the virus infect its host by latching on to healthy cells. Now, a major new study shows that the virus spike proteins (which behave very differently than those safely encoded by vaccines) also play a key role in the disease itself.

The paper, published on April 30, 2021, in Circulation Research, also shows conclusively that COVID-19 is a vascular disease, demonstrating exactly how the SARS-CoV-2 virus damages and attacks the vascular system on a cellular level. The findings help explain COVID-19’s wide variety of seemingly unconnected complications, and could open the door for new research into more effective therapies.

Representative images of vascular endothelial control cells (left) and cells treated with the SARS-CoV-2 Spike protein (right) show that the spike protein causes increased mitochondrial fragmentation in vascular cells.
Click here for a high-resolution image.
Credit: Salk Institute

“A lot of people think of it as a respiratory disease, but it’s really a vascular disease,” says Assistant Research Professor Uri Manor, who is co-senior author of the study. “That could explain why some people have strokes, and why some people have issues in other parts of the body. The commonality between them is that they all have vascular underpinnings.”

Salk researchers collaborated with scientists at the University of California San Diego on the paper, including co-first author Jiao Zhang and co-senior author John Shyy, among others.

While the findings themselves aren’t entirely a surprise, the paper provides clear confirmation and a detailed explanation of the mechanism through which the protein damages vascular cells for the first time. There’s been a growing consensus that SARS-CoV-2 affects the vascular system, but exactly how it did so was not understood. Similarly, scientists studying other coronaviruses have long suspected that the spike protein contributed to damaging vascular endothelial cells, but this is the first time the process has been documented.

In the new study, the researchers created a “pseudovirus” that was surrounded by SARS-CoV-2 classic crown of spike proteins, but did not contain any actual virus. Exposure to this pseudovirus resulted in damage to the lungs and arteries of an animal model—proving that the spike protein alone was enough to cause disease. Tissue samples showed inflammation in endothelial cells lining the pulmonary artery walls.

The team then replicated this process in the lab, exposing healthy endothelial cells (which line arteries) to the spike protein. They showed that the spike protein damaged the cells by binding ACE2. This binding disrupted ACE2’s molecular signaling to mitochondria (organelles that generate energy for cells), causing the mitochondria to become damaged and fragmented.

Previous studies have shown a similar effect when cells were exposed to the SARS-CoV-2 virus, but this is the first study to show that the damage occurs when cells are exposed to the spike protein on its own.

“If you remove the replicating capabilities of the virus, it still has a major damaging effect on the vascular cells, simply by virtue of its ability to bind to this ACE2 receptor, the S protein receptor, now famous thanks to COVID,” Manor explains. “Further studies with mutant spike proteins will also provide new insight towards the infectivity and severity of mutant SARS CoV-2 viruses.”

The researchers next hope to take a closer look at the mechanism by which the disrupted ACE2 protein damages mitochondria and causes them to change shape.

Other authors on the study are Yuyang Lei and Zu-Yi Yuan of Jiaotong University in Xi’an, China; Cara R. Schiavon, Leonardo Andrade, and Gerald S. Shadel of Salk; Ming He, Hui Shen, Yichi Zhang, Yoshitake Cho, Mark Hepokoski, Jason X.-J. Yuan, Atul Malhotra, Jin Zhang of the University of California San Diego; Lili Chen, Qian Yin, Ting Lei, Hongliang Wang and Shengpeng Wang of Xi’an Jiatong University Health Science Center in Xi’an, China.

The research was supported by the National Institutes of Health, the National Natural Science Foundation of China, the Shaanxi Natural Science Fund, the National Key Research and Development Program, the First Affiliated Hospital of Xi’an Jiaotong University; and Xi’an Jiaotong University.

DOI: 10.1161/CIRCRESAHA.121.318902

Long-Term Dangers Of Experimental mRNA Shots

Authors: Analysis by Dr. Joseph Mercola

STORY AT-A-GLANCE

  • mRNA-based COVID shots have used codon optimization to improve protein production. A codon consists of three nucleotides, and nucleotides are the building blocks of DNA. Use of codon optimization virtually guarantees unexpected results
  • Replacing rare codons must be done judiciously, as rarer codons can have slower translation rates and a slowed-down rate is actually necessary to prevent protein misfolding
  • Stop codons, when present at the end of an mRNA coding sequence, signals the termination of protein synthesis. According to a recent paper, both Pfizer and Moderna selected suboptimal stop codons
  • The COVID shots induce spike protein at levels unheard of in nature, and the spike protein is the toxic part of the virus responsible for the most unique effects of the virus, such as the blood clotting disorders, neurological problems and heart damage. To expect the COVID shot to not produce these kinds of effects would be rather naïve
  • Other significant threats include immune dysfunction and the flare-up of latent viral infections such as herpes and shingles. Coinfections, in turn, could accelerate other diseases. Herpes viruses, for example, have been implicated as a cause of both AIDS and chronic fatigue syndrome

“Let’s start with a thought experiment: If an engineering design flaw exists and no one measures it, can it really injure people or kill them?” a Twitter user named Ehden writes.1 He goes on to discuss an overlooked aspect of the COVID mRNA shots, something called “codon optimization,” which virtually guarantees unexpected results. Ehden explains:2

“Trying to tell your body to generate proteins is hard for many reasons. One of them is the fact that when you try to run the protein information via ribosomes which process that code and generate the protein, it can be very slow or can get stuck during the process.

Luckily, scientists found a way to overcome this problem, by doing code substitution: instead of using the original genetic code to generate the protein, they changed the letters in the code so the code would be optimized. This is known as Codon Optimization.”

COVID Shots Use Codon Optimization

A codon consists of three nucleotides, and nucleotides are the building blocks of DNA. An August 2021 article in Nature Reviews Drug Discovery, addressed the use of codon optimization as follows:3

“The open reading frame of the mRNA vaccine is the most crucial component because it contains the coding sequence that is translated into protein.

Although the open reading frame is not as malleable as the non-coding regions, it can be optimized to increase translation without altering the protein sequence by replacing rarely used codons with more frequently occurring codons that encode the same amino acid residue.

For instance, the biopharmaceutical company CureVac AG discovered that human mRNA codons rarely have A or U at the third position and patented a strategy that replaces A or U at the third position in the open reading frame with G or C. CureVac used this optimization strategy for its SARS-CoV-2 candidate CVnCoV …

Although replacement of rare codons is an attractive optimization strategy, it must be used judiciously. This is because, in the case of some proteins, the slower translation rate of rare codons is necessary for proper protein folding.

To maximize translation, the mRNA sequence typically incorporates modified nucleosides, such as pseudouridine, N1-methylpseudouridine or other nucleoside analogues. Because all native mRNAs include modified nucleosides, the immune system has evolved to recognize unmodified single-stranded RNA, which is a hallmark of viral infection.

Specifically, unmodified mRNA is recognized by pattern recognition receptors, such as Toll-like receptor 3 (TLR3), TLR7 and TLR8, and the retinoic acid-inducible gene I (RIGI) receptor. TLR7 and TLR8 receptors bind to guanosine- or uridine-rich regions in mRNA and trigger the production of type I interferons, such as IFNα, that can block mRNA translation.

The use of modified nucleosides, particularly modified uridine, prevents recognition by pattern recognition receptors, enabling sufficient levels of translation to produce prophylactic amounts of protein.

Both the Moderna and Pfizer–BioNTech SARS-CoV-2 vaccines … contain nucleoside-modified mRNAs. Another strategy to avoid detection by pattern recognition receptors, pioneered by CureVac, uses sequence engineering and codon optimization to deplete uridines by boosting the GC content of the vaccine mRNA.”

Much of this information was previously reviewed in my interview with Stephanie Seneff, Ph.D., and Judy Mikovits, Ph.D. You can’t see the article but the video is embedded above. This study was published well after our interview and merely confirms what Seneff and Mikovits have unraveled in their research.

According to Ehden, 60.9% of the codons in COVID shots have been optimized, equivalent to 22.5% of the nucleotides, but he doesn’t specify which shot he’s talking about, or exactly where the data came from.

That all mRNA COVID shots are using codon optimization to one degree or another is clear, however. A July 2021 article4 in the journal Vaccines specifically evaluates and comments on the Pfizer/BioNTech and Moderna mRNA shots, noting:

“The design of Pfizer/BioNTech and Moderna mRNA vaccines involves many different types of optimizations … The mRNA components of the vaccine need to have a 5′-UTR to load ribosomes efficiently onto the mRNA for translation initiation, optimized codon usage for efficient translation elongation, and optimal stop codon for efficient translation termination.

Both 5′-UTR and the downstream 3′-UTR should be optimized for mRNA stability. The replacement of uridine by N1-methylpseudourinine (Ψ) complicates some of these optimization processes because Ψ is more versatile in wobbling than U. Different optimizations can conflict with each other, and compromises would need to be made.

I highlight the similarities and differences between Pfizer/BioNTech and Moderna mRNA vaccines and discuss the advantage and disadvantage of each to facilitate future vaccine improvement. In particular, I point out a few optimizations in the design of the two mRNA vaccines that have not been performed properly.”

What Can Go Wrong?

One key take-home from the Nature Reviews Drug Discovery article5 cited above is that replacing rare codons “must be used judiciously,” as rarer codons can have slower translation rates and a slowed-down rate is actually necessary to prevent protein misfolding.The spike protein is the toxic part of the virus responsible for the most unique effects of the virus, such as the blood clotting disorders, neurological problems and heart damage. To expect the COVID shot to not produce these kinds of effects would be rather naïve.

A (adenine) and U (uracil) in the third position are rare, and the COVID shots replace these A’s and U’s with G’s (guanine) or C’s (cytosine). According to Seneff, this switch results in a 1,000-fold greater amount of spike protein compared to being infected with the actual virus.

What could go wrong? Well, just about anything. Again, the shot induces spike protein at levels unheard of in nature (even if SARS-CoV-2 is a “souped up” manmade concoction), and the spike protein is the toxic part of the virus responsible for the most unique effects of the virus, such as the blood clotting disorders, neurological problems and heart damage.

So, to expect the COVID shot to not produce these kinds of effects would be rather naïve. The codon switches might also result in protein misfolding, which is equally bad news. As explained by Seneff in our previous interview:

“The spike proteins that these mRNA vaccines are producing … aren’t able to go into the membrane, which I think is going to encourage it to become a problematic prion protein. Then, when you have inflammation, it upregulates alpha-synuclein [a neuronal protein that regulates synaptic traffic and neurotransmitter release].

So, you’re going to get alpha-synuclein drawn into misfolded spike proteins, turning into a mess inside the dendritic cells in the germinal centers in the spleen. And they’re going to package up all this crud into exosomes and release them. They’re then going to travel along the vagus nerve to the brainstem and cause things like Parkinson’s disease.

So, I think this is a complete setup for Parkinson’s disease … It’s going to push forward the date at which someone who has a propensity towards Parkinson’s is going to get it.

And it’s probably going to cause people to get Parkinson’s who never would have gotten it in the first place — especially if they keep getting the vaccine every year. Every year you do a booster, you bring the date that you’re going to get Parkinson’s ever closer.”

Immune Dysfunction and Viral Flare-Ups

Other significant threats include immune dysfunction and the flare-up of latent viral infections, which is something Mikovits has been warning about. In our previous interview, she noted:

“We use poly(I:C) [a toll-like receptor 3 agonist] to signal the cell to turn on the type I interferon pathway, and because [the spike protein your body produces in response to the COVID shot] is an unnatural synthetic envelope, you’re not seeing poly(I:C), and you’re not [activating] the Type I interferon pathway.

You’ve bypassed the plasmacytoid dendritic cell, which combined with IL-10, by talking to the regulatory B cells, decides what subclasses of antibodies to put out. So, you’ve bypassed the communication between the innate and adaptive immune response. You now miss the signaling of the endocannabinoid receptors …

A large part of Dr. [Francis] Ruscetti’s and my work over the last 30 years has been to show you don’t need an infectious transmissible virus — just pieces and parts of these viruses are worse, because they also turn on danger signals. They act like danger signals and pathogen-associated molecular patterns.

So, it synergistically leaves that inflammatory cytokine signature on that spins your innate immune response out of control. It just cannot keep up with the myelopoiesis [the production of cells in your bone marrow]. Hence you see a skew-away from the mesenchymal stem cell towards TGF-beta regulated hematopoietic stem cells.

This means you could see bleeding disorders on both ends. You can’t make enough firetrucks to send to the fire. Your innate immune response can’t get there, and then you’ve just got a total train wreck of your immune system.”

We’re now seeing reports of herpes and shingles infection following COVID-19 injection, and this is precisely what you can expect if your Type I interferon pathway is disabled. That’s not the end of your potential troubles, however, as these coinfections could accelerate other diseases as well.

For example, herpes viruses have been implicated as a trigger of both AIDS6 and myalgic encephalomyelitis7 (chronic fatigue syndrome or ME-CFS). According to Mikovits, these diseases don’t appear until viruses from different families partner up and retroviruses take out the Type 1 interferon pathway. Long term, the COVID mass injection campaign may be laying the foundation for a rapidly approaching avalanche of a wide range of debilitating chronic illnesses.

Are COVID Shots Appropriately Optimized?

As noted in the Vaccines article cited earlier, the codon optimization in the Pfizer and Moderna shots could be problematic:8

“As mammalian host cells attack unmodified exogeneous RNA, all U nucleotides were replaced by N1-methylpseudouridine (Ψ). However, Ψ wobbles more in base-pairing than U and can pair not only with A and G, but also, to a lesser extent, with C and U.

This is likely to increase misreading of a codon by a near-cognate tRNA. When nucleotide U in stop codons was replaced by Ψ, the rate of misreading of a stop codon by a near-cognate tRNAs increased.

Such readthrough events would not only decrease the number of immunogenic proteins, but also produce a longer protein of unknown fate with potentially deleterious effects …

The designers of both vaccines considered CGG as the optimal codon in the CGN codon family and recoded almost all CGN codons to CGG … [M]ultiple lines of evidence suggest that CGC is a better codon than CGG. The designers of the mRNA vaccines (especially mRNA-1273) chose a wrong codon as the optimal codon.”

The paper also points out the importance of vaccine mRNA to be translated accurately and not merely effectively, because if the wrong amino acids are incorporated, it can confuse your immune system and prevent it from identifying the correct targets.

Accuracy is also important in translation termination, and here it comes down to selecting the correct stop codons. Stop codons (UAA, UAG or UGA), when present at the end of an mRNA coding sequence signals the termination of protein synthesis.

According to the author, both Pfizer and Moderna selected less than optimal stop codons. “UGA is a poor choice of a stop codon, and UGAU in Pfizer/BioNTech and Moderna mRNA vaccines could be even worse,” she says.

What Health Problems Can We Expect to See More Of?

While the variety of diseases we may see a rise in as a result of this vaccination campaign are myriad, some general predictions can be made. We’ve already seen a massive uptick in blood clotting disorders, heart attacks and stroke, as well as heart inflammation.

More long term, Seneff believes we’ll see a significant rise in cancer, accelerated Parkinson’s-like diseases, Huntington’s disease, and all types of autoimmune diseases and neurodegenerative disorders.

Mikovits also suspects many will develop chronic and debilitating diseases and will die prematurely. At highest risk, she places those who are asymptomatically infected with XMRVs and gammaretroviruses from contaminated conventional vaccines. The COVID shot will effectively accelerate their death by crippling their immune function. “The kids that are highly vaccinated, they’re ticking time bombs,” Mikovits said in my May 2021 interview. 

What Are the Options?

While all of this is highly problematic, there is hope. From my perspective, I believe the best thing you can do is to build your innate immune system. To do that, you need to become metabolically flexible and optimize your diet. You’ll also want to make sure your vitamin D level is optimized to between 60 ng/mL and 80 ng/mL (100 nmol/L to 150 nmol/L).

I also recommend time-restricted eating, where you eat all your meals for the day within a six- to eight-hour window. Time-restricted eating will also upregulate autophagy, which may help digest and remove spike protein. Avoid all vegetable oils and processed foods. Focus on certified-organic foods to minimize your glyphosate exposure.

Sauna therapy may also be helpful. It upregulates heat shock proteins, which can help refold misfolded proteins. They also tag damaged proteins and target them for removal.Sources and References

SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro

Authors: Hui Jiang1,2,* and Ya-Fang Mei2,*

Viruses. 2021 Oct; 13(10): 2056.Published online 2021 Oct 13. doi: 10.3390/v13102056

Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) has led to the coronavirus disease 2019 (COVID–19) pandemic, severely affecting public health and the global economy. Adaptive immunity plays a crucial role in fighting against SARS–CoV–2 infection and directly influences the clinical outcomes of patients. Clinical studies have indicated that patients with severe COVID–19 exhibit delayed and weak adaptive immune responses; however, the mechanism by which SARS–CoV–2 impedes adaptive immunity remains unclear. Here, by using an in vitro cell line, we report that the SARS–CoV–2 spike protein significantly inhibits DNA damage repair, which is required for effective V(D)J recombination in adaptive immunity. Mechanistically, we found that the spike protein localizes in the nucleus and inhibits DNA damage repair by impeding key DNA repair protein BRCA1 and 53BP1 recruitment to the damage site. Our findings reveal a potential molecular mechanism by which the spike protein might impede adaptive immunity and underscore the potential side effects of full-length spike-based vaccines.Keywords: SARS–CoV–2, spike, DNA damage repair, V(D)J recombination, vaccineGo to:

1. Introduction

Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) is responsible for the ongoing coronavirus disease 2019 (COVID–19) pandemic that has resulted in more than 2.3 million deaths. SARS–CoV–2 is an enveloped single positive–sense RNA virus that consists of structural and non–structural proteins [1]. After infection, these viral proteins hijack and dysregulate the host cellular machinery to replicate, assemble, and spread progeny viruses [2]. Recent clinical studies have shown that SARS–CoV–2 infection extraordinarily affects lymphocyte number and function [3,4,5,6]. Compared with mild and moderate survivors, patients with severe COVID–19 manifest a significantly lower number of total T cells, helper T cells, and suppressor T cells [3,4]. Additionally, COVID–19 delays IgG and IgM levels after symptom onset [5,6]. Collectively, these clinical observations suggest that SARS–CoV–2 affects the adaptive immune system. However, the mechanism by which SARS–CoV–2 suppresses adaptive immunity remains unclear.

As two critical host surveillance systems, the immune and DNA repair systems are the primary systems that higher organisms rely on for defense against diverse threats and tissue homeostasis. Emerging evidence indicates that these two systems are interdependent, especially during lymphocyte development and maturation [7]. As one of the major double-strand DNA break (DSB) repair pathways, non-homologous end joining (NHEJ) repair plays a critical role in lymphocyte–specific recombination–activating gene endonuclease (RAG) –mediated V(D)J recombination, which results in a highly diverse repertoire of antibodies in B cell and T cell receptors (TCRs) in T cells [8]. For example, loss of function of key DNA repair proteins such as ATM, DNA–PKcs, 53BP1, et al., leads to defects in the NHEJ repair which inhibit the production of functional B and T cells, leading to immunodeficiency [7,9,10,11]. In contrast, viral infection usually induces DNA damage via different mechanisms, such as inducing reactive oxygen species (ROS) production and host cell replication stress [12,13,14]. If DNA damage cannot be properly repaired, it will contribute to the amplification of viral infection-induced pathology. Therefore, we aimed to investigate whether SARS–CoV–2 proteins hijack the DNA damage repair system, thereby affecting adaptive immunity in vitro.Go to:

2. Materials and Methods

2.1. Antibodies and Reagents

DAPI (Cat #MBD0015), doxorubicin (Cat #D1515), H2O2 (Cat #H1009), and β-tubulin antibodies (Cat #T4026) were purchased from Sigma-Aldrich. Antibodies against His tag (Cat #12698), H2A (Cat #12349), H2A.X (Cat #7631), γ–H2A.X (Cat #2577), Ku80 (Cat # 2753), and Rad51(Cat #8875) were purchased from Cell Signaling Technology (Danvers, MA, USA). 53BP1(Cat #NB100-304) and RNF168 (Cat #H00165918–M01) antibodies were obtained from Novus Biologicals (Novus Biologicals, Littleton, CO, USA). Lamin B (Cat #sc–374015), ATM (Cat #sc–135663), DNA–PK (Cat #sc–5282), and BRCA1(Cat #sc–28383) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). XRCC4 (Cat #PA5–82264) antibody was purchased from Thermo Fisher Scientific (Waltham, MA, USA).

2.2. Plasmids

pHPRT–DRGFP and pCBASceI were kindly gifted by Maria Jasin (Addgene plasmids #26476 and #26477) [15]. pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid #44026) [16]. The NSP1, NSP9, NSP13, NSP14, NSP16, spike, and nucleocapsid proteins were first synthesized with codon optimization and then cloned into a mammalian expression vector pUC57 with a C–terminal 6xHis tag. A 12–spacer RSS–GFP inverted complementary sequence–a 23–spacer RSS was synthesized for the V(D)J reporter vector. Then, the sequence was cloned into the pBabe–IRES–mRFP vector to generate the pBabe–12RSS–GFPi–23RSS–IRES–mRFP reporter vector. 12–spacer RSS sequence: 5′–CACAGTGCTACAGACTGGAACAAAAACC–3′. 23–spacer RSS sequence: 5′–CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC–3′. RAG1 and RAG2 expression constructs were generously gifted by Martin Gellert (Addgene plasmid #13328 and #13329) [17].

2.3. Cells and Cell Culture

HEK293T and HEK293 cells obtained from the American Type Culture Collection (ATCC) were cultured under 5% CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX) (Life Technologies, Carlsbad, CA, USA) containing 10% (v/v) fetal calf serum (FCS, Gibco), 1% (v/v) penicillin (100 IU/mL), and streptomycin (100 μg/mL). HEK293T–DR–GFP and HEK293T–EJ5–GFP reporter cells were generated as previously described and cultured under 5% CO2 at 37 °C in the above-mentioned culture medium.

2.4. HR and NHEJ Reporter Assays

HR and NHEJ repair in HEK293T cells were measured as described previously using DR–GFP and EJ5–GFP stable cells. Briefly, 0.5 × 106 HEK293T stable reporter cells were seeded in 6–well plates and transfected with 2 μg I–SceI expression plasmid (pCBASceI) together with SARS–CoV–2 proteins expression plasmids. Forty–eight hours post–transfection and aspirin treatment, cells were harvested and analyzed by flow cytometry analysis for GFP expression. The means were obtained from three independent experiments.

2.5. Cellular Fractionation and Immunoblotting

For the cellular fraction assay, the Subcellular Protein Fractionation Kit (Thermo Fisher) was used according to the manufacturer’s instructions. Protein lysates were quantified using the BCA reagent (Thermo Fisher Scientific, Rockford, IL, USA). Proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to nitrocellulose membranes (Amersham protran, 0.45 μm NC), and immunoblotted with specific primary antibodies followed by HRP–conjugated secondary antibodies. Protein bands were detected using SuperSignal West Pico or Femto Chemiluminescence kit (Thermo Fisher Scientific).

2.6. Comet Assay

Cells were treated with different DNA damage reagents and then harvested at the indicated time points for analysis. Cells (1 × 105 cells/mL in cold phosphate-buffered saline [PBS]) were resuspended in 1% low–melting agarose at 40 °C at a ratio of 1:3 vol/vol and pipetted onto a CometSlide. Slides were then immersed in prechilled lysis buffer (1.2 M NaCl, 100 mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH pH > 13) for overnight (18–20 h) lysis at 4 °C in the dark. Slides were then carefully removed and submerged in rinse buffer (0.03 M NaOH and 2 mM EDTA, pH > 12) at room temperature (RT) for 20 min in the dark. This washing step was repeated twice. The slides were transferred to a horizontal electrophoresis chamber containing rinse buffer and separated for 25 min at a voltage of 0.6 V/cm. Finally, the slides were washed with distilled water, stained with 10 μg/mL propidium iodide, and analyzed by fluorescence microscopy. Twenty fields with approximately 100 cells in each sample were evaluated and quantified using the Fiji software to determine the tail length (tail moment).

2.7. Immunofluorescence

Cells were seeded on glass coverslips in a 12–well plate and transfected with the indicated plasmid for 24 h. Then, the cells were treated with or without DNA damage reagents according to the experimental setup. The cells were fixed in 4% paraformaldehyde (PFA) in PBS for 20 min at RT and then permeabilized in 0.5% Triton X–100 for 10 min. Slides were blocked in 5% normal goat serum (NGS) and incubated with primary antibodies diluted in 1% NGS overnight at 4 °C. Samples were then incubated with the indicated secondary antibodies labeled with Alexa Fluor 488 or 555 (Invitrogen) diluted in 1% NGS at RT for 1 h. Thereafter, they were stained with DAPI for 15 min at RT. Coverslips were mounted using Dako Fluorescence Mounting Medium (Agilent) and imaged using a Nikon confocal microscope (Eclipse C1 Plus). All scoring was performed under blinded conditions.

2.8. Analysis of V(D)J Recombination

Briefly, V(D)J reporter plasmid contains inverted-GFP and IRES driving continuously expressed RFP. Continuously expressed RFP is the internal transfection control. After Recombination activation gene1/2 (RAG1/2) co–transfected into the cells, RAG1/2 will cut the RSS and mediated induction of DSBs, if V(D)J recombination occurs, the inverted GFPs are ligated in positive order by NHEJ repair. Then the cell will express functional GFP. So, the GFP and RFP double positive cells are the readout of the V(D)J reporter assay [18]. 293T cells at 70% confluency were transfected with the V(D)J GFP reporter alone (background) or in combination with RAG1 and RAG2 expression constructs, at a ratio of 1 µg V(D)J GFP reporter: 0.5 µg RAG1: 0.5 µg RAG2. The following day, the medium was changed, and after an additional 48 h, cells were harvested and analyzed by flow cytometry for GFP and RFP expression.

2.9. Statistical Analysis

All experiments were repeated at least three times using independently collected or prepared samples. Data were analyzed by Student’s t test or ANOVA followed by Tukey’s multiple-comparison tests using GraphPad 8.Go to:

3. Results

3.1. Effect of Nuclear–Localized SARS–CoV–2 Viral Proteins on DNA Damage Repair

DNA damage repair occurs mainly in the nucleus to ensure genome stability. Although SARS–CoV–2 proteins are synthesized in the cytosol [1], some viral proteins are also detectable in the nucleus, including Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 [19]. We investigated whether these nuclear-localized SARS–CoV–2 proteins affect the host cell DNA damage repair system. For this, we constructed these viral protein expression plasmids together with spike and nucleoprotein expression plasmids, which are generally considered cytosol–localized proteins. We confirmed their expression and localization by immunoblotting and immunofluorescence (Figure 1A and Figure S1A). Our results were consistent with those from previous studies [19]; Nsp1, Nsp5, Nsp9, Nsp13, Nsp14, and Nsp16 proteins are indeed localized in the nucleus, and nucleoproteins are mainly localized in the cytosol. Surprisingly, we found the abundance of the spike protein in the nucleus (Figure 1A). NHEJ repair and homologous recombination (HR) repair are two major DNA repair pathways that not only continuously monitor and ensure genome integrity but are also vital for adaptive immune cell functions [9]. To evaluate whether these viral proteins impede the DSB repair pathway, we examined the repair of a site-specific DSB induced by the I–SceI endonuclease using the direct repeat–green fluorescence protein (DR–GFP) and the total-NHEJ-GFP (EJ5–GFP) reporter systems for HR and NHEJ, respectively [15,16]. Overexpression of Nsp1, Nsp5, Nsp13, Nsp14, and spike proteins diminished the efficiencies of both HR and NHEJ repair (Figure 1B–E and Figure S2A,B). Moreover, we also found that Nsp1, Nsp5, Nsp13, and Nsp14 overexpression dramatically suppressed proliferation compared with other studied proteins (Figure S3A,B). Therefore, the inhibitory effect of Nsp1, Nsp5, Nsp13, and Nsp14 on DNA damage repair may be due to secondary effects, such as growth arrest and cell death. Interestingly, overexpressed spike protein did not affect cell morphology or proliferation but significantly suppressed both HR and NHEJ repair (Figure 1B–E, Figures S2A,B and S3A,B).

An external file that holds a picture, illustration, etc.
Object name is viruses-13-02056-g001.jpg

Open in a separate windowFigure 1

Effect of severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) nuclear-localized proteins on DNA damage repair. (A) Subcellular distribution of the SARS–CoV–2 proteins. Immunofluorescence was performed at 24 h after transfection of the plasmid expressing the viral proteins into HEK293T cells. Scale bar: 10 µm. (B) Schematic of the EJ5-GFP reporter used to monitor non-homologous end joining (NHEJ). (C) Effect of empty vector (E.V) and SARS–CoV–2 proteins on NHEJ DNA repair. The values represent the mean ± standard deviation (SD) from three independent experiments (see representative FACS plots in Figure S2A). (D) Schematic of the DR-GFP reporter used to monitor homologous recombination (HR). (E) Effect of E.V and SARS–CoV–2 proteins on HR DNA repair. The values represent the mean ± SD from three independent experiments (see representative FACS plots in Figure S2B). The values represent the mean ± SD, n = 3. Statistical significance was determined using one-way analysis of variance (ANOVA) in (C,E). ** p < 0.01, *** p < 0.001, **** p <  0.0001.

3.2. SARS–CoV–2 Spike Protein Inhibits DNA Damage Repair

Because spike proteins are critical for mediating viral entry into host cells and are the focus of most vaccine strategies [20,21], we further investigated the role of spike proteins in DNA damage repair and its associated V(D)J recombination. Spike proteins are usually thought to be synthesized on the rough endoplasmic reticulum (ER) [1]. After posttranslational modifications such as glycosylation, spike proteins traffic via the cellular membrane apparatus together with other viral proteins to form the mature virion [1]. Spike protein contains two major subunits, S1 and S2, as well as several functional domains or repeats [22] (Figure 2A). In the native state, spike proteins exist as inactive full–length proteins. During viral infection, host cell proteases such as furin protease activate the S protein by cleaving it into S1 and S2 subunits, which is necessary for viral entry into the target cell [23]. We further explored different subunits of the spike protein to elucidate the functional features required for DNA repair inhibition. Only the full–length spike protein strongly inhibited both NHEJ and HR repair (Figure 2B–E and Figure S4A,B). Next, we sought to determine whether the spike protein directly contributes to genomic instability by inhibiting DSB repair. We monitored the levels of DSBs using comet assays. Following different DNA damage treatments, such as γ–irradiation, doxorubicin treatment, and H2O2 treatment, there is less repair in the presence of the spike protein (Figure 2F,G). Together, these data demonstrate that the spike protein directly affects DNA repair in the nucleus.

An external file that holds a picture, illustration, etc.
Object name is viruses-13-02056-g002.jpg

Open in a separate windowFigure 2

Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) spike protein inhibits DNA damage repair. (A) Schematic of the primary structure of the SARS–CoV–2 spike protein. The S1 subunit includes an N–terminal domain (NTD, 14–305 residues) and a receptor–binding domain (RBD, 319–541 residues). The S2 subunit consists of the fusion peptide (FP, 788–806 residues), heptapeptide repeat sequence 1 (HR1, 912–984 residues), HR2 (1163–1213 residues), TM domain (TM, 1213–1237 residues), and cytoplasm domain (CT,1237–1273 residues). (B,C) Effect of titrated expression of the spike protein on DNA repair in HEK–293T cells. (D,E) Only full-length spike protein inhibits non-homologous end joining (NHEJ) and homologous recombination (HR) DNA repair. The values represent the mean ± SD from three independent experiments (see representative FACS plots in Figure S4A,B). (F) Full–length spike (S–FL) protein–transfected HEK293T cells exhibited more DNA damage than empty vector-, S1–, and S2–transfected cells under different DNA damage conditions. For doxorubicin: 4 µg/mL, 2 h. For γ–irradiation: 10 Gy, 30 min. For H2O2: 100 µM, 1 h. Scale bar: 50 µm. (G) Corresponding quantification of the comet tail moments from 20 different fields with n > 200 comets of three independent experiments. Statistical significance was assessed using a two-way analysis of variance (ANOVA). NS (Not Significant): * p > 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

3.3. Spike Proteins Impede the Recruitment of DNA Damage Repair Checkpoint Proteins

To confirm the existence of spike protein in the nucleus, we performed subcellular fraction analysis and found that spike proteins are not only enriched in the cellular membrane fraction but are also abundant in the nuclear fraction, with detectable expression even in the chromatin–bound fraction (Figure 3A). We also observed that the spike has three different forms, the higher band is a highly glycosylated spike, the middle one is a full–length spike, and the lower one is a cleaved spike subunit. Consistent with the comet assay, we also found the upregulation of the DNA damage marker, γ–H2A.X, in spike protein–overexpressed cells under DNA damage conditions (Figure 3B). A recent study suggested that spike proteins induce ER stress and ER–associated protein degradation [24]. To exclude the possibility that the spike protein inhibits DNA repair by promoting DNA repair protein degradation, we checked the expression of some essential DNA repair proteins in NHEJ and HR repair pathways and found that these DNA repair proteins were stable after spike protein overexpression (Figure 3C). To determine how the spike protein inhibits both NHEJ and HR repair pathways, we analyzed the recruitment of BRCA1 and 53BP1, which are the key checkpoint proteins for HR and NHEJ repair, respectively. We found that the spike protein markedly inhibited both BRCA1 and 53BP1 foci formation (Figure 3D–G). Together, these data show that the SARS–CoV–2 full–length spike protein inhibits DNA damage repair by hindering DNA repair protein recruitment.

An external file that holds a picture, illustration, etc.
Object name is viruses-13-02056-g003.jpg

Open in a separate windowFigure 3

Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) spike protein impedes the recruitment of DNA damage repair checkpoint proteins. (A) Membrane fraction (MF), cytosolic fraction (CF), soluble nuclear fraction (SNF), and chromatin-bound fraction (CBF) from HEK293T cells transfected with SARS–CoV–2 spike protein were immunoblotted for His-tag spike and indicated proteins. (B) Left: Immunoblots of DNA damage marker γH2AX in empty vector (E.V)– and spike protein–expressing HEK293T cells after 10 Gy γ-irradiation. Right: corresponding quantification of immunoblots in left. The values represent the mean ± SD (n = 3). Statistical significance was determined using Student’s t-test. **** p < 0.0001. (C) Immunoblots of DNA damage repair related proteins in spike protein–expressing HEK293T cells. (D) Representative images of 53BP1 foci formation in E.V– and spike protein-expressing HEK293 cells exposed to 10 Gy γ–irradiation. Scale bar: 10 µm. (E) Quantitative analysis of 53BP1 foci per nucleus. The values represent the mean ± SEM, n = 50. (F) BRCA1 foci formation in empty vector- and spike protein-expressing HEK293 cells exposed to 10 Gy γ–irradiation. Scale bar: 10 µm. (G). Quantitative analysis of BRCA1 foci per nucleus. The values represent the mean ± SEM, n = 50. Statistical significance was determined using Student’s t-test. **** p < 0.0001.

3.4. Spike Protein Impairs V(D)J Recombination In vitro

DNA damage repair, especially NHEJ repair, is essential for V(D)J recombination, which lies at the core of B and T cell immunity [9]. To date, many approved SARS–CoV–2 vaccines, such as mRNA vaccines and adenovirus–COVID–19 vaccines, have been developed based on the full–length spike protein [25]. Although it is debatable whether SARS–CoV–2 directly infects lymphocyte precursors [26,27], some reports have shown that infected cells secrete exosomes that can deliver SARS–CoV–2 RNA or protein to target cells [28,29]. We further tested whether the spike protein reduced NHEJ–mediated V(D)J recombination. For this, we designed an in vitro V(D)J recombination reporter system according to a previous study [18] (Figure S5). Compared with the empty vector, spike protein overexpression inhibited RAG–mediated V(D)J recombination in this in vitro reporter system (Figure 4).

An external file that holds a picture, illustration, etc.
Object name is viruses-13-02056-g004.jpg

Figure 4

Spike protein impairs V(D)J recombination in vitro. (A) Schematic of the V(D)J reporter system. (B) Representative plots of flow cytometry show that the SARS–CoV–2 spike protein impedes V(D)J recombination in vitro. (C) Quantitative analysis of relative V(D)J recombination. The values represent the mean ± SD, n = 3. Statistical significance was determined using Student’s t-test. **** p < 0.0001.Go to:

4. Discussion

Our findings provide evidence of the spike protein hijacking the DNA damage repair machinery and adaptive immune machinery in vitro. We propose a potential mechanism by which spike proteins may impair adaptive immunity by inhibiting DNA damage repair. Although no evidence has been published that SARS–CoV–2 can infect thymocytes or bone marrow lymphoid cells, our in vitro V(D)J reporter assay shows that the spike protein intensely impeded V(D)J recombination. Consistent with our results, clinical observations also show that the risk of severe illness or death with COVID–19 increases with age, especially older adults who are at the highest risk [22]. This may be because SARS–CoV–2 spike proteins can weaken the DNA repair system of older people and consequently impede V(D)J recombination and adaptive immunity. In contrast, our data provide valuable details on the involvement of spike protein subunits in DNA damage repair, indicating that full–length spike–based vaccines may inhibit the recombination of V(D)J in B cells, which is also consistent with a recent study that a full–length spike–based vaccine induced lower antibody titers compared to the RBD–based vaccine [28]. This suggests that the use of antigenic epitopes of the spike as a SARS–CoV–2 vaccine might be safer and more efficacious than the full–length spike. Taken together, we identified one of the potentially important mechanisms of SARS–CoV–2 suppression of the host adaptive immune machinery. Furthermore, our findings also imply a potential side effect of the full–length spike–based vaccine. This work will improve the understanding of COVID–19 pathogenesis and provide new strategies for designing more efficient and safer vaccines.Go to:

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/v13102056/s1, Figure S1: Expression of nuclear–localized SARS–CoV–2 proteins in human cells, Figure S2: Effect of nuclear SARS–CoV–2 proteins on NHEJ– and HR–DNA repair pathway, Figure S3: Nsp1, Nsp5, Nsp13, Nsp14 but not spike inhibit cell proliferation, Figure S4: Effect of SARS–CoV–2 spike mutants on NHEJ– and HR– DNA repair pathway, Figure S5: In vitro V(D)J recombination assay.Click here for additional data file.(1.3M, zip)Go to:

Author Contributions

H.J. conceived and designed the study. H.J. and Y.-F.M. supervised the study, performed experiments, and interpreted the data. Writing—original draft preparation, H.J.; Writing—review and editing, H.J. and Y.-F.M.; funding acquisition, Y.-F.M. All authors have read and agreed to the published version of the manuscript.Go to:

Funding

This work was supported by Umeå University, Medical Faculty’s Planning grants for COVID–19 (research project number: 3453 16032 to Y.F.M.); the Lion’s Cancer Research Foundation at Umeå University (grants: LP 17–2153, AMP 19–982, and LP 20–2256 to Y.F.M.), and the base unit’s ALF funds for research at academic healthcare units and university healthcare units in the northern healthcare region (ALF–Basenheten: 2019, 2020, 2021 to Y.F.M.).Go to:

Institutional Review Board Statement

Not applicable, because of this study not involving humans or animals.Go to:

Informed Consent Statement

Not applicable, because of this study not involving humans.Go to:

Data Availability Statement

The data presented in this study are available in the main text and Supplementary Materials.Go to:

Conflicts of Interest

The authors have declared that no competing interests exist. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.Go to:

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.Go to:

References

1. V’Kovski P., Kratzel A., Steiner S., Stalder H., Thiel V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021;19:155–170. doi: 10.1038/s41579-020-00468-6. [PMC free article] [PubMed] [CrossRef] [Google Scholar]2. Suryawanshi R.K., Koganti R., Agelidis A., Patil C.D., Shukla D. Dysregulation of Cell Signaling by SARS-CoV-2. Trends Microbiol. 2021;29:224–237. doi: 10.1016/j.tim.2020.12.007. [PMC free article] [PubMed] [CrossRef] [Google Scholar]3. Qin C., Zhou L., Hu Z., Zhang S., Yang S., Tao Y., Xie C., Ma K., Shang K., Wang W., et al. Dysregulation of Immune Response in Patients With Coronavirus 2019 (COVID-19) in Wuhan, China. Clin. Infect. Dis. 2020;71:762–768. doi: 10.1093/cid/ciaa248. [PMC free article] [PubMed] [CrossRef] [Google Scholar]4. Wang F., Nie J., Wang H., Zhao Q., Xiong Y., Deng L., Song S., Ma Z., Mo P., Zhang Y. Characteristics of Peripheral Lymphocyte Subset Alteration in COVID-19 Pneumonia. J. Infect. Dis. 2020;221:1762–1769. doi: 10.1093/infdis/jiaa150. [PMC free article] [PubMed] [CrossRef] [Google Scholar]5. Zhang G., Nie S., Zhang Z., Zhang Z. Longitudinal Change of Severe Acute Respiratory Syndrome Coronavirus 2 Antibodies in Patients with Coronavirus Disease 2019. J. Infect. Dis. 2020;222:183–188. doi: 10.1093/infdis/jiaa229. [PMC free article] [PubMed] [CrossRef] [Google Scholar]6. Long Q.X., Liu B.Z., Deng H.J., Wu G.C., Deng K., Chen Y.K., Liao P., Qiu J.F., Lin Y., Cai X.F., et al. Antibody responses to SARS-CoV-2 in patients with COVID-19. Nat. Med. 2020;26:845–848. doi: 10.1038/s41591-020-0897-1. [PubMed] [CrossRef] [Google Scholar]7. Bednarski J.J., Sleckman B.P. Lymphocyte development: Integration of DNA damage response signaling. Adv. Immunol. 2012;116:175–204. [PMC free article] [PubMed] [Google Scholar]8. Malu S., Malshetty V., Francis D., Cortes P. Role of non-homologous end joining in V(D)J recombination. Immunol. Res. 2012;54:233–246. doi: 10.1007/s12026-012-8329-z. [PubMed] [CrossRef] [Google Scholar]9. Bednarski J.J., Sleckman B.P. At the intersection of DNA damage and immune responses. Nat. Rev. Immunol. 2019;19:231–242. doi: 10.1038/s41577-019-0135-6. [PMC free article] [PubMed] [CrossRef] [Google Scholar]10. Gapud E.J., Sleckman B.P. Unique and redundant functions of ATM and DNA-PKcs during V(D)J recombination. Cell. Cycle. 2011;10:1928–1935. doi: 10.4161/cc.10.12.16011. [PMC free article] [PubMed] [CrossRef] [Google Scholar]11. Difilippantonio S., Gapud E., Wong N., Huang C.Y., Mahowald G., Chen H.T., Kruhlak M.J., Callen E., Livak F., Nussenzweig M.C., et al. 53BP1 facilitates long-range DNA end-joining during V(D)J recombination. Nature. 2008;456:529–533. doi: 10.1038/nature07476. [PMC free article] [PubMed] [CrossRef] [Google Scholar]12. Schwarz K.B. Oxidative stress during viral infection: A review. Free Radic. Biol. Med. 1996;21:641–649. doi: 10.1016/0891-5849(96)00131-1. [PubMed] [CrossRef] [Google Scholar]13. Xu L.H., Huang M., Fang S.G., Liu D.X. Coronavirus infection induces DNA replication stress partly through interaction of its nonstructural protein 13 with the p125 subunit of DNA polymerase delta. J. Biol. Chem. 2011;286:39546–39559. doi: 10.1074/jbc.M111.242206. [PMC free article] [PubMed] [CrossRef] [Google Scholar]14. Delgado-Roche L., Mesta F. Oxidative Stress as Key Player in Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Infection. Arch. Med. Res. 2020;51:384–387. doi: 10.1016/j.arcmed.2020.04.019. [PMC free article] [PubMed] [CrossRef] [Google Scholar]15. Pierce A.J., Hu P., Han M., Ellis N., Jasin M. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 2001;15:3237–3242. doi: 10.1101/gad.946401. [PMC free article] [PubMed] [CrossRef] [Google Scholar]16. Bennardo N., Cheng A., Huang N., Stark J.M. Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair. PLoS Genet. 2008;4:e1000110. doi: 10.1371/journal.pgen.1000110. [PMC free article] [PubMed] [CrossRef] [Google Scholar]17. Sadofsky M.J., Hesse J.E., McBlane J.F., Gellert M. Expression and V(D)J recombination activity of mutated RAG-1 proteins. Nucleic Acids Res. 1993;21:5644–5650. doi: 10.1093/nar/21.24.5644. [PMC free article] [PubMed] [CrossRef] [Google Scholar]18. Trancoso I., Bonnet M., Gardner R., Carneiro J., Barreto V., Demengeot J., Sarmento L. A Novel Quantitative Fluorescent Reporter Assay for RAG Targets and RAG Activity. Front. Immunol. 2013;4:110. doi: 10.3389/fimmu.2013.00110. [PMC free article] [PubMed] [CrossRef] [Google Scholar]19. Zhang J., Cruz-cosme R., Zhuang M.-W., Liu D., Liu Y., Teng S., Wang P.-H., Tang Q. A systemic and molecular study of subcellular localization of SARS-CoV-2 proteins. Signal Transduct. Target. Ther. 2020;5:269. doi: 10.1038/s41392-020-00372-8. [PMC free article] [PubMed] [CrossRef] [Google Scholar]20. Shang J., Wan Y., Luo C., Ye G., Geng Q., Auerbach A., Li F. Cell entry mechanisms of SARS-CoV-2. Proc. Natl. Acad. Sci. USA. 2020;117:11727–11734. doi: 10.1073/pnas.2003138117. [PMC free article] [PubMed] [CrossRef] [Google Scholar]21. Du L., He Y., Zhou Y., Liu S., Zheng B.J., Jiang S. The spike protein of SARS-CoV—A target for vaccine and therapeutic development. Nat. Rev. Microbiol. 2009;7:226–236. doi: 10.1038/nrmicro2090. [PMC free article] [PubMed] [CrossRef] [Google Scholar]22. Huang Y., Yang C., Xu X.F., Xu W., Liu S.W. Structural and functional properties of SARS-CoV-2 spike protein: Potential antivirus drug development for COVID-19. Acta Pharmacol. Sin. 2020;41:1141–1149. doi: 10.1038/s41401-020-0485-4. [PMC free article] [PubMed] [CrossRef] [Google Scholar]23. Hoffmann M., Kleine-Weber H., Schroeder S., Kruger N., Herrler T., Erichsen S., Schiergens T.S., Herrler G., Wu N.H., Nitsche A., et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell. 2020;181:271–280.e8. doi: 10.1016/j.cell.2020.02.052. [PMC free article] [PubMed] [CrossRef] [Google Scholar]24. Hsu A.C.-Y., Wang G., Reid A.T., Veerati P.C., Pathinayake P.S., Daly K., Mayall J.R., Hansbro P.M., Horvat J.C., Wang F., et al. SARS-CoV-2 Spike protein promotes hyper-inflammatory response that can be ameliorated by Spike-antagonistic peptide and FDA-approved ER stress and MAP kinase inhibitors in vitro. bioRxiv. 2020;2020:317818. [Google Scholar]25. Poland G.A., Ovsyannikova I.G., Kennedy R.B. SARS-CoV-2 immunity: Review and applications to phase 3 vaccine candidates. Lancet. 2020;396:1595–1606. doi: 10.1016/S0140-6736(20)32137-1. [PMC free article] [PubMed] [CrossRef] [Google Scholar]26. Davanzo G.G., Codo A.C., Brunetti N.S., Boldrini V., Knittel T.L., Monterio L.B., de Moraes D., Ferrari A.J.R., de Souza G.F., Muraro S.P., et al. SARS-CoV-2 Uses CD4 to Infect T Helper Lymphocytes. medRxiv. 2020;2020:20200329. [Google Scholar]27. Borsa M., Mazet J.M. Attacking the defence: SARS-CoV-2 can infect immune cells. Nat. Rev. Immunol. 2020;20:592. doi: 10.1038/s41577-020-00439-1. [PMC free article] [PubMed] [CrossRef] [Google Scholar]28. Barberis E., Vanella V.V., Falasca M., Caneapero V., Cappellano G., Raineri D., Ghirimoldi M., De Giorgis V., Puricelli C., Vaschetto R., et al. Circulating Exosomes Are Strongly Involved in SARS-CoV-2 Infection. Front. Mol. Biosci. 2021;8:632290. doi: 10.3389/fmolb.2021.632290. [PMC free article] [PubMed] [CrossRef] [Google Scholar]29. Sur S., Khatun M., Steele R., Isbell T.S., Ray R., Ray R.B. Exosomes from COVID-19 patients carry tenascin-C and fibrinogen-β in triggering inflammatory signals in distant organ cells. bioRxiv. 2021;2021:430369. [PMC free article] [PubMed] [Google Scholar]

COVID-19 Causes Genetic Changes that Create Long-Haul COVID-19 Symptoms, Researchers Find

Gene changes caused by SARS-CoV-2 spike proteins provide a potential answer for what causes long-haul COVID-19, Texas researchers find 

As COVID-19 vaccines become widely available and cases of COVID-19 in the United States begin to drop, the medical community is beginning to focus more on the long-term effects of COVID-19. Sometimes called “long-haul COVID-19,” the varied and long-term effects that a SARS-CoV-2 infection can create are just starting to be understood (See Long-Haul COVID-19 Emerges as a Concern, Potentially Increasing Need for More COVID-19 Antibody Testing).

New research out of Texas Tech University provides a possible explanation for why these symptoms occur. Led by Sharilyn Almodovar, PhD, at the Texas Tech University Health Sciences Center, researchers found that exposing airway cells to the spike protein of the SARS-CoV-2 virus caused genetic changes.

Potential Impact of Exposure to SARS-CoV-2 Spike Protein Alone

“We found that exposure to the SARS-CoV-2 spike protein alone was enough to change baseline gene expression in airway cells,” said Nicholas Evans, a master’s student at the Texas Tech University Health Sciences Center and one of the researchers involved in the study. “This suggests that symptoms seen in patients may initially result from the spike protein interacting with the cells directly.”

This finding that changes in gene expression occur with exposure to the spike protein of SARS-CoV-2 provides a possible explanation of what causes the mysterious, unexplainable symptoms of long-haul COVID-19 that vary from patient to patient. Changes in gene expression can have different effects on different patients, depending on their genetic makeup and their exposure to the virus.

“Our work helps to elucidate changes occurring in patients on the genetic level, which could eventually provide insight into which treatments would work best for specific patients,” says Evans.

Research May Eventually Lead to Clues About Unexplained Illnesses

While the scientific community’s understanding of long-haul COVID-19 is still quite nascent, Almodovar’s team’s findings are one of the first findings in studying long-haul COVID-19 that provide a good explanation for what could potentially be the cause of these symptoms. This new research will undoubtedly lead to further research examining more in-depth which genes are affected and to what extent this impacts different individuals. These findings may also have implications for other previously unexplained illnesses, such as the long-term effects of Lyme disease.

One interesting result of the these findings is that they may explain why some people with long-haul COVID-19 symptoms have relief of their symptoms after getting vaccinated against COVID-19. Authorized COVID-19 vaccines are designed to use human cells to manufacture spike proteins and stimulate immunity. The finding that the spike protein of SARS-CoV-2 may cause long-haul COVID-19 symptoms could explain how vaccines that artificially create a form of the spike protein could cause these symptoms to change.

COVID-19 Vaccine Questions, Further Studies

Another question that this finding raises is if COVID-19 vaccines, which artificially create SARS-CoV-2 spike proteins, could also stimulate changes in gene expression, causing symptoms that mimic long-haul COVID-19 symptoms.

While Almodovar’s team’s research is only the beginning of study into the possibility of gene expression changes driving long-haul COVID-19 symptoms, it may become a foundational concept in this area of research.

Understanding the implications and effects of long-haul COVID-19 will be important for clinical laboratories that provide COVID-19 antibody testing. As the medical community’s understanding of long-haul COVID-19 increases, it may not only increase the demand for serology tests but may also create a demand for other related tests, particularly immunologically-related tests.

Clinical laboratories will benefit from keeping abreast of long-haul COVID-19 related research and being aware of developments that affect how testing will support clinical treatments and outcomes.

Long-Haulers: Spike Protein Present on Covid And in Vaccines Dangerously Modifies Genes Even After Exposure – Texas Tech Uni Study

study by the Texas Tech University published in Biochemistry and Molecular Biology section of the FASEB journal, has found that spike proteins which Covid-19 uses to penetrate cells and is also supplied in abundance by vaccines to stimulate the body’s immune response, modify the body’s genes.

The study coordinators, Nicholas Evans et al. found that even after exposure, these proteins stimulate continued gene expression and inflammatory events that may be behind the long haul Covid and post vaccine syndromes.

Quoting from a review of the study as we published earlier:

“Results from a new cell study at Texas Tech University Health Sciences Center, US, suggest that the SARS-CoV-2 Spike (S) protein can bring about long-term gene expression changes. The findings could help explain why some COVID-19 patients experience symptoms such as shortness of breath and dizziness long after clearing the infection, a condition known as long COVID.

“We found that exposure to the SARS-CoV-2 S protein alone was enough to change baseline gene expression in airway cells,” said Nicholas Evans, one of the researchers. “This suggests that symptoms seen in patients may initially result from the S protein interacting with the cells directly.””

https://www.drugtargetreview.com/news/90224/gene-changes-caused-by-spike-protein-could-explain-long-covid/

The study is titled “Lung Time No See”: SARS-Cov-2 Spike Protein Changes Genetic Expression in Human Primary Bronchial Epithelial Cells After Recovery” and is published in the Biochemistry and Molecular Biology section of the FASEB journal.

https://faseb.onlinelibrary.wiley.com/doi/abs/10.1096/fasebj.2021.35.S1.03097

Long Haul Covid and Long Haul Post-Vaccine Syndromes

Long haul covid or Long-COVID or COVID long-haulers according to a new review can present with as many as 55 long term symptoms. The most common of which are “fatigue (58%), headache (44%), attention disorder (27%), hair loss (25%), and dyspnea (24%)…Diseases such as stroke and diabetes mellitus were also present.” Psychiatric problems like dementia and insomnia are also included. Smell and taste deficiency may persist as also cough and lung abnormalities. Autoimmune problems where the body fights itself is also part of this plethora of presentations. Weight loss, palpitations, renal failure, mood disorders, throat pain and sputum, myocarditis, arrhythmia, OCD, intermittent fever, digestive problems are some more.

These same symptoms as well as symptoms of acute covid infection are now reported months after being vaccinated according to Dr. Bruce Patterson, a pioneer in figuring out Covid and Long haul syndromes.

The precise cause of Long-COVID and Long-Post-Vaccine is being investigated but it may be due to organ damage or persistent autoimmune or inflammatory damage after the infection. Another recent study found Epstein Bar virus reactivated in 73% of long haulers and blamed this for the chronic fatigue, raynaud’s phenomenon and other related symptoms in long haulers.

“We found over 73 percent of COVID-19 patients who were experiencing long COVID symptoms were also positive for EBV reactivation.”

The long-lasting gene changes that result from spike proteins as discovered by Texas Tech University may well be the culprits in these prolonged syndromes.

Watch Dr. Patterson Discuss Long Haul Post-Vaccine Syndrome on Dr. Bean

Video culled from https://www.youtube.com/watch?v=JwjJs5ZHKJI&t=1210s @ 20mins

Dr. Thomas E. Levy, MD, JD writes in OrthoMolecular that “depending on the cell types to which such spike proteins bind, a wide variety of diseases with autoimmune qualities can result.” He recommends treating both syndromes the same way with Vitamin C, Ivermectin, Quercetin and other agents.

“long-haul COVID syndrome likely represents a low-grade unresolved smoldering COVID infection with the same kind of spike protein persistence and clinical impact as is seen in many individuals after their COVID vaccinations (Mendelson et al., 2020; Aucott and Rebman, 2021; Raveendran, 2021).”

http://orthomolecular.org/resources/omns/v17n15.shtml

He further postulates an effect of the spike protein on the ACE2 receptor which has roles in essential pathways that protect blood vessels and other vital physiological processes.

“By itself, the disruption of ACE2 receptor function in so many areas of the body has resulted in an array of different side effects (Ashraf et al., 2021).” Dr Levy writes.

Salk researchers earlier in April found that the spike protein was dangerous to blood vessels by itself, their investigations “proving that the spike protein alone was enough to cause disease.”

Texas Tech University described the dangerous gene-modifying effects of the spike protein as being long-lived and leading to genetic inflammatory changes even after exposure.

“The researchers found that cultured human airway cells exposed to both low and high concentrations of purified S protein showed differences in gene expression that remained even after the cells recovered from the exposure. The top genes included ones related to inflammatory response.”

The study researcher, Nicholas Evans, et al. Concluded:

“Our preliminary results suggest that the SARS-CoV-2 spike protein is enough to change the baseline protein expression in primary HBECs. After recovery, genes related to immune response retained changes in gene expression, and these may indicate relevant long-term effects in asymptomatic patients. Additionally, the interplay between immune response and other pathways after SARS-CoV-2 spike protein exposure should be investigated in the future.”

NewsRescue experts opine: “It is plausible that candidates with lower immunities face more adverse reactions and are on greater risk of Long haul post-vaccine syndrome because it takes longer for their immune system to kick off and wash out the spike proteins produced in the body post vaccine. Studies should investigate any relationship between Long haul post-vaccine and immune compromise.

“Of the various vaccines, AstraZeneca distributed in Africa and the rest of the poorer third world is the worst for many reasons including the fact that it delivers the wild-type unmodified spike protein which has the capacity to transform to the ‘post-fusion’ state and enter the cell and as such has the potential to cause more gene modification or other side effects.”

Animal studies have found toxic effects of spike proteins.

“…those animal studies where Spike protein was produced by a pseudovirus, or the S1 subunit was administered directly. Both of these caused pathology in the animals all by itself, without coronavirus itself being present.”

https://blogs.sciencemag.org/pipeline/archives/2021/06/15/the-novavax-vaccine-data-and-spike-proteins-in-general

Vaccine Technology and the Spike Protein

All current vaccines introduce the spike protein in the recipient. Oxford/AstraZeneca and Janssen (Johnson and Johnson) use ‘vectors’, J&J uses adenovirus type 26 (Ad26) as its vector, while AstraZeneca uses a chimpanzee adenovirus to introduce the spike protein. Moderna, Pfizer/BioNTech vaccines introduce mRNA which is a sort of pre-protein. This mRNA is then read by your cells and translated into S1 and modified spike proteins.

While Oxford/AZ introduces the same exact spike protein the virus uses, Moderna, Pfizer/BioNTech and J&J make the body produce a modified spike protein which has the addition of two amino acids (these are the building blocks of proteins), which modify the spike protein so it stays stuck in the ‘pre-fusion’ state and does not switch to the ‘post-fusion’ state which can penetrate the cell.

– Read more: https://newsrescue.com/long-haul-post-vaxx-syndrome/

Certainly more studies shall continue to help humanity deal with these complex new long haul syndromes and to completely reverse the effects of the possible gene modification as reported.