Worse Than the Disease? Reviewing Some Possible Unintended Consequences of the mRNA Vaccines Against COVID-19

Authors: Stephanie Seneff Computer Science and Artificial Intelligence Laboratory, MIT, Cambridge MA, 02139, USA, Greg Nigh Naturopathic Oncology, Immersion Health, Portland, OR 97214, USA International Journal of Vaccine Theory, Practice, and Research

Abstract

Operation Warp Speed brought to market in the United States two mRNA vaccines, produced by Pfizer and Moderna. Interim data suggested high efficacy for both of these vaccines, which helped legitimize Emergency Use Authorization (EUA) by the FDA. However, the exceptionally rapid movement of these vaccines through controlled trials and into mass deployment raises multiple safety concerns. In this review we first describe the technology underlying these vaccines in detail. We then review both components of and the intended biological response to these vaccines, including production of the spike protein itself, and their potential relationship to a wide range of both acute and long-term induced pathologies, such as blood disorders, neurodegenerative diseases and autoimmune diseases. Among these potential induced pathologies, we discuss the relevance of prion-protein-related amino acid sequences within the spike protein. We also present a brief review of studies supporting the potential for spike protein “shedding”, transmission of the protein from a vaccinated to an unvaccinated person, resulting in symptoms induced in the latter. We finish by addressing a common point of debate, namely, whether or not these vaccines could modify the DNA of those receiving the vaccination. While there are no studies demonstrating definitively that this is happening, we provide a plausible scenario, supported by previously established pathways for transformation and transport of genetic material, whereby injected mRNA could ultimately be incorporated into germ cell DNA for transgenerational transmission. We conclude with our recommendations regarding surveillance that will help to clarify the long-term effects of these experimental drugs and allow us to better assess the true risk/benefit ratio of these novel technologies.

Extensive thrombosis after COVID-19 vaccine: cause or coincidence

Authors: Luís Lourenço Graça ,1 Maria João Amaral ,2 Marco Serôdio,3 Beatriz Costa2

SUMMARY
A 62-year-old Caucasian female patient presented with abdominal pain, vomiting and fever 1 day after administration of COVID-19 vaccine. Bloodwork revealed anaemia and thrombocytosis. Abdominal CT angiography showed a mural thrombus at the emergence of the coeliac trunk, hepatic and splenic arteries, and extensive thrombosis of the superior and inferior mesenteric veins, splenic and portal veins, and the inferior vena cava, extending to the
left common iliac vein. The spleen displayed extensive areas of infarction. Etiological investigation included assessment of congenital coagulation disorders and acquired causes with no relevant findings. Administration of COVID-19 vaccine was considered a possible cause of the extensive multifocal thrombosis. After reviewing relevant literature, it was considered
that other causes of this event should be further investigated. Thrombosis associated with COVID-19vaccine is rare and an etiological relationship should only be considered in the appropriate context and after investigation of other, more frequent, causes.

BACKGROUND
During the COVID-19 pandemic, the pharmaceutical industry is under immense pressure to develop effective and safe vaccines, and as such clinical trials have been expedited in order to make them available to help fight this health crisis. In this context, timely communication between healthcare institutions and regulatory entities is especially important. Reports of thrombosis due to administration of these vaccines have been causing an important
discussion in the scientific community as well as social alarm. However, it is important to note that this is a rare complication and more frequent causes of extensive arterial and venous thrombosis should be considered and investigated.1

CASE PRESENTATION
A 62-year-old Caucasian female patient, with personal history of obesity (body mass index of
30kg/m2), asthma and rhinitis, presented to the emergency department with abdominal pain,
nausea, vomiting and fever (38°C) 1day after administration of the first dose of COVID-19 vaccine(from AstraZeneca). On physical examination, she presented epigastric and left iliac fossa tenderness as the only abnormal finding. The patient denied recent epistaxis and gastrointestinal or genitourinary blood loss.

INVESTIGATIONS
Blood tests revealed microcytic hypochromic anemia (hemoglobin 7g/L), thrombocytosis (780×109/L),increased levels of inflammatory parameters (leucocytes 13×109/L; C reactive protein 31.07mg/dL) and slightly increased levels of liver enzymes and function (AST 36, ALP 126U/L, GGT 72U/L, LDH 441U/L, total bilirubin 1.3mg/dL, direct bilirubin 0.5mg/dL). The patient was tested for COVID-19 with nasopharyngeal PCR tests at admission and on the fifth day of hospitalization. Both tests were negative. Abdominal CT angiography (CTA) showed a mural thrombus at the emergence of the coeliac trunk, with total occlusion (figure 1), as well as at the hepatic and splenic arteries. There was also extensive thrombosis of the superior and inferior mesenteric veins and its tributaries, splenic and portal veins, including the splenoportal confluent (figure 2). There was a filiform thrombus at the distal portion of the inferior vena cava, extending to the left common iliac vein, non-occlusive (figure 3). Spleen presented extensive areas of infarction (figure 1). Coeliac trunk occlusion due to paradoxical embolism was excluded by transthoracic echocardiogram. No interatrial communication was detected. Re-evaluation CTA 5days after the diagnosis was identical. Etiological investigation included assessment of congenital coagulation disorders and acquired causes. Regarding congenital disorders, personal and family history of important thrombotic events, thrombosis in unusual sites and abortions were assessed with no relevant findings. Molecular testing for factor V Leiden mutation and prothrombin gene20210 G/A mutation were both negative. Acquired causes of a coagulation disorder, such as neoplastic, infectious and autoimmune disorders, like antiphospholipid syndrome (APS), were also investigated. Thorax, abdomen, pelvic and brain CT did not detect any suspicious lesions. Tumor biomarkers—carcinoembryonic antigen, alpha fetoprotein, carbohydrate antigen 19-9, cancer antigen 125, cancer antigen 15-3, neuron-specific enolase and chromogranin A—were negative. The patient refused to undergo upper digestive endoscopy and colonoscopy. Despite increased levels of inflammatory parameters at admission (leukocytosis and C reactive protein), these values decreased during the hospitalization period. Blood and urine cultures were also negative. Anticardiolipin IgG and IgM and antibeta-2-glycoprotein IgG and IgM were negative, excluding APS.

DIFFERENTIAL DIAGNOSIS
In the presence of venous and arterial thrombosis, the etiological investigation should include

assessment of congenital and acquired coagulation disorders, as well as the presence of interatrial communication that could explain the coeliac trunk occlusion due to paradoxical embolism. As previously stated, these etiological factors were assessed with no specific findings, with the exception of digestive endoscopic study, which was refused by the patient. In this context, and given the fact that the presentation took place 1day after administration of the first dose of COVID-19 vaccine, we hypothesize that the vaccine might be the cause of the extensive arterial and venous thrombosis. This case was immediately reported to INFARMED, the Portuguese authority for drugs and health products. Vaccine-induced thrombotic thrombocytopenia (VITT) was also considered a differential diagnosis. However, the patient did
not present with thrombocytopenia, which is a key criteria for VITT, and therefore the presence of this syndrome was unlikely.COVID-19 tests at admission and on the fifth day of hospitalization were negative; however, she was not tested prior to the onset of the event and therefore it was not possible to exclude

recent COVID-19 infection, which may predispose to thrombosis, even during the convalescent phase.
TREATMENT
At presentation, there were no signs of organ ischemia that required revascularization procedure or intestinal resection. Considering the anemia, the patient was not a candidate for
fibrinolysis. The treatment was empiric endovenous antibiotherapy and transfusion of two units of red blood cells. Anticoagulation with low molecular weight heparin (LMWH) 1mg/kg
two times per day was initiated and maintained during hospitalisation, with monitoring of anti-Xa levels. After hospitalization,in an outpatient setting, the patient was initiated on edoxaban.

OUTCOME AND FOLLOW-UP
Re-evaluation CTA 28 days after presentation revealed a portal vein with a filiform caliber, with a cavernomatous transformation. There was only permeability of the left branch of the portal
vein, with venous collateralization in the hepatic hilum. Coeliac trunk was still occluded, with permeability of the gastroduodenal artery and the right hepatic artery, and apparent occlusion at the emergence of the left hepatic artery, although with distal repermeabilisation. Partial thrombus persisted in the lumen of the left common iliac vein and inferior infrarenal vena cava. At the follow-up consultation, 1month after discharge, the patient was clinically asymptomatic.

DISCUSSION
Venous and arterial thrombotic disorders have long been considered separate pathophysiological entities due to their anatomical differences and distinct clinical presentations. In particular, arterial thrombosis is seen largely as a phenomenon of platelet
activation, whereas venous thrombosis is mostly a matter of activation of the clotting system.2
There is increasing evidence regarding a link between venous and arterial thromboses. These two vascular complications share several risk factors, such as age, obesity, diabetes mellitus, blood Figure 1 CT angiography arterial phase, axial image: a mural thrombus is observed at the coeliac trunk emergence, with total occlusion. Splenic parenchyma without enhancement after contrast administration can also be observed, translating to extensive infarct areas.
Figure 2 CT angiography portal phase, coronal image: portal vein thrombosis (A) extending to the splenoportal confluent (B) can be observed. Figure 3 CT angiography portal phase, coronal image: a non-occlusive filiform thrombus at the distal portion of the inferior vena cava can be observed, extending to the left common iliac vein. on April 13, 2022 by guest. Protected by copyright. http://casereports.bmj.com/ BMJ Case Rep: first published as 10.1136/bcr-2021-244878 on 16 August 2021. Downloaded from Graça LL, et al. BMJ Case Rep 2021;14:e244878. doi:10.1136/bcr-2021-244878 3

Case report hypertension, hypertriglyceridaemia and metabolic syndrome.3 Moreover, there are many examples of conditions accounting for both venous and arterial thromboses, such as APS, hyperhomocysteinaemia, malignancies, infections and use of hormonal treatment.3 In this case, in accordance with the literature, the patient is 62 years old and obese, with no other findings. Hyperhomocysteinaemia and digestive tract malignancies were not excluded. Recent studies have shown that patients with venous thromboembolism are at a higher risk of arterial thrombotic complications than matched control individuals. Therefore, it is speculated that
the two vascular complications may be simultaneously triggered by biological stimuli responsible for activating coagulation and inflammatory pathways in both the arterial and the venous system.3 The modified adenovirus vector COVID-19 vaccines (ChAdOx1nCoV-19 by Oxford/AstraZeneca and Ad26.COV2.S by Johnson & Johnson/Janssen) and mRNA-based COVID-19 vaccines(BNT162b2 mRNA by Pfizer/BioNTech and mRNA-1273 by Moderna) have shown both safety and efficacy against COVID-19 in phase III clinical trials and are now being used in global vaccination programmes.4Rare cases of postvaccine-associated cerebral venous thrombosis(CVT) from use of COVID-19 vaccines which use a viral vector, including the mechanism of VITT, have emerged in real-worldvaccination.4 On the other hand, the incidence and pathogenesis of CVT after mRNA COVID-19 vaccines remain unknown. However Fan et al4
presented three cases and Dias et al5reported two cases of CVT in patients who took an mRNA vaccine (BNT162b2 mRNA by Pfizer/BioNTech). In both cases, causality has not been proven.
In a recent editorial, three independent descriptions of persons with a newly described syndrome, VITT, were highlighted, characterized by thrombosis and thrombocytopenia that developed 5–24 days after initial vaccination with ChAdOx1 nCoV-19 (AstraZeneca), a recombinant adenoviral vector encoding the spike protein of SARS-CoV-2.6VITT is also characterized by the presence of CVT, thrombosis in the portal, splanchnic and hepatic veins, as well as acute arterial thromboses, platelet counts of 20–30×109 /L, high levels of D-dimers and low levels of fibrinogen, suggesting systemic activation of coagulation.6 In our case, similarities were found with VITT regarding thrombosis in the portal, splanchnic and hepatic veins, as well as acute arterial thromboses and high levels of D-dimers. On the other hand, timing of the event (1day after vaccination), high levels of fibrinogen and absence of thrombocytopenia, which is a key criteria for VITT, point to a different direction. Moreover, the
presence of thrombocytosis allowed for a safe use of LMWH for anticoagulation, with monitoring of anti-Xa levels. Most of the cases reported so far of venous and arterial thrombosis as a complication of AstraZeneca’s COVID-19 vaccine have occurred in women under the age of 60 years, associated with thrombocytopenia, within 2weeks of receiving their first dose of the vaccine.7As for the mechanism, it is thought that the vaccine may trigger an immune response leading to an atypical heparin-induced thrombocytopenia-like disorder. In contrast with the literature, our patient presented with thrombocytosis, not thrombocytopaenia.7 Smadja et al8reported that between 13 December 2020 and
16 March 2021 (94 days), 361734967 people in the international COVID-19 vaccination data set received vaccination and795 venous and 1374 arterial thrombotic events were reported in
Vigibase on 16 March 2021. Spontaneous reports of thrombotic events are shared in 1197 for Pfizer/BioNtech’s COVID-19 vaccine,325 for Moderna’s COVID-19 vaccine and 639 for AstraZeneca’sCOVID-19 vaccine.7 The reporting rate for cases of venous (VTE) and arterial (ATE) thrombotic events during this time period among the total number of people vaccinated was 0.21 cases of thrombotic events per 1million person vaccinated-days.7For VTE and ATE, the rates were 0.075 and 0.13 cases per 1million persons vaccinated, respectively, and the timeframe between vaccinationand ATE is the same for the three vaccines (median of 2days),
although a significant difference in terms of VTE was identified between AstraZeneca’s COVID-19 vaccine (median of 6days) and both mRNA vaccines (median of 4days).8 The first paper addressing this issue was published in the New England Journal of Medicine and described 11 patients, 9 of themwomen.9 Nine patients had cerebral venous thrombosis, three had
splanchnic vein thrombosis, three had pulmonary embolism and four had other thromboses. All 11 patients, as well as another 17 for whom the researchers had blood samples, tested positive for antibodies against platelet factor 4 (PF4). These antibodies are also observed in people who develop heparin-induced thrombocytopenia. However, none of the patients had received heparin before their symptoms started.9Our patient did not present thrombocytopenia, so anti-PF4 antibodies were not tested. Thus, considering the anemia, thrombocytosis and thrombosis diagnosed 1day after the first dose ofCOVID-19 vaccine, it seems prudent to continue investigation for other causes of this event, such as hematological malignancies or others.

REFERENCES
1 Burch J, Enofe I. Acute mesenteric ischaemia secondary to portal, splenic and superior
mesenteric vein thrombosis. BMJ Case Rep 2019;12:e230145.
2 Singer DE, Albers GW, Dalen JE, et al. Antithrombotic therapy in atrial fibrillation:
American College of chest physicians evidence-based clinical practice guidelines (8th
edition). Chest 2008;133:546S–92.
3 Ageno W, Becattini C, Brighton T, et al. Cardiovascular risk factors and venous
thromboembolism: a meta-analysis. Circulation 2008;117:93–102.
4 Fan BE, Shen JY, Lim XR, et al. Cerebral venous thrombosis post BNT162b2 mRNA
SARS-CoV-2 vaccination: a black Swan event. Am J Hematol 2021. doi:10.1002/
ajh.26272. [Epub ahead of print: 16 Jun 2021].
5 Dias L, Soares-Dos-Reis R, Meira J, et al. Cerebral venous thrombosis after BNT162b2
mRNA SARS-CoV-2 vaccine. J Stroke Cerebrovasc Dis 2021;30:105906.
6 Cines DB, Bussel JB. SARS-CoV-2 vaccine-induced immune thrombotic
thrombocytopenia. N Engl J Med 2021;384:2254–6.
7 AstraZeneca’s COVID-19 vaccine: EMA finds possible link to very rare cases of unusual
blood clots with low blood platelets. Available: https://www.ema.europa.eu/en/news/
astrazenecas-covid-19-vaccine-ema-finds-possible-link-very-rare-cases-unusual-bloodclots-low-blood [Accessed Apr 2021].
8 Smadja DM, Yue Q-Y, Chocron R, et al. Vaccination against COVID-19: insight from
arterial and venous thrombosis occurrence using data from VigiBase. Eur Respir J
2021;58:2100956.
9 Wise J. Covid-19: rare immune response may cause clots after AstraZeneca vaccine, say
researchers. BMJ 2021;373:n954.

Intestinal Damage in COVID-19: SARS-CoV-2 Infection and Intestinal Thrombosis

Authors: Xiaoming Wu1Haijiao Jing1Chengyue Wang1Yufeng Wang1Nan Zuo1Tao Jiang2*Valerie A. Novakovic3 and Jialan Shi1,3,4* Front. Microbiol., 22 March 2022 | https://doi.org/10.3389/fmicb.2022.860931

The intestinal tract, with high expression of angiotensin-converting enzyme 2 (ACE2), is a major site of extrapulmonary infection in COVID-19. During pulmonary infection, the virus enters the bloodstream forming viremia, which infects and damages extrapulmonary organs. Uncontrolled viral infection induces cytokine storm and promotes a hypercoagulable state, leading to systemic microthrombi. Both viral infection and microthrombi can damage the gut–blood barrier, resulting in malabsorption, malnutrition, and intestinal flora entering the blood, ultimately increasing disease severity and mortality. Early prophylactic antithrombotic therapy can prevent these damages, thereby reducing mortality. In this review, we discuss the effects of SARS-CoV-2 infection and intestinal thrombosis on intestinal injury and disease severity, as well as corresponding treatment strategies.

Introduction

COVID-19 has become a worldwide pandemic causing widespread illness and mortality. SARS-CoV-2 mainly infects the respiratory tract through attachment to angiotensin-converting enzyme 2 (ACE2) receptors (Lan et al., 2020). ACE2 is also highly expressed on intestinal epithelial cells, allowing SARS-CoV-2 to infect the intestinal tract (Xiao et al., 2020a). Recent meta-analyses show that 48%–54% of fecal samples from COVID-19 patients have tested positive for viral RNA, and 15%–17% of patients have gastrointestinal (GI) symptoms (Cheung et al., 2020Mao et al., 2020Sultan et al., 2020). Additionally, live virus can be isolated from fecal samples of COVID-19 patients (Wang et al., 2020). Some studies have proposed fecal–oral transmission as the cause of intestinal infection (Guo et al., 2021). However, direct evidence for fecal–oral transmission is still lacking. Meanwhile, the virus has been detected in the blood of both symptomatic and asymptomatic patients (Chang et al., 2020), and disseminated virus could infect extrapulmonary organs (Jacobs and Mellors, 2020). Thus, the potential that intestinal infection occurs via blood transmission should be carefully considered.

Pulmonary infection triggers cytokine storm and induces a prothrombotic state (McFadyen et al., 2020Moore and June, 2020). Venous and arterial thrombosis are common in COVID-19 (Moore and June, 2020). Systematic reviews estimate that 14%–31% of in-hospital patients develop a clinically apparent thrombotic event (Suh et al., 2021Tan et al., 2021), while autopsy reports show a high prevalence of microthrombi in multiple organs, including lung, heart, liver, kidney, and gastrointestinal tract (Bradley et al., 2020Polak et al., 2020). A cohort study showed that COVID-19 patients with intestinal ischemia had markedly elevated D-dimer levels and poor outcomes (Norsa et al., 2020). Additionally, recent studies have shown that mesenteric thrombosis often results in intestinal resection and significantly increases mortality (Bhayana et al., 2020El Moheb et al., 2020). Therefore, it is essential to outline the mechanisms of intestinal thrombosis and its contribution to intestinal damage and disease progression.

In this review, we discuss blood transmission as a potential route for intestinal infection. We then summarize the characteristics and mechanism of intestinal thrombosis formation in COVID-19. Next, we focus on the effects of intestinal infection and thrombosis on intestinal damage and disease severity. Finally, we discuss therapeutic strategies to prevent intestinal damage.

Gastrointestinal Symptoms and SARS-CoV-2 Infection

Multiple studies have reported GI symptoms in COVID-19 patients, including diarrhea, nausea, vomiting, anorexia, and abdominal pain (Cheung et al., 2020Mao et al., 2020Sultan et al., 2020). According to a meta-analysis comprising 10,890 COVID-19 patients, the pooled prevalence estimates of GI symptoms were: diarrhea (7.7%), nausea or vomiting (7.8%), and abdominal pain (2.7%; Sultan et al., 2020) with 10% of these patients reporting GI symptoms as being their initial symptoms (Cheung et al., 2020). These data indicate potential gastrointestinal infection by SARS-CoV-2, which is reported to infect and replicate in epithelial cells of human small intestinal organoids (Zang et al., 2020). Both viral nucleocapsid proteins and viral particles have been detected in infected patient intestinal biopsies (Livanos et al., 2021). Additionally, SARS-CoV-2 RNA and live virus can be found in the stool of patients (Wang et al., 2020). More importantly, SARS-CoV-2 subgenomic mRNA is transcribed in actively replicating cells and has been detected in fecal samples (Wölfel et al., 2020). Further, rectal viral shedding persists for longer than that of the respiratory system (Zhao et al., 2020). All these data demonstrate that SARS-CoV-2 directly infects and replicates in intestinal epithelial cells of patients.

Intestinal Infection and Transmission Routes

With the deepening understanding of COVID-19, GI symptoms have been recognized as early signs of the disease. The high expression of ACE2 in the GI tract, isolation of live virus from fecal samples, and a subset of patients presenting with only GI symptoms seem to suggest fecal–oral transmission. However, problems with the feasibility of this mode of transmission remain. First, studies have shown that SARS-CoV-2 loses infectivity in simulated gastric acid within 10 min (Chan et al., 2020Zang et al., 2020Zhong et al., 2020). Secondly, SARS-CoV-2, as an enveloped virus, is largely unable to withstand the detergent effect of bile salts and the activity of digestive enzymes in the duodenum (Figure 1). Although some studies have suggested that highly viscous mucus in the gastrointestinal tract protects SARS-CoV-2, allowing the virus to retain its infectivity (Guo et al., 2021Zhang H. et al., 2021), there is still a lack of direct evidence. Bushman et al. (2019) had previously investigated the links between the structures of viruses and routes of transmission and found a strong association between fecal–oral transmission and the absence of a lipid envelope. Lastly, although some studies have isolated intact viruses from feces (Wang et al., 2020Zhang Y. et al., 2020Zhou et al., 2020Xiao et al., 2020b), most of them have not further confirmed the infectivity of these viruses (Wang et al., 2020Zhang Y. et al., 2020Xiao et al., 2020b). Zhou et al. (2020) confirmed viral propagation by RT-PCR, but only in a single fecal sample. Previous research has shown that SARS-CoV-2 is completely inactivated in simulated human colonic fluid over the course of 24 h, which may explain the sporadic detection of infection-active SARS-CoV-2 from feces samples.FIGURE 1

Figure 1. Intestinal infection and transmission routes. ① Direct evidence for fecal–oral transmission is still lacking. SARS-CoV-2 may be unable to enter the small intestine from the stomach due to gastric acid, bile and digestive enzymes. ② SARS-CoV-2 released from type II alveolar cells infects alveolar capillary endothelial cells (ECs). The virus replicates in ECs and is released into the blood to form viremia. ③ SARS-CoV-2 is released from infected ciliary cells of the nasal cavity and breaks through the basement membrane, infecting the vascular ECs and eventually entering circulation. ④ Blood transmission after alveolar or nasal infection is a potential route of intestinal infection. Eventually, SARS-CoV-2 is released into the gut and infects surrounding intestinal epithelial cells along the intestinal tract. ⑤ SARS-CoV-2 in the gut can also enter the capillaries and cause viremia, leading to recurrence of disease.

Several lines of evidence suggest that SARS-CoV-2 may infect the intestinal tract via the bloodstream. Deng et al. (2020) detected SARS-CoV-2 RNA in anal swabs from intratracheally but not intragastrically infected rhesus macaques, suggesting blood transmission. Indeed, SARS-CoV-2 RNA has been detected in blood and urine samples of patients (Wang et al., 2020). The virus can also be detected in multiple organs (including heart, brain, and kidney) and is associated with organ injury, indicating that the virus can reach and infect extrapulmonary organs (Puelles et al., 2020). Another study showed that SARS-CoV-2 viremia was associated with intestinal damage, independent of disease severity (Li Y. et al., 2021). Thus, blood transmission could be the cause of intestinal infection. Specifically, SARS-CoV-2 replicating in alveolar epithelial cells and capillary ECs is released into the bloodstream and infects new vascular ECs. The capillary network is then the main route by which the virus enters and infects extrapulmonary organs. The extensive surface area of intestinal capillaries makes intestinal epithelial cells more susceptible to infection than other extrapulmonary organs. Following infection of intestinal capillaries, SARS-CoV-2 is released into the gut and infects surrounding intestinal epithelial cells along the intestinal tract (Figure 1). Once established in the gut, SARS-CoV-2 can also reenter the capillaries, potentially leading to recurrence of disease. Consistent with this, in patients who experienced recurrence, the phylogenetic analysis of infection samples has shown that recurrent virus evolves from the original parent virus (Hu et al., 2020).

Additionally, SARS-CoV-2 RNA can also be detected in the blood and urine of asymptomatic patients, suggesting a second pathway to viremia through the nasal cavity (Chang et al., 2020Hasanoglu et al., 2021). The abundant blood vessels, thin mucous membrane, and higher levels of ACE2 (Huang et al., 2021) make it possible for the virus to initiate viremia from the nasal cavity. Specifically, SARS-CoV-2 is released from infected ciliary cells of the nasal cavity and breaks through the basement membrane, infecting the vascular ECs and eventually entering circulation (Figure 1). Blood transmission after nasal infection is therefore another potential route of intestinal infection.

Intestinal Damage, Malnutrition, and Poor Outcomes

A recent study has shown that a fecal sample positive for SARS-CoV-2 RNA at any time during hospitalization was associated with higher mortality [HR: 3.4 (1.2–9.9); Das Adhikari et al., 2021]. Similarly, another study showed that small-bowel thickening on CT was strongly associated with ICU admission (Wölfel et al., 2020). This relationship did not hold for colon or rectal thickening. These data indicates that small-bowel damage contributes to poor outcomes. As the main organ for nutrient absorption, damage to the small intestine will result in malabsorption and malnutrition, both of which commonly occur in COVID-19 patients (Di Filippo et al., 2021Lv et al., 2021) and are associated with disease severity (Luo et al., 2020Zhang P. et al., 2021). A fecal metabolome study showed that feces of COVID-19 patients were enriched with important nutrients that should be metabolized or absorbed, consistent with malabsorption (Lv et al., 2021). A prospective study showed that 29% of COVID-19 patients (31% of hospitalization patients and 21% of patients quarantined at home) had lost >5% of body weight [median weight loss, 6.5 (5.0–9.0) kg or 8.1 (6.1–10.9) %; Di Filippo et al., 2021]. Those patients with weight loss had greater systemic inflammation, impaired renal function and longer disease duration. A large, multicenter study (including 3,229 patients with GI symptoms) showed that 23% of patients had malnutrition, of whom 56.4% were unable to gain weight after 6 months follow-up (Rizvi et al., 2021). Studies also showed that malnutrition was associated with higher incidences of acute respiratory distress syndrome, acute myocardial injury, secondary infection, shock, and 28-day ICU mortality (Luo et al., 2020Zhang P. et al., 2021). Overall, malabsorption and malnutrition due to damaged small intestine increased disease severity and mortality.

Nutrient absorption in the small intestine is mainly through ATP-dependent active transport. Intestinal infection, hypoxemia, and intestinal ischemia contribute to malabsorption. SARS-CoV-2 adhesion depletes ACE2 levels on intestinal epithelial cells, which alters the expression of the neutral amino acid transporter B0AT1, reducing the intake of tryptophan and the production of nicotinamide (D’Amico et al., 2020). Meanwhile, uncontrolled viral replication consumes large amounts of ATP and nutrients, resulting in decreased nutrients entering the bloodstream. More importantly, anaerobic glycolysis caused by hypoxemia and intestinal ischemia significantly decreases ATP and active transport, leading to malabsorption. Additionally, hypoxemia and intestinal ischemia can also cause anorexia, nausea, vomiting, and enteral nutrition intolerance, reducing food intake. A prospective multicenter study showed that reduced food intake was associated with higher ICU admission and mortality (Caccialanza et al., 2021).

Intestinal Ischemia and Thrombosis

Intestinal ischemia is a common manifestation in COVID-19 patients. Autopsy results have shown that 31.6% of deceased patients had focal ischemic intestinal changes (Chiu et al., 2020). In a separate imaging study, bowel wall thickening and pneumatosis intestinalis, which indicate intestinal ischemia, were found on 38.1% (16 of 42) of abdominal CT images (Bhayana et al., 2020). Of these, 4 (9.5%) patients with pneumatosis intestinalis developed severe intestinal necrosis and needed resection. In another cohort study, 55.8% (58/104) of ICU patients developed an ileus (Kaafarani et al., 2020). Although mechanical factors cannot be ruled out, insufficient intestinal motility due to intestinal ischemia was more likely to be the cause of ileus in COVID-19 patients. In these patients with ileus, 4 (3.8%) developed severe intestinal ischemia and require emergency surgery. Both studies found microthrombi in these resected intestinal samples, which were the main cause of intestinal ischemia and increased mortality.

Additional intestinal ischemia and necrosis follows the formation of mesenteric thrombosis. However, there is currently relatively little data of mesenteric thrombus in COVID-19. Therefore, we have summarized the characteristics of 40 patients in 39 case reports published on PubMed (Supplementary Table 1). The median age of these patients was 50 (20–82) years, 26 (65%) were male, 38 (95%) developed bowel ischemia or necrosis, 30 (75%) needed bowel resection, 7 (17.5%) required no surgery, at least 3 (7.5%) developed sepsis, and 13 (32.5%) died. Other abdominal thrombotic events (such as celiac aortic thrombosis) leading to mesenteric ischemia can also result in severe intestinal necrosis and require intestinal resection (Zamboni et al., 2021).

Mild intestinal ischemia can lead to reduced diet and malabsorption. Severe intestinal ischemia or necrosis leads to the dissemination of gut bacteria, endotoxins, and microbial metabolites into the blood (Figure 2 bottom), aggravating hyperinflammation and the hypercoagulability state. Such patients need emergency excision of the necrotic bowel, which significantly increases mortality.FIGURE 2

Figure 2. Intestinal thrombosis leads to intestinal mucosal necrosis and dissemination of gut bacteria, endotoxins, and microbial metabolites in blood. (Top) Mesenteric vascular endotheliitis (initiated by viremia and accelerated by cytokines), hyperactivated platelets and high levels of phosphatidylserine (PS) promote a high rate of mesenteric thrombus in COVID-19 patients (mesenteric vein is shown in Supplementary Figure 1). (Bottom) Intestinal microthrombi and hypoxemia rapidly lead to intestinal mucosal ischemia and necrosis. The damaged gut–blood barrier leads to dissemination of gut bacteria, endotoxins, and microbial metabolites in blood.

Long-Term Gastrointestinal Sequelae

Long-term GI complications are common in recovering COVID-19 patients. In one systematic review of post-acute COVID-19 manifestations, diarrhea was among the top 10 most common complaints, with a prevalence of 6%. Other long-term GI symptoms include nausea, vomiting, abdominal pain, loss of appetite, and weight loss (Aiyegbusi et al., 2021Huang et al., 2021). The exact mechanisms of the GI sequelae remain unclear. Recently, persistent endotheliopathy, higher levels of thrombin (Fogarty et al., 2021), and residual SARS-CoV-2 viral antigens in the GI tract (Cheung et al., 2022) were described in convalescent COVID-19 patients. These data suggest that prolonged intestinal infection, persistent endothelial injury (abnormal intestinal–blood barrier), and microthrombi could be causes of the persistent GI symptoms.

The Mechanisms of Intestinal Thrombosis

Damaged Endothelial Cells

Resected bowel samples from COVID-19 patients routinely exhibit thrombi and endotheliitis, indicating the important role of EC injury in mesenteric thrombosis (Bhayana et al., 2020Chiu et al., 2020Kaafarani et al., 2020). SARS-CoV-2 infection (Varga et al., 2020) and elevated inflammatory cytokines (He et al., 2016) damage mesenteric vascular ECs. In response, EC cell margins retract, extending phosphatidylserine (PS) positive filopods and releasing endothelial microparticles (MPs; Figure 3BHe et al., 2016). The PS+ filopods and MPs can be co-stained by Xa and Va and support fibrin formation (Figures 3BD). The exposed PS then activates tissue factor on ECs, triggering the extrinsic coagulation pathway (Versteeg et al., 2013). Next, higher levels of FVIII and vWF released from damaged EC contribute to the hypercoagulable state and platelet aggregation, respectively (Goshua et al., 2020). Thrombomodulin is then released from ECs in its soluble form, which has an attenuated capacity to activate Protein C due to a lack of other cofactors on ECs, such as endothelial protein C receptor (Versteeg et al., 2013). Finally, upregulation of endothelial cell adhesion molecules recruits neutrophils and platelets and further contributes to thrombosis (Tong et al., 2020Li L. et al., 2021).FIGURE 3

Figure 3. Phosphatidylserine exposure on activated/apoptotic cells and microparticles (MPs) promotes fibrin formation. (A) Phosphatidylserine is usually confined to the inner leaflet of the cell membrane. This asymmetry is maintained through ATP-dependent inward transport of PS by flippases and outward transport of non-PS by floppases (left). Upon stimulation, calcium transients will inhibit ATP-dependent transport and stimulate the nonselective lipid transporter scramblase (ATP-independent), resulting in PS exposure (right). (B–D) Human umbilical vein ECs were treated with healthy human plasma and TNF-ɑ (our previous study; He et al., 2016). (B) ECs retracts the cell margins, extends PS positive filopods and releases endothelial-MPs. (C) The PS+ filopods and MPs can be co-stained by Xa and Va. (D) ECs (green) were incubated with MPs-depleted plasma (MDP) in the presence of calcium for 30 min and stained with Alexa Fluro 647-anti-fibrin for 30 min. Considerable fibrin stands among cultured ECs along with filopodia. (E) Confocal images showed PS expression on platelets of patients stained with Alexa 488 lactadherin (our previous study; Ma et al., 2017). MPs from the activated platelet (*) had formed at the margin area located between the distinct outlines. (F) MPs from plasma were co-stained by Xa and Va (or lactadherin and annexin V; our previous study; Gao et al., 2015). (G) MPs that were incubated with recalcified MDP for 30 min and stained with Alexa Fluro 647-anti-fibrin for 30 min. Converted fibrin networks were detected around MPs. The inset bars represent 5 μm in (B–D,G) and 2 μm in (E,F).

Hyperactivated Platelets and Phosphatidylserine Storm

Although COVID-19 patients exhibit mild thrombocytopenia, the remaining platelets are hyperactivated (Manne et al., 2020Taus et al., 2020Zaid et al., 2020). Studies have shown that platelets from COVID-19 patients have increased P-selectin and αIIbβ3 expression. P-selectin on activated platelets interacts with integrin αIIb3 on monocytes to form platelet-monocyte complexes, which induce monocyte tissue factor expression (Hottz et al., 2020). The activated platelets can also induce neutrophils to release neutrophil extracellular traps (NETs; Middleton et al., 2020). Furthermore, platelets from COVID-19 patients aggregate and adhere more efficiently to collagen-coated surfaces under flow conditions (Manne et al., 2020Zaid et al., 2020). Meanwhile, activated platelets release α- and dense-granule contents including FV, FXI, fibrinogen and vWF (Zaid et al., 2020). In addition, activated platelets also produce inflammatory cytokines, fueling cytokine storm (Taus et al., 2020Zaid et al., 2020). Most importantly, activated platelets expose higher levels of PS and release higher numbers of PS+ MPs (Figures 3EGZaid et al., 2020Althaus et al., 2021).

Phosphatidylserine is the most abundant negatively charged phospholipid in mammalian cells and is usually confined to the inner leaflet of the cell membrane (Versteeg et al., 2013). This asymmetry is maintained through ATP-dependent inward transport of PS by flippases and outward transport of other phospholipids by floppases (Figure 3A left). Upon stimulation, transiently increased calcium inhibits ATP-dependent transport and stimulates the nonselective lipid transporter scramblase (ATP-independent), resulting in PS exposure on the outer membrane (Figure 3A right). During this process, microvesicles derived from the budding of cellular membranes will be released. These MPs are typically <1 μm and express PS (Burnier et al., 2009). The exposure of PS on the surface of cells and MPs provides a catalytic surface for factor Xa and thrombin formation in vivo (Versteeg et al., 2013). We have previously demonstrated that PS mediates 90% of Xa and thrombin formation and significantly increases thrombosis in vivo (Shi and Gilbert, 2003).

Cytokines and virus infection can activate blood cells and ECs, resulting in higher levels of PS+ cells and MPs. As COVID-19 progresses, the developing cytokine storm activates more blood cells, leading to PS storm. Platelets are highly sensitive to circulating cytokines, releasing large amounts of cytokines and PS exposed MPs into the plasma (Taus et al., 2020Althaus et al., 2021) and thus are a major contributor to PS storm. Previous studies found an unusual elevation of FVa in severe COVID-19 patients (248 IU/dl, higher than any previous disease; Stefely et al., 2020von Meijenfeldt et al., 2021). The degree of FVa elevation in these patients may be the result of PS storm.

Collectively, SARS-CoV-2 infection is the initiating factor for injury of the intestinal vascular ECs, which is then aggravated by systemic cytokines, leading to endotheliitis. Subsequently, the hyperactivated platelets in circulation rapidly accumulate around the damaged ECs, inducing tissue factor expression, NET release, and activating the intrinsic/extrinsic coagulation pathways. Simultaneously, the high levels of PS expression in circulating cells and MPs further promote thrombin and fibrin formation (Figure 2 top).

Early Antithrombotic Treatment

Vaccines and antithrombotic therapy are effective measures to reduce intestinal damage and fight against the COVID-19 pandemic (Baden et al., 2021Chalmers et al., 2021). Vaccines induce adaptive immunity to clear the virus, reducing intestinal infection and intestinal damage. However, the usefulness of vaccines is limited by incomplete vaccine acceptance and viral mutations (Hacisuleyman et al., 2021Wang et al., 2021). Vaccines are also ineffective for already infected patients. Therefore, more attention should be paid to antithrombotic therapy. Studies had shown that thrombotic events mainly occurred within 7 days of COVID-19 diagnosis (both inpatients and outpatients; Mouhat et al., 2020Ho et al., 2021). Meanwhile, two large randomized controlled trials (RCTs) from the same platform showed that therapeutic anticoagulation reduced mortality in moderate cases but not in severe ones, suggesting that delayed anticoagulant therapy may lead to treatment failure (REMAP-CAP Investigators et al., 2021a,b). More importantly, a recent study reported three asymptomatic COVID-19 patients who developed abdominal (or intestinal) thrombosis leading to intestinal necrosis (Zamboni et al., 2021). All these data suggest that antithrombotic therapy should be initiated once COVID-19 is diagnosed (excluding patients with contraindications). Early prophylactic antithrombotic therapy can reduce the activation of vascular ECs and blood cells, preventing intestinal thrombosis, ensuring sufficient intestinal perfusion, maintaining the normal gut–blood barrier, avoiding malabsorption, malnutrition, and intestinal flora entering the bloodstream. Further, attenuated injury and decreased microthrombi in convalescent patients may lower the risk of long-term GI sequelae. Meanwhile, unobstructed systemic circulation can also accelerate the removal of SARS-CoV-2, inflammatory cytokines and damaged blood cells by the mononuclear phagocyte system.

Anticoagulation

Table 1 summarizes the RCTs of anticoagulant therapy in COVID-19 patients. For outpatients, early anticoagulant therapy reduced hospitalization and supplemental oxygen (Gonzalez-Ochoa). While, delayed treatment had no similar effect (ACTIV-4B and Ananworanich). Thus, oral anticoagulant therapy should be initiated in outpatients once COVID-19 is diagnosed. For non-critically ill patients, therapeutic doses of low molecular weight heparin (LMWH) reduced thrombotic events and mortality, and increased organ support-free days (REMAP-CAP, ACTIV-4a, ATTACC; RAPID; HEP-COVID). However, therapeutic doses of rivaroxaban did not improve clinical outcomes and increased bleeding (ACTION). This is potentially because novel oral anticoagulants do not share the anti-inflammatory and antiviral functions of heparin. Intestinal damage might also result in abnormal absorption of oral anticoagulants. Therefore, therapeutic LMWH should be the first choice for non-critically ill patients. For critically ill patients, RCTs showed that moderate and therapeutic doses were not superior to prophylactic ones. Results from several other studies suggest that the overwhelming thrombosis leads to failure of anticoagulant therapy at therapeutic doses (Leentjens et al., 2021Poor, 2021). Faced with this dilemma, an editorial in N Engl J Med argued that profibrinolytic strategies should be considered (Ten Cate, 2021). More studies are needed to explore optimal antithrombotic therapy in critically ill patients.TABLE 1

Table 1. Randomized clinical trials of anticoagulant therapy in COVID-19 patients.

Inhibition of Platelet Activation

As COVID-19 progresses, cytokine storm activates platelets, which not only participate in primary hemostasis, but also are the major components of PS storm. Autopsy results show a high prevalence of platelet-fibrin-rich microthrombi in lung and extrapulmonary organs, including the gastrointestinal tract (Bradley et al., 2020Polak et al., 2020). Early inhibition of platelet activation can reduce platelet activity and prevent PS storm, thus decreasing thrombosis and mortality. Several observational studies have shown that aspirin decreases mechanical ventilation, ICU admission, and mortality (Chow et al., 2020Santoro et al., 2022). The RCTs testing antiplatelet agents were still preliminary. A recent RCT suggested that aspirin was associated with an increase in survival and reduction in thrombotic events (RECOVERY Collaborative Group, 2022). In addition, anti-inflammatory therapy (e.g., dexamethasone, 6 mg once daily; RECOVERY Collaborative Group et al., 2020) inhibits cytokine storm, as well as platelet activation, reducing mortality. Overall, inhibition of platelet activation is also important to reduce mortality through the prevention of thrombosis and organs damage.

Factors Influencing Antithrombotic Treatment

Thrombotic Risk Factors or Co-morbidities

Studies have shown that obesity, hyperglycemia and diabetes are associated with increased thrombotic events (including intestinal thrombosis), COVID-19 severity, and mortality (Drucker, 2021Stefan et al., 2021). Other thrombotic risk factors include previous venous thromboembolism, active cancer, known thrombophilic condition, recent trauma or surgery, age ≥70 years, respiratory/cardiac/renal failure, and inflammatory bowel disease (Susen et al., 2020). These factors or co-morbidities heighten basal inflammatory levels and endothelial damage, leading to premature cytokine and PS storms, ultimately increasing thrombosis and mortality. Thus, more active antithrombotic therapy strategies should be adopted in these patients. For patients with mild COVID-19 with these factors, the French Working Group on Perioperative Hemostasis and the French Study Group on Thrombosis and Hemostasis recommend higher (intermediate) doses of anticoagulant therapy (Susen et al., 2020). For moderately ill patients, therapeutic doses of anticoagulant therapy should be initiated as soon as possible to prevent excessive microthrombus formation. The need for extended thromboprophylaxis in discharged patients remains controversial. However, a recent RCT showed that rivaroxaban (10 mg/day, 35 days) improved clinical outcomes in discharged COVID-19 patients with higher thrombotic risk factors (Ramacciotti et al., 2022), supporting extended thromboprophylaxis in patients with these risk factors or co-morbidities.

Vaccination

Although more than half the world population has received at least one dose of the vaccines, there are relatively little data of antithrombotic therapy in vaccinated patients. Studies of viral dynamics show that the viral loads of vaccinated patients are as high as that of unvaccinated patients, but drop significantly faster (Brown et al., 2021Klompas, 2021). Thus, vaccinated patients have shorter hospital stays, and are less likely to progress to critical illness and death (Tenforde et al., 2021Thompson et al., 2021). Nevertheless, antithrombotic therapy is still beneficial for the vaccinated patients. Firstly, heparin has anti-inflammatory and antiviral functions and can interfere with the binding of SARS-CoV-2 to ACE2 and shorten the duration of virus infection (Kwon et al., 2020Pereyra et al., 2021). Secondly, antithrombotic therapy protects cells from damage, PS exposure, and microthrombi formation, maintains unobstructed blood circulation, and facilitates virus clearance (by vaccine-induced adaptive immunity). Thirdly, thrombosis remains an important factor in disease progression. Antithrombotic therapy further reduces thrombosis and mortality, especially in vaccinated patients with high risk factors or co-morbidities. Lastly, although vaccines reduce the incidence, a subset of vaccinated patients will still develop long-term sequelae or Long Covid (Ledford, 2021Antonelli et al., 2022). Persistent viral infection and microthrombi are the primary causes (Ledford, 2021Xie et al., 2022), and early antithrombotic therapy is still needed to prevent them.

Conclusion and Future Research

During COVID-19 disease progression, SARS-CoV-2 infiltrates the blood stream from the initial respiratory tract infection, causing viremia, hyperactivated platelets and PS storm. The virus settles into the vascular beds of extrapulmonary organs, ultimately causing infection of intestinal epithelial cell. Damaged ECs, combined with hyperactivated platelets and PS storm, promote intestinal thrombosis, resulting in intestinal ischemia or necrosis. The damaged gut–blood barrier leads to malabsorption, malnutrition and intestinal flora entering the bloodstream, which significantly increase disease severity and mortality. Prolonged intestinal infection, persistent endothelial injury and microthrombi contribute to the long-term GI sequelae after discharge. Early prophylactic antithrombotic therapy can prevent microthrombi, ensuring sufficient intestinal perfusion, maintaining the normal intestinal function, and reducing the risk of long-term GI sequelae. More active antithrombotic therapy should be adopted in patients with other thrombotic risk factors or co-morbidities. Even in vaccinated COVID-19 patients, antithrombotic therapy is also important to decrease (intestinal) thrombosis, mortality and the risk of long-term GI sequelae.

With the Omicron pandemic, patients requiring hospitalization and ICU treatment decline rapidly. However, people are increasingly concerned about Long Covid. In terms of long-term GI sequelae, the detailed mechanisms of prolonged intestinal infection and persistent microthrombi remain unclear. And whether anticoagulant therapy can decrease GI symptoms in patients with long-term GI sequelae deserves further study. Finally, the impact of vaccines on long-term GI sequelae remains unclear in previously infected and breakthrough infected patients.

References

Aiyegbusi, O. L., Hughes, S. E., Turner, G., Rivera, S. C., McMullan, C., Chandan, J. S., et al. (2021). Symptoms, complications and management of long COVID: a review. J. R. Soc. Med. 114, 428–442. doi: 10.1177/01410768211032850

PubMed Abstract | CrossRef Full Text | Google Scholar

Althaus, K., Marini, I., Zlamal, J., Pelzl, L., Singh, A., Häberle, H., et al. (2021). Antibody-induced procoagulant platelets in severe COVID-19 infection. Blood 137, 1061–1071. doi: 10.1182/blood.2020008762

PubMed Abstract | CrossRef Full Text | Google Scholar

Ananworanich, J., Mogg, R., Dunne, M. W., Bassyouni, M., David, C. V., Gonzalez, E., et al. (2021). Randomized study of rivaroxaban vs. placebo on disease progression and symptoms resolution in high-risk adults with mild COVID-19. Clin. Infect. Dis. doi: 10.1093/cid/ciab813 [Epub ahead of print].

PubMed Abstract | CrossRef Full Text | Google Scholar

Antonelli, M., Penfold, R. S., Merino, J., Sudre, C. H., Molteni, E., Berry, S., et al. (2022). Risk factors and disease profile of post-vaccination SARS-CoV-2 infection in UK users of the COVID symptom study app: a prospective, community-based, nested, case-control study. Lancet Infect. Dis. 22, 43–55. doi: 10.1016/S1473-3099(21)00460-6

CrossRef Full Text | Google Scholar

Baden, L. R., El Sahly, H. M., Essink, B., Kotloff, K., Frey, S., Novak, R., et al. (2021). Efficacy and safety of the mRNA-1273 SARS-CoV-2 vaccine. N. Engl. J. Med. 384, 403–416. doi: 10.1056/NEJMoa2035389

CrossRef Full Text | Google Scholar

Bhayana, R., Som, A., Li, M. D., Carey, D. E., Anderson, M. A., Blake, M. A., et al. (2020). Abdominal imaging findings in COVID-19: preliminary observations. Radiology 297, E207–E215. doi: 10.1148/radiol.2020201908

PubMed Abstract | CrossRef Full Text | Google Scholar

Bradley, B. T., Maioli, H., Johnston, R., Chaudhry, I., Fink, S. L., Xu, H., et al. (2020). Histopathology and ultrastructural findings of fatal COVID-19 infections in Washington state: a case series. Lancet 396, 320–332. doi: 10.1016/S0140-6736(20)31305-2

PubMed Abstract | CrossRef Full Text | Google Scholar

Brown, C. M., Vostok, J., Johnson, H., Burns, M., Gharpure, R., Sami, S., et al. (2021). Outbreak of SARS-CoV-2 infections, including COVID-19 vaccine breakthrough infections, associated with large public gatherings – Barnstable County, Massachusetts, July 2021. MMWR Morb. Mortal. Wkly Rep. 70, 1059–1062. doi: 10.15585/mmwr.mm7031e2

PubMed Abstract | CrossRef Full Text | Google Scholar

Burnier, L., Fontana, P., Kwak, B. R., and Angelillo-Scherrer, A. (2009). Cell-derived microparticles in haemostasis and vascular medicine. Thromb. Haemost. 101, 439–451. doi: 10.1160/TH08-08-0521

CrossRef Full Text | Google Scholar

Bushman, F. D., McCormick, K., and Sherrill-Mix, S. (2019). Virus structures constrain transmission modes. Nat. Microbiol. 4, 1778–1780. doi: 10.1038/s41564-019-0523-5

PubMed Abstract | CrossRef Full Text | Google Scholar

Caccialanza, R., Formisano, E., Klersy, C., Ferretti, V., Ferrari, A., Demontis, S., et al. (2021). Nutritional parameters associated with prognosis in non-critically ill hospitalized COVID-19 patients: the NUTRI-COVID19 study. Clin. Nutr. doi: 10.1016/j.clnu.2021.06.020 [Epub ahead of print].

CrossRef Full Text | Google Scholar

Chalmers, J. D., Crichton, M. L., Goeminne, P. C., Cao, B., Humbert, M., Shteinberg, M., et al. (2021). Management of hospitalised adults with coronavirus disease 2019 (COVID-19): a European Respiratory Society living guideline. Eur. Respir. J. 57:2100048. doi: 10.1183/13993003.00048-2021

PubMed Abstract | CrossRef Full Text | Google Scholar

Chan, K. H., Sridhar, S., Zhang, R. R., Chu, H., Fung, A. Y., Chan, G., et al. (2020). Factors affecting stability and infectivity of SARS-CoV-2. J. Hosp. Infect. 106, 226–231. doi: 10.1016/j.jhin.2020.07.009

CrossRef Full Text | Google Scholar

Chang, L., Zhao, L., Gong, H., Wang, L., and Wang, L. (2020). Severe acute respiratory syndrome coronavirus 2 RNA detected in blood donations. Emerg. Infect. Dis. 26, 1631–1633. doi: 10.3201/eid2607.200839

PubMed Abstract | CrossRef Full Text | Google Scholar

Cheung, C. C. L., Goh, D., Lim, X., Tien, T. Z., Lim, J. C. T., Lee, J. N., et al. (2022). Residual SARS-CoV-2 viral antigens detected in GI and hepatic tissues from five recovered patients with COVID-19. Gut 71, 226–229. doi: 10.1136/gutjnl-2021-324280

PubMed Abstract | CrossRef Full Text | Google Scholar

Cheung, K. S., Hung, I. F. N., Chan, P. P. Y., Lung, K. C., Tso, E., Liu, R., et al. (2020). Gastrointestinal manifestations of SARS-CoV-2 infection and virus load in faecal samples from a Hong Kong cohort: systematic review and meta-analysis. Gastroenterology 159, 81–95. doi: 10.1053/j.gastro.2020.03.065

CrossRef Full Text | Google Scholar

Chiu, C. Y., Sarwal, A., Mon, A. M., Tan, Y. E., and Shah, V. (2020). Gastrointestinal: COVID-19 related ischemic bowel disease. J. Gastroenterol. Hepatol. 36:850. doi: 10.1111/jgh.15254

PubMed Abstract | CrossRef Full Text | Google Scholar

Chow, J. H., Khanna, A. K., Kethireddy, S., Yamane, D., Levine, A., Jackson, A. M., et al. (2020). Aspirin use is associated with decreased mechanical ventilation, ICU admission, and in-hospital mortality in hospitalized patients with COVID-19. Anesth. Analg. 132, 930–941. doi: 10.1213/ANE.0000000000005292

CrossRef Full Text | Google Scholar

Connors, J. M., Brooks, M. M., Sciurba, F. C., Krishnan, J. A., Bledsoe, J. R., Kindzelski, A., et al. (2021). Effect of antithrombotic therapy on clinical outcomes in outpatients with clinically stable symptomatic COVID-19: the ACTIV-4B randomized clinical trial. JAMA 326, 1703–1712. doi: 10.1001/jama.2021.17272

PubMed Abstract | CrossRef Full Text | Google Scholar

D’Amico, F., Baumgart, D. C., Danese, S., and Peyrin-Biroulet, L. (2020). Diarrhea during COVID-19 infection: pathogenesis, epidemiology, prevention, and management. Clin. Gastroenterol. Hepatol. 18, 1663–1672. doi: 10.1016/j.cgh.2020.04.001

PubMed Abstract | CrossRef Full Text | Google Scholar

Das Adhikari, U., Eng, G., Farcasanu, M., Avena, L. E., Choudhary, M. C., Triant, V. A., et al. (2021). Faecal SARS-CoV-2 RNA is associated with decreased COVID-19 survival. Clin. Infect. Dis. doi: 10.1093/cid/ciab623 Epub ahead of print

PubMed Abstract | CrossRef Full Text | Google Scholar

Deng, W., Bao, L., Gao, H., Xiang, Z., Qu, Y., Song, Z., et al. (2020). Ocular conjunctival inoculation of SARS-CoV-2 can cause mild COVID-19 in rhesus macaques. Nat. Commun. 11:4400. doi: 10.1038/s41467-020-18149-6

CrossRef Full Text | Google Scholar

Di Filippo, L., De Lorenzo, R., D’Amico, M., Sofia, V., Roveri, L., Mele, R., et al. (2021). COVID-19 is associated with clinically significant weight loss and risk of malnutrition, independent of hospitalisation: a post-hoc analysis of a prospective cohort study. Clin. Nutr. 40, 2420–2426. doi: 10.1016/j.clnu.2020.10.043

PubMed Abstract | CrossRef Full Text | Google Scholar

Drucker, D. J. (2021). Diabetes, obesity, metabolism, and SARS-CoV-2 infection: the end of the beginning. Cell Metab. 33, 479–498. doi: 10.1016/j.cmet.2021.01.016

CrossRef Full Text | Google Scholar

El Moheb, M., Naar, L., Christensen, M. A., Kapoen, C., Maurer, L. R., Farhat, M., et al. (2020). Gastrointestinal complications in critically ill patients with and without COVID-19. JAMA 324, 1899–1901. doi: 10.1001/jama.2020.19400

PubMed Abstract | CrossRef Full Text | Google Scholar

Fogarty, H., Townsend, L., Morrin, H., Ahmad, A., Comerford, C., Karampini, E., et al. (2021). Persistent endotheliopathy in the pathogenesis of long COVID syndrome. J. Thromb. Haemost. 19, 2546–2555. doi: 10.1111/jth.15490

CrossRef Full Text | Google Scholar

Gao, C., Xie, R., Yu, C., Ma, R., Dong, W., Meng, H., et al. (2015). Thrombotic role of blood and endothelial cells in uremia through phosphatidylserine exposure and microparticle release. PLoS One 10:e0142835. doi: 10.1371/journal.pone.0142835

PubMed Abstract | CrossRef Full Text | Google Scholar

Gonzalez-Ochoa, A. J., Raffetto, J. D., Hernández, A. G., Zavala, N., Gutiérrez, O., Vargas, A., et al. (2021). Sulodexide in the treatment of patients with early stages of COVID-19: a randomized controlled trial. Thromb. Haemost. 121, 944–954. doi: 10.1055/a-1414-5216

CrossRef Full Text | Google Scholar

Goshua, G., Pine, A. B., Meizlish, M. L., Chang, C. H., Zhang, H., Bahel, P., et al. (2020). Endotheliopathy in COVID-19-associated coagulopathy: evidence from a single-Centre, cross-sectional study. Lancet Haematol. 7, e575–e582. doi: 10.1016/S2352-3026(20)30216-7

CrossRef Full Text | Google Scholar

Guo, M., Tao, W., Flavell, R. A., and Zhu, S. (2021). Potential intestinal infection and faecal-oral transmission of SARS-CoV-2. Nat. Rev. Gastroenterol. Hepatol. 18, 269–283. doi: 10.1038/s41575-021-00416-6

CrossRef Full Text | Google Scholar

Hacisuleyman, E., Hale, C., Saito, Y., Blachere, N. E., Bergh, M., Conlon, E. G., et al. (2021). Vaccine breakthrough infections with SARS-CoV-2 variants. N. Engl. J. Med. 384, 2212–2218. doi: 10.1056/NEJMoa2105000

CrossRef Full Text | Google Scholar

Hasanoglu, I., Korukluoglu, G., Asilturk, D., Cosgun, Y., Kalem, A. K., Altas, A. B., et al. (2021). Higher viral loads in asymptomatic COVID-19 patients might be the invisible part of the iceberg. Infection 49, 117–126. doi: 10.1007/s15010-020-01548-8

PubMed Abstract | CrossRef Full Text | Google Scholar

He, Z., Si, Y., Jiang, T., Ma, R., Zhang, Y., Cao, M., et al. (2016). Phosphotidylserine exposure and neutrophil extracellular traps enhance procoagulant activity in patients with inflammatory bowel disease. Thromb. Haemost. 115, 738–751. doi: 10.1160/TH15-09-0710

CrossRef Full Text | Google Scholar

Ho, F. K., Man, K. K. C., Toshner, M., Church, C., Celis-Morales, C., Wong, I. C. K., et al. (2021). Thromboembolic risk in hospitalized and nonhospitalized COVID-19 patients: a self-controlled case series analysis of a nationwide cohort. Mayo Clin. Proc. 96, 2587–2597. doi: 10.1016/j.mayocp.2021.07.002

PubMed Abstract | CrossRef Full Text | Google Scholar

Hottz, E. D., Azevedo-Quintanilha, I. G., Palhinha, L., Teixeira, L., Barreto, E. A., Pão, C. R. R., et al. (2020). Platelet activation and platelet-monocyte aggregates formation trigger tissue factor expression in severe COVID-19 patients. Blood 136, 1330–1341. doi: 10.1182/blood.2020007252

PubMed Abstract | CrossRef Full Text | Google Scholar

Hu, F., Chen, F., Ou, Z., Fan, Q., Tan, X., Wang, Y., et al. (2020). A compromised specific Humoral immune response against the SARS-CoV-2 receptor-binding domain is related to viral persistence and periodic shedding in the gastrointestinal tract. Cell. Mol. Immunol. 17, 1119–1125. doi: 10.1038/s41423-020-00550-2

CrossRef Full Text | Google Scholar

Huang, N., Pérez, P., Kato, T., Mikami, Y., Okuda, K., Gilmore, R. C., et al. (2021). SARS-CoV-2 infection of the oral cavity and saliva. Nat. Med. 27, 892–903. doi: 10.1038/s41591-021-01296-8

PubMed Abstract | CrossRef Full Text | Google Scholar

INSPIRATION Investigators Sadeghipour, P., Talasaz, A. H., Rashidi, F., Sharif-Kashani, B., Beigmohammadi, M. T., et al. (2021). Effect of intermediate-dose vs. standard-dose prophylactic anticoagulation on thrombotic events, extracorporeal membrane oxygenation treatment, or mortality among patients with COVID-19 admitted to the intensive care unit: the INSPIRATION randomized clinical trial. JAMA 325, 1620–1630. doi: 10.1001/jama.2021.4152

PubMed Abstract | CrossRef Full Text | Google Scholar

Jacobs, J. L., and Mellors, J. W. (2020). Detection of SARS-CoV-2 RNA in blood of patients with COVID-19: what does it mean? Clin. Infect. Dis. doi: 10.1093/cid/ciaa1316 [Epub ahead of print].

CrossRef Full Text | Google Scholar

Kaafarani, H. M. A., El Moheb, M., Hwabejire, J. O., Naar, L., Christensen, M. A., Breen, K., et al. (2020). Gastrointestinal complications in critically ill patients with COVID-19. Ann. Surg. 272, e61–e62. doi: 10.1097/SLA.0000000000004004

CrossRef Full Text | Google Scholar

Klompas, M. (2021). Understanding breakthrough infections following mRNA SARS-CoV-2 vaccination. JAMA 326, 2018–2020. doi: 10.1001/jama.2021.19063

PubMed Abstract | CrossRef Full Text | Google Scholar

Kwon, P. S., Oh, H., Kwon, S. J., Jin, W., Zhang, F., Fraser, K., et al. (2020). Sulfated polysaccharides effectively inhibit SARS-CoV-2 in vitro. Cell Discov. 6:50. doi: 10.1038/s41421-020-00192-8

PubMed Abstract | CrossRef Full Text | Google Scholar

Lan, J., Ge, J., Yu, J., Shan, S., Zhou, H., Fan, S., et al. (2020). Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor. Nature 581, 215–220. doi: 10.1038/s41586-020-2180-5

CrossRef Full Text | Google Scholar

Ledford, H. (2021). Do vaccines protect against long COVID? What the data say. Nature 599, 546–548. doi: 10.1038/d41586-021-03495-2

CrossRef Full Text | Google Scholar

Leentjens, J., van Haaps, T. F., Wessels, P. F., Schutgens, R. E. G., and Middeldorp, S. (2021). COVID-19-associated coagulopathy and antithrombotic agents-lessons after 1 year. Lancet Haematol. 8, e524–e533. doi: 10.1016/S2352-3026(21)00105-8

PubMed Abstract | CrossRef Full Text | Google Scholar

Lemos, A. C. B., do Espírito Santo, D. A., Salvetti, M. C., Gilio, R. N., Agra, L. B., Pazin-Filho, A., et al. (2020). Therapeutic versus prophylactic anticoagulation for severe COVID-19: a randomized phase II clinical trial (HESACOVID). Thromb. Res. 196, 359–366. doi: 10.1016/j.thromres.2020.09.026

PubMed Abstract | CrossRef Full Text | Google Scholar

Li, L., Huang, M., Shen, J., Wang, Y., Wang, R., Yuan, C., et al. (2021). Serum levels of soluble platelet endothelial cell adhesion molecule 1 in COVID-19 patients are associated with disease severity. J. Infect. Dis. 223, 178–179. doi: 10.1093/infdis/jiaa642

PubMed Abstract | CrossRef Full Text | Google Scholar

Li, Y., Schneider, A. M., Mehta, A., Sade-Feldman, M., Kays, K. R., Gentili, M., et al. (2021). SARS-CoV-2 viremia is associated with distinct proteomic pathways and predicts COVID-19 outcomes. J. Clin. Invest. 131:e148635. doi: 10.1172/JCI148635

CrossRef Full Text | Google Scholar

Livanos, A. E., Jha, D., Cossarini, F., Gonzalez-Reiche, A. S., Tokuyama, M., Aydillo, T., et al. (2021). Intestinal host response to SARS-CoV-2 infection and COVID-19 outcomes in patients with gastrointestinal symptoms. Gastroenterology 16, 2435.e34–2450.e34. doi: 10.1053/j.gastro.2021.02.056

CrossRef Full Text | Google Scholar

Lopes, R. D., de Barros, E., Silva, P. G. M., Furtado, R. H. M., Macedo, A. V. S., Bronhara, B., et al. (2021). Therapeutic versus prophylactic anticoagulation for patients admitted to hospital with COVID-19 and elevated D-dimer concentration (ACTION): an open-label, multicentre, randomised, controlled trial. Lancet 397, 2253–2263. doi: 10.1016/S0140-6736(21)01203-4

CrossRef Full Text | Google Scholar

Luo, Y., Xue, Y., Mao, L., Yuan, X., Lin, Q., Tang, G., et al. (2020). Prealbumin as a predictor of prognosis in patients with coronavirus disease 2019. Front. Med. 7:374. doi: 10.3389/fmed.2020.00374

PubMed Abstract | CrossRef Full Text | Google Scholar

Lv, L., Jiang, H., Chen, Y., Gu, S., Xia, J., Zhang, H., et al. (2021). The faecal metabolome in COVID-19 patients is altered and associated with clinical features and gut microbes. Anal. Chim. Acta 1152:338267. doi: 10.1016/j.aca.2021.338267

PubMed Abstract | CrossRef Full Text | Google Scholar

Ma, R., Xie, R., Yu, C., Si, Y., Wu, X., Zhao, L., et al. (2017). Phosphatidylserine-mediated platelet clearance by endothelium decreases platelet aggregates and procoagulant activity in sepsis. Sci. Rep. 7:4978. doi: 10.1038/s41598-018-24187-4

PubMed Abstract | CrossRef Full Text | Google Scholar

Manne, B. K., Denorme, F., Middleton, E. A., Portier, I., Rowley, J. W., Stubben, C., et al. (2020). Platelet gene expression and function in patients with COVID-19. Blood 136, 1317–1329. doi: 10.1182/blood.2020007214

PubMed Abstract | CrossRef Full Text | Google Scholar

Mao, R., Qiu, Y., He, J. S., Tan, J. Y., Li, X. H., Liang, J., et al. (2020). Manifestations and prognosis of gastrointestinal and liver involvement in patients with COVID-19: a systematic review and meta-analysis. Lancet Gastroenterol. Hepatol. 5, 667–678. doi: 10.1016/S2468-1253(20)30126-6

PubMed Abstract | CrossRef Full Text | Google Scholar

Marcos-Jubilar, M., Carmona-Torre, F., Vidal Laso, R., Ruiz-Artacho, P., Filella, D., Carbonell, C., et al. (2022). Therapeutic versus prophylactic bemiparin in hospitalized patients with non-severe COVID-19 pneumonia (BEMICOP): an open-label, multicenter, randomized trial. Thromb. Haemost. 122, 295–299. doi: 10.1055/a-1667-7534

PubMed Abstract | CrossRef Full Text | Google Scholar

McFadyen, D. J., Stevens, H., and Karlheinz, P. (2020). The emerging threat of (micro)thrombosis in COVID-19 and its therapeutic implications. Circ. Res. 127, 571–587. doi: 10.1161/CIRCRESAHA.120.317447

CrossRef Full Text | Google Scholar

Middleton, E. A., He, X. Y., Denorme, F., Campbell, R. A., Ng, D., Salvatore, S. P., et al. (2020). Neutrophil extracellular traps contribute to immunothrombosis in COVID-19 acute respiratory distress syndrome. Blood 136, 1169–1179. doi: 10.1182/blood.2020007008

CrossRef Full Text | Google Scholar

Moore, J. B., and June, C. H. (2020). Cytokine release syndrome in severe COVID-19. Science 368, 473–474. doi: 10.1126/science.abb8925

CrossRef Full Text | Google Scholar

Mouhat, B., Besutti, M., Bouiller, K., Grillet, F., Monnin, C., Ecarnot, F., et al. (2020). Elevated D-dimers and lack of anticoagulation predict PE in severe COVID-19 patients. Eur. Respir. J. 56:2001811. doi: 10.1183/13993003.01811-2020

PubMed Abstract | CrossRef Full Text | Google Scholar

Norsa, L., Bonaffini, P. A., Indriolo, A., Valle, C., Sonzogni, A., and Sironi, S. (2020). Poor outcome of intestinal ischemic manifestations of COVID-19. Gastroenterology 159, 1595.e1–1597.e1. doi: 10.1053/j.gastro.2020.06.041

PubMed Abstract | CrossRef Full Text | Google Scholar

Perepu, U. S., Chambers, I., Wahab, A., Ten Eyck, P., Wu, C., Dayal, S., et al. (2021). Standard prophylactic versus intermediate dose enoxaparin in adults with severe COVID-19: a multi-center, open-label, randomized controlled trial. J. Thromb. Haemost. 19, 2225–2234. doi: 10.1111/jth.15450

PubMed Abstract | CrossRef Full Text | Google Scholar

Pereyra, D., Heber, S., Schrottmaier, W. C., Santol, J., Pirabe, A., Schmuckenschlager, A., et al. (2021). Low molecular weight heparin use in COVID-19 is associated with curtailed viral persistence: a retrospective multicenter observational study. Cardiovasc. Res. 117, 2807–2820. doi: 10.1093/cvr/cvab308

PubMed Abstract | CrossRef Full Text | Google Scholar

Polak, S. B., Van Gool, I. C., Cohen, D., von der Thüsen, J. H., and van Paassen, J. (2020). A systematic review of pathological findings in COVID-19: a pathophysiological timeline and possible mechanisms of disease progression. Mod. Pathol. 33, 2128–2138. doi: 10.1038/s41379-020-0603-3

CrossRef Full Text | Google Scholar

Poor, H. D. (2021). Pulmonary thrombosis and thromboembolism in COVID-19. Chest 160, 1471–1480. doi: 10.1016/j.chest.2021.06.016

CrossRef Full Text | Google Scholar

Puelles, V. G., Lütgehetmann, M., Lindenmeyer, M. T., Sperhake, J. P., Wong, M. N., Allweiss, L., et al. (2020). Multiorgan and renal tropism of SARS-CoV-2. N. Engl. J. Med. 383, 590–592. doi: 10.1056/NEJMc2011400

PubMed Abstract | CrossRef Full Text | Google Scholar

Ramacciotti, E., Barile Agati, L., Calderaro, D., Aguiar, V. C. R., Spyropoulos, A. C., de Oliveira, C. C. C., et al. (2022). Rivaroxaban versus no anticoagulation for post-discharge thromboprophylaxis after hospitalisation for COVID-19 (MICHELLE): an open-label, multicentre, randomised, controlled trial. Lancet 399, 50–59. doi: 10.1016/S0140-6736(21)02392-8

PubMed Abstract | CrossRef Full Text | Google Scholar

RECOVERY Collaborative Group (2022). Aspirin in patients admitted to hospital with COVID-19 (RECOVERY): a randomised, controlled, open-label, platform trial. Lancet 399, 143–151. doi: 10.1016/S0140-6736(21)01825-0

CrossRef Full Text | Google Scholar

RECOVERY Collaborative Group Horby, P., Lim, W. S., Emberson, J. R., Mafham, M., Bell, J. L., et al. (2020). Dexamethasone in hospitalized patients with Covid-19. N. Engl. J. Med. 384, 693–704. doi: 10.1056/NEJMoa2021436

PubMed Abstract | CrossRef Full Text | Google Scholar

REMAP-CAP Investigators ACTIV-4a Investigators ATTACC Investigators Goligher, E. C., Bradbury, C. A., McVerry, B. J., et al. (2021a). Therapeutic anticoagulation with heparin in critically ill patients with Covid-19. N. Engl. J. Med. 385, 777–789. doi: 10.1056/NEJMoa2103417

PubMed Abstract | CrossRef Full Text | Google Scholar

REMAP-CAP Investigators ACTIV-4a Investigators ATTACC Investigators Lawler, P. R., Goligher, E. C., Berger, J. S., et al. (2021b). Therapeutic anticoagulation with heparin in noncritically ill patients with Covid-19. N. Engl. J. Med. 385, 790–802. doi: 10.1056/NEJMoa2105911

PubMed Abstract | CrossRef Full Text | Google Scholar

Rizvi, A., Patel, Z., Liu, Y., Satapathy, S. K., Sultan, K., and Trindade, A. J. (2021). Gastrointestinal sequelae 3 and 6 months after hospitalization for coronavirus disease 2019. Clin. Gastroenterol. Hepatol. 19, 2438.e1–2440.e1. doi: 10.1016/j.cgh.2021.06.046

CrossRef Full Text | Google Scholar

Santoro, F., Nuñez-Gil, I. J., Vitale, E., Viana-Llamas, M. C., Reche-Martinez, B., Romero-Pareja, R., et al. (2022). Antiplatelet therapy and outcome in COVID-19: the health outcome predictive evaluation registry. Heart 108, 130–136. doi: 10.1136/thoraxjnl-2021-217561

PubMed Abstract | CrossRef Full Text | Google Scholar

Shi, J., and Gilbert, G. E. (2003). Lactadherin inhibits enzyme complexes of blood coagulation by completing for phospholipid binding sites. Blood 101, 2628–2636. doi: 10.1182/blood-2002-07-1951

PubMed Abstract | CrossRef Full Text | Google Scholar

Sholzberg, M., Tang, G. H., Rahhal, H., AlHamzah, M., Kreuziger, L. B., Áinle, F. N., et al. (2021). Effectiveness of therapeutic heparin versus prophylactic heparin on death, mechanical ventilation, or intensive care unit admission in moderately ill patients with covid-19 admitted to hospital: RAPID randomised clinical trial. BMJ 375:n2400. doi: 10.1136/bmj.n2400

CrossRef Full Text | Google Scholar

Spyropoulos, A. C., Goldin, M., Giannis, D., Diab, W., Wang, J., Khanijo, S., et al. (2021). Efficacy and safety of therapeutic-dose heparin vs. standard prophylactic or intermediate-dose heparins for thromboprophylaxis in high-risk hospitalized patients with COVID-19: the HEP-COVID randomized clinical trial. JAMA Intern. Med. 181, 1612–1620. doi: 10.1001/jamainternmed.2021.6203

PubMed Abstract | CrossRef Full Text | Google Scholar

Stefan, N., Birkenfeld, A. L., and Schulze, M. B. (2021). Global pandemics interconnected – obesity, impaired metabolic health and COVID-19. Nat. Rev. Endocrinol. 17, 135–149. doi: 10.1038/s41574-020-00462-1

CrossRef Full Text | Google Scholar

Stefely, J. A., Christensen, B. B., Gogakos, T., Cone Sullivan, J. K., Montgomery, G. G., Barranco, J. P., et al. (2020). Marked factor V activity elevation in severe COVID-19 is associated with venous thromboembolism. Am. J. Hematol. 95, 1522–1530. doi: 10.1002/ajh.25979

PubMed Abstract | CrossRef Full Text | Google Scholar

Suh, Y. J., Hong, H., Ohana, M., Bompard, F., Revel, M. P., Valle, C., et al. (2021). Pulmonary embolism and deep vein thrombosis in COVID-19: a systematic review and meta-analysis. Radiology 298, E70–E80. doi: 10.1148/radiol.2020203557

CrossRef Full Text | Google Scholar

Sultan, S., Altayar, O., Siddique, S. M., Davitkov, P., Feuerstein, J. D., Lim, J. K., et al. (2020). AGA institute rapid review of the gastrointestinal and liver manifestations of COVID-19, meta-analysis of international data, and recommendations for the consultative management of patients with COVID-19. Gastroenterology 159, 320.e27–334.e27. doi: 10.1053/j.gastro.2020.05.001

PubMed Abstract | CrossRef Full Text | Google Scholar

Susen, S., Tacquard, C. A., Godon, A., Mansour, A., Garrigue, D., Nguyen, P., et al. (2020). Prevention of thrombotic risk in hospitalized patients with COVID-19 and hemostasis monitoring. Crit. Care 24:364. doi: 10.1186/s13054-020-03000-7

CrossRef Full Text | Google Scholar

Tan, B. K., Mainbourg, S., Friggeri, A., Bertoletti, L., Douplat, M., Dargaud, Y., et al. (2021). Arterial and venous thromboembolism in COVID-19: a study-level meta-analysis. Thorax 76, 970–979. doi: 10.1136/thoraxjnl-2020-215383

PubMed Abstract | CrossRef Full Text | Google Scholar

Taus, F., Salvagno, G., Canè, S., Fava, C., Mazzaferri, F., Carrara, E., et al. (2020). Platelets promote thromboinflammation in SARS-CoV-2 pneumonia. Arterioscler. Thromb. Vasc. Biol. 40, 2975–2989. doi: 10.1161/ATVBAHA.120.315175

PubMed Abstract | CrossRef Full Text | Google Scholar

Ten Cate, H. (2021). Surviving Covid-19 with heparin? N. Engl. J. Med. 385, 845–846. doi: 10.1056/NEJMe2111151

PubMed Abstract | CrossRef Full Text | Google Scholar

Tenforde, M. W., Self, W. H., Adams, K., Gaglani, M., Ginde, A. A., McNeal, T., et al. (2021). Association between mRNA vaccination and COVID-19 hospitalization and disease severity. JAMA 326, 2043–2054. doi: 10.1001/jama.2021.19499

CrossRef Full Text | Google Scholar

Thompson, M. G., Burgess, J. L., Naleway, A. L., Tyner, H., Yoon, S. K., Meece, J., et al. (2021). Prevention and attenuation of Covid-19 with the BNT162b2 and mRNA-1273 vaccines. N. Engl. J. Med. 385, 320–329. doi: 10.1056/NEJMoa2107058

PubMed Abstract | CrossRef Full Text | Google Scholar

Tong, M., Jiang, Y., Xia, D., Xiong, Y., Zheng, Q., Chen, F., et al. (2020). Elevated expression of serum endothelial cell adhesion molecules in COVID-19 patients. J. Infect. Dis. 222, 894–898. doi: 10.1093/infdis/jiaa349

CrossRef Full Text | Google Scholar

Varga, Z., Flammer, A. J., Steiger, P., Haberecker, M., Andermatt, R., Zinkernagel, A. S., et al. (2020). Endothelial cell infection and endotheliitis in COVID-19. Lancet 395, 1417–1418. doi: 10.1016/S0140-6736(20)30937-5

PubMed Abstract | CrossRef Full Text | Google Scholar

Versteeg, H. H., Heemskerk, J. W., Levi, M., and Reitsma, P. H. (2013). New fundamentals in hemostasis. Physiol. Rev. 93, 327–358. doi: 10.1152/physrev.00016.2011

PubMed Abstract | CrossRef Full Text | Google Scholar

von Meijenfeldt, F. A., Havervall, S., Adelmeijer, J., Lundström, A., Magnusson, M., Mackman, N., et al. (2021). Elevated factor V activity and antigen levels in patients with Covid-19 are related to disease severity and 30-day mortality. Am. J. Hematol. 96, E98–E100. doi: 10.1002/ajh.26085

PubMed Abstract | CrossRef Full Text | Google Scholar

Wang, P., Nair, M. S., Liu, L., Iketani, S., Luo, Y., Guo, Y., et al. (2021). Antibody resistance of SARS-CoV-2 variants B.1.351 and B.1.1.7. Nature 593, 130–135. doi: 10.1038/s41586-021-03398-2

CrossRef Full Text | Google Scholar

Wang, W., Xu, Y., Gao, R., Han, K., Wu, G., and Tan, W. (2020). Detection of SARS-CoV-2 in different types of clinical specimens. JAMA 323, 1843–1844. doi: 10.1001/jama.2020.3786

PubMed Abstract | CrossRef Full Text | Google Scholar

Wölfel, R., Corman, V. M., Guggemos, W., Seilmaier, M., Zange, S., Müller, M. A., et al. (2020). Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465–469. doi: 10.1038/s41586-020-2196-x

CrossRef Full Text | Google Scholar

Xiao, F., Sun, J., Xu, Y., Li, F., Huang, X., Li, H., et al. (2020a). Infectious SARS-CoV-2 in feces of patient with severe COVID-19. Emerg. Infect. Dis. 26, 1920–1922. doi: 10.3201/eid2608.200681

PubMed Abstract | CrossRef Full Text | Google Scholar

Xiao, F., Tang, M., Zheng, X., Liu, Y., Li, X., and Shan, H. (2020b). Evidence for gastrointestinal infection of SARS-CoV-2. Gastroenterology 158, 1831.e3–1833.e3. doi: 10.1053/j.gastro.2020.02.055

PubMed Abstract | CrossRef Full Text | Google Scholar

Xie, Y., Xu, E., Bowe, B., and Al-Aly, Z. (2022). Long-term cardiovascular outcomes of COVID-19. Nat. Med. doi: 10.1038/s41591-022-01689-3 [Epub ahead of print].

CrossRef Full Text | Google Scholar

Zaid, Y., Puhm, F., Allaeys, I., Naya, A., Oudghiri, M., Khalki, L., et al. (2020). Platelets can associate with SARS-CoV-2 RNA and are hyperactivated in COVID-19. Circ. Res. 127, 1404–1418. doi: 10.1161/CIRCRESAHA.120.317703

CrossRef Full Text | Google Scholar

Zamboni, P., Bortolotti, D., Occhionorelli, S., Traina, L., Neri, L. M., Rizzo, R., et al. (2021). Bowel ischemia as onset of COVID-19 in otherwise asymptomatic patients with persistently negative swab. J. Intern. Med. 291, 224–231. doi: 10.1111/joim.13385

CrossRef Full Text | Google Scholar

Zang, R., Gomez Castro, M. F., McCune, B. T., Zeng, Q., Rothlauf, P. W., Sonnek, N. M., et al. (2020). TMPRSS2 and TMPRSS4 promote SARS-CoV-2 infection of human small intestinal enterocytes. Sci. Immunol. 5:eabc3582. doi: 10.1126/sciimmunol.abc3582

CrossRef Full Text | Google Scholar

Zhang, Y., Chen, C., Zhu, S., Shu, C., Wang, D., Song, J., et al. (2020). Isolation of 2019-nCoV from a stool specimen of a laboratory- confirmed case of the coronavirus disease 2019 (COVID-19). China CDC Wkly 2, 123–124. doi: 10.46234/ccdcw2020.033

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhang, P., He, Z., Yu, G., Peng, D., Feng, Y., Ling, J., et al. (2021). The modified NUTRIC score can be used for nutritional risk assessment as well as prognosis prediction in critically ill COVID-19 patients. Clin. Nutr. 40, 534–541. doi: 10.1016/j.clnu.2020.05.051

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhang, H., Shao, B., Dang, Q., Chen, Z., Zhou, Q., Luo, H., et al. (2021). Pathogenesis and mechanism of gastrointestinal infection With COVID-19. Front. Immunol. 12:674074. doi: 10.3389/fimmu.2021.674074

CrossRef Full Text | Google Scholar

Zhao, F., Yang, Y., Wang, Z., Li, L., Liu, L., and Liu, Y. (2020). The time sequences of respiratory and rectal viral shedding in patients with coronavirus disease 2019. Gastroenterology 159, 1158.e2–1160.e2. doi: 10.1053/j.gastro.2020.05.035

CrossRef Full Text | Google Scholar

Zhong, P., Xu, J., Yang, D., Shen, Y., Wang, L., Feng, Y., et al. (2020). COVID-19-associated gastrointestinal and liver injury: clinical features and potential mechanisms. Signal Transduct. Target. Ther. 5:256. doi: 10.1038/s41392-020-00373-7

PubMed Abstract | CrossRef Full Text | Google Scholar

Zhou, J., Li, C., Liu, X., Chiu, M. C., Zhao, X., Wang, D., et al. (2020). Infection of bat and human intestinal organoids by SARS-CoV-2. Nat. Med. 26, 1077–1083. doi: 10.1038/s41591-020-0912-6

Review of Mesenteric Ischemia in COVID-19 Patients

Authors: Amit GuptaOshin SharmaKandhala SrikanthRahul MishraAmoli Tandon & Deepak Rajput  Indian Journal of Surgery (2022) Published: 

Abstract

The new coronavirus (COVID-19) infection, first detected in Wuhan, China in 2019 has become a pandemic that has spread to nearly every country in the world. Through October 11, 2021, more than 23 billion confirmed cases and 4.8 million fatalities were reported globally. The bulk of individuals afflicted in India during the first wave were elderly persons. The second wave, however, resulted in more severe diseases and mortality in even younger age groups due to mutations in the wild virus. Symptoms may range from being asymptomatic to fatal acute respiratory distress syndrome (ARDS). In addition to respiratory symptoms, patients may present with gastrointestinal symptoms such as stomach pain, vomiting, loose stools, or mesenteric vein thrombosis. The frequency of patients presenting with thromboembolic symptoms has recently increased. According to certain studies, the prevalence of venous thromboembolism among hospitalized patients ranges from 9 to 25%. It was also shown that the incidence is significantly greater among critically sick patients, with a prevalence of 21–31%. Although the exact origin of thromboembolism is unknown, it is considered to be produced by several altered pathways that manifest as pulmonary embolism, myocardial infarction, stroke, limb gangrene, and acute mesenteric ischemia. Acute mesenteric ischemia (AMI) is becoming an increasingly prevalent cause of acute surgical abdomen in both intensive care unit (ICU) and emergency room (ER) patients. Mesenteric ischemia should be evaluated in situations with unexplained stomach discomfort. In suspected situations, appropriate imaging techniques and early intervention, either non-surgical or surgical, are necessary to avert mortality. The purpose of this article is to look at the data on acute mesenteric ischemia in people infected with COVID-19.

Introduction

Aside from the respiratory system, the gastrointestinal system is the most common site of SARS-COV-2 infection. This might be because enterocyte and vascular endothelial membranes have large amounts of angiotensin-converting enzyme receptor 2, a membrane integral protein. As a result, the COVID virus induces direct enterocyte invasion as well as indirect endothelial injury-induced thrombosis/intestinal ischemia in the bowel [1]. ICU patients are more prone than non-ICU patients to suffer acute mesenteric ischemia. This might be because, in addition to the direct viral activity on vascular endothelium, ICU patients have extra persistent pro-inflammatory effects. Cases have been observed even among individuals who have recovered from infection [2]. A rising number of cases of acute mesenteric ischemia in COVID-19 patients have been reported in the literature since the outbreak of this pandemic (list of reported cases are summarized in the Table 1). AMI risk was shown to be increased with age, male sex, and comorbidities such as hypertension, obesity, and diabetes mellitus. Because of delayed clinical manifestation, AMI-related mortality is quite significant, with 60–80% [3].Table 1 Summary of the cases reported on mesenteric ischemia in COVID-19 patientsFull size table

Case summary

A 55 years old man with no known comorbidity presented to the emergency department of our institute with severe pain abdomen and multiple episodes of vomiting. He reported the recent recovery from the non-complicated COVID-related illness. He did not report any intake of anticoagulants. On clinical examination, abdomen was unremarkable. X-ray chest, x-ray erect abdomen, and ultrasound abdomen were unremarkable. Mesenteric ischemia was suspected and the patient was subjected to CT angiography abdomen, which revealed thrombus at the origin of the superior mesenteric artery and impending gangrene of the small bowel (Fig. 1). Emergency laparotomy was done and intraoperatively found the gangrenous bowel involving the distal jejunum and almost the entire ileum sparing the terminal ileum (Fig. 2). Resection of the gangrenous small bowel and end jejunostomy was done. Later, he was given ICU care, but unfortunately, the patient succumbed to multi-organ dysfunction syndrome.

figure 1
Fig. 1
figure 2
Fig. 2

Pathophysiology

Although the specific etiology of hypercoagulable state and subsequent mesenteric ischemia in COVID-19 patients is unknown, these thromboembolic events can be related to alterations in all three Virchow triad characteristics (vascular endothelial injury, hypercoagulability, and stasis). A variety of variables complicate the etiology of thrombus development, one of which is vascular endothelial injury. Capillary permeability, hemostasis, and fibrinolysis are all maintained by the vascular endothelium (Fig. 3). Direct invasion causes endothelial cells to be damaged and lysed, resulting in an imbalance between pro and anticoagulant states [4]. Furthermore, vascular endothelial cells displayed morphological changes such as cellular expansion, retraction, and intercellular connection breakage [5]. The elevated levels of pro-inflammatory markers, von Willebrand factor, tissue factor, fibrinogen, and circulating microvesicles in the COVID-19 patients explain their hypercoagulability [6]. Antiphospholipid antibodies are elevated in some situations [7]. Patients who are critically ill, on limited oxygen support, and mechanical breathing are less mobilized, which increases the risk of deep venous thrombosis [3].

figure 3
Fig. 3

These mesenteric vascular thromboses cause acute hypoxia in the intestinal wall, which stimulates the renin-angiotensin system, causing mesenteric vasospasm and an elevated risk of hypoxic injury. SARS-COV binds to ACE 2 receptors in intestinal cells, causing cell lysis [8]. As a result, both hypoxia and direct invasion can trigger intestinal cell death. The loss of this epithelial barrier function in the gut promotes increased contact with enteric bacteria/endotoxins and viral particle penetration into the circulation [5]. The hypoxia continues, resulting in transmural infarction, perforation, and peritonitis. In one example of mesenteric ischemia induced by invasive mucormycosis, the presence of fungal components in the mesenteric microcirculation was documented [2]. See the flow chart summarizing the pathophysiology of mesenteric ischemia in covid-19 infection.

Clinical Presentation

Patients with mesenteric ischemia may exhibit a range of symptoms, from nonspecific complaints to peritonitis-like symptoms. Most of the patients developed symptoms a few days after being discharged successfully with proper symptomatic inpatient care. Although the respiratory symptoms predominate mesenteric ischemia presents with nonspecific abdominal symptoms such as loose stools, abdominal pain, nausea, vomiting, abdominal distension, and bleeding per rectum may occur in addition to the usual clinical presentation with respiratory features [6]. When opposed to arterial thrombosis, venous thrombosis has a delayed onset of symptoms. At first, sudden onset pain in the abdomen may be the sole symptom, and it may develop after 5–14 days. Abdominal clinical examination is nonyielding in the majority of cases. Abdominal signs would not develop unless the bowel gangrene or bowel perforation with peritonitis occurs [9].

Investigations

Blood investigations

Despite extensive study on the subject of acute mesenteric ischemia, the associated biomarkers were shown to be neither sensitive nor selective [10]. Elevated lactic acid levels and fibrin degradation products like D-dimer have low specificity and remain elevated in severe COVID-19 without AMI. However, biomarkers associated with hypercoagulable conditions aid in the initiation of preventive treatment and, to a lesser extent, in the management of COVID-related thrombotic events. Increased biomarkers of inflammation and infection include leukopenia (due to corticosteroid usage) and other signs such as C-reactive protein, procalcitonin, and IL-6. D-dimer, ferritin, prothrombin time, and lactate dehydrogenase are additional significant markers. The severity of increased lactate dehydrogenase and ferritin levels is associated with high mortality[8].

Radiological imaging

In the emergency room, an X-ray of the abdomen and an ultrasound are helpful for early examinations. X-ray of the erect abdomen helps in initial assessment in cases presented with features of obstruction or perforation. Ultrasound in the early phase may show SMA occlusion and bowel spasm or ultrasound findings in the early stages of acute mesenteric ischemia may appear normal [11]. In the intermediate phase, USG is not useful because of the presence of a large amount of gas-filled intestinal loops. In the late phase, USG may reveal fluid-filled lumen, bowel wall thinning, evidence of extra-luminal fluid, decreased or absent peristalsis. Therefore, USG may be helpful in the diagnosis of advanced bowel obstruction, gangrene, and perforation with peritoneal collection [12]. Ultrasonography revealed some other important features with distended and sludge-filled gall bladder with bile stasis. Portal venous gas also can be detected on ultrasonography which can be better characterized with the help of computed tomography [13].

Computed tomography

The gold standard investigation is CT angiography. CT observations commonly encountered in acute mesenteric ischemia secondary to COVID-19 includes thrombus in the aorta/SMA/portal circulation, augmentation of the bowel wall, thickness of the bowel wall with distention(> 3 cm), edema, and stranding of the mesentery, pneumatosis intestinalis or portal venous gas suggesting bowel wall ischemia, and non-enhancing thick bowel wall seen in bowel infarction, bowel perforation secondary to bowel infarction may present discontinuity of bowel wall with localized air collection. One should remember that pneumatosis intestinalis may also occur due to mechanical ventilation. Pneumoperitoneum occurs when there is severe intestinal necrosis and perforation. There were additional reports of nonspecific features such as a dilated gut with a fluid-filled lumen, distended gallbladder with bile stasis, features of solid organ ischemia, and pancreatitis [14]. MRI, despite its accessibility, has drawbacks such as a longer acquisition time and lower resolution than CT angiography [12].

Management

A summary of cases of acute mesenteric ischemia has been tabulated (Table 1). Management of acute mesenteric ischemia in COVID-19 includes the following:

  • Supportive measures: Crystalloid rehydration and empirical antibacterial treatment should begin before angiography or any surgical resection. Comorbidity management, hemodynamic support in unstable patients, and electrolyte balance correction are all critical components of patient care [10].
  • Anticoagulation: There is insufficient data in 19 patients to warrant thromboprophylaxis. According to the Tang et al. study, low-dose heparin prophylaxis decreased thrombotic events and mortality in those with D-dimer levels over 3 mg/ml. Despite the increased risk of bleeding, mesenteric ischemia should be treated with intraoperative and postoperative anticoagulation [15].
  • Revascularisation: Revascularization with catheter-directed thrombolysis and thrombectomy by percutaneous/surgical intervention can be explored in instances where there is no indication of significant intestinal ischemia. Catheter-directed thrombolysis with unfractionated heparin and recombinant tissue plasminogen activators can accomplish this. Because of the increased risk of re-thrombosis, vascular clearance is not indicated in instances of superior mesenteric vein thrombus [15].
  • Resection of the gangrenous bowel: Depending on clinical suspicion, a CT angiography examination of mesenteric vasculature and bowel health can be performed, and an emergency exploration call should be placed. Intraoperatively, if the patient is normotensive, has no sepsis or peritonitis, and the remaining bowel viability is unquestionable, the gangrenous bowel is to be removed, and the remaining bowel can be considered for re-anastomosis. In unfavorable circumstances, a stoma should be created following gangrenous bowel resection [11]. The margin dissection in venous thrombosis should be broader than in arterial thrombosis. To assure the bowel’s survivability, abdominal closure should be temporary, and a relook laparotomy should be done 48 h later. Histopathological examination of the resected intestine may indicate patchy or widespread necrotic changes from mucosa to transmural thickness. In the submucosal vasculature, fibrin-containing microthrombi with perivascular neutrophilic infiltration is observed.
  • Management of short bowel syndrome: The therapy varies depending on the length of colon left after excision of infarcted bowel caused by mesenteric ischemia.
  • Medical- In severe diarrhea, fluid and electrolyte loss must be replaced. TPN for feeding and histamine-2 receptor antagonists or PPIs for stomach acid secretion reduction. Loperamide and diphenoxylate are anti-motility medicines that delay small intestine transit whereas Octreotide reduces the volume of gastrointestinal secretions.
  • Non-transplant surgical therapy- Done to improve the absorption capacity of the remaining intestine by restoring intestinal continuity. Increased nutrient and fluid absorption is the goal. Segmental reversal of the small bowel, fabrication of small intestinal valves, and electrical pacing of the small bowel are all procedures used to delay intestinal transit. Longitudinal intestinal lengthening and tailoring technique (LILT) and serial transverse arthroplasty process are two intestinal lengthening procedures (STEP).
  • Intestinal transplantation- Life-threatening problems such as liver failure, thrombosis of major central veins, frequent episodes of severe dehydration, and catheter-related sepsis are reasons for intestinal transplantation [16].

Prognosis

Acute mesenteric ischemia has a poor prognosis, and life is reliant on prompt diagnosis and treatment. If detected within 24 h, the likelihood of survival is 50%, but it declines to 30% beyond that [17].In operated cases, COVID infection acts as an independent risk factor and is responsible for higher mortality [18].

Conclusion

SARS-COV-2 infection even though initially thought to be respiratory infection; later cases detected presenting with multisystem involvement. The presentation may vary from asymptomatic or mildly symptomatic to severe respiratory distress syndrome or thromboembolic phenomenon requiring ICU care. The exact mechanism of thromboembolism is not established. However, the increasing number of acute mesenteric ischemia is quite alarming. The treating physician should be overcautious in patients presenting with abdominal symptoms either currently affected or recovered from COVID-related illness. In high-risk patients, early start of prophylactic anticoagulation may be beneficial. Earlier intervention is known acute mesenteric ischemia cases with operative or minimally invasive procedures may give higher survival benefits. It mandates more research to determine the causes of thromboembolism, as well as preventive and therapeutic anticoagulation in these individuals.

References

  1. Jin B, Singh R, Ha SE, Zogg H, Park PJ, Ro S (2021) Pathophysiological mechanisms underlying gastrointestinal symptoms in patients with COVID-19. World J Gastroenterol. Baishideng Publishing Group Co 27:2341–52CAS Article Google Scholar 
  2. Jain M, Tyagi R, Tyagi R, Jain G (2021) Post-COVID-19 gastrointestinal invasive mucormycosis. Indian J Surg 22:1–3
  3. Kerawala AA, Das B, Solangi A (2021) Mesenteric ischemia in COVID-19 patients: a review of current literature. World J Clin Cases 9(18):4700–4708Article Google Scholar 
  4. Kichloo A, Dettloff K, Aljadah M, Albosta M, Jamal S, Singh J et al (2020) COVID-19 and hypercoagulability: a review. Clin Appl Thromb 26
  5. Parry AH, Wani AH, Yaseen M (2020) Acute mesenteric ischemia in severe Coronavirus-19 (COVID-19): possible mechanisms and diagnostic pathway. Acad Radiol 27(8):1190Article Google Scholar 
  6. Cheung S, Quiwa JC, Pillai A, Onwu C, Tharayil ZJ, Gupta R (2020) Superior mesenteric artery thrombosis and acute intestinal ischemia as a consequence of COVID-19 infection. Am J Case Rep 21:1–3Google Scholar 
  7. Zhang Y, Xiao M, Zhang S, Xia P, Cao W, Jiang W et al (2020) Coagulopathy and antiphospholipid antibodies in patients with Covid-19. N Engl J Med. 382(17):e38Article Google Scholar 
  8. Al Mahruqi G, Stephen E, Abdelhedy I, Al WK (2021) Our early experience with mesenteric ischemia in COVID-19 positive patients. Ann Vasc Surg 73:129–132Article Google Scholar 
  9. Karna ST, Panda R, Maurya AP, Kumari S (2020) Superior mesenteric artery thrombosis in COVID-19 Pneumonia: an underestimated diagnosis—first case report in Asia. Indian J Surg 82(6):1235–1237Article Google Scholar 
  10. Singh B, Kaur P (2021) COVID-19 and acute mesenteric ischemia: a review of literature. Hematol Transfus Cell Ther 43(1):112–116Article Google Scholar 
  11. Janež J, Klen J (2021) Multidisciplinary diagnostic and therapeutic approach to acute mesenteric ischaemia: a case report with literature review. SAGE Open Med Case Rep 9:2050313X2110048Article Google Scholar 
  12. Mc W (2010) Acute mesenteric ischemia: diagnostic approach and surgical treatment. Semin Vasc Surg 23(1):9–20Article Google Scholar 
  13. Bhayana R, Som A, Li MD, Carey DE, Anderson MA, Blake MA et al (2020) Abdominal imaging findings in COVID-19: Preliminary observations. Radiology 297(1):E207–E215
  14. Keshavarz P, Rafiee F, Kavandi H, Goudarzi S, Heidari F, Gholamrezanezhad A (2021) Ischemic gastrointestinal complications of COVID-19: a systematic review on imaging presentation. Clin Imaging 73:86–95Article Google Scholar 
  15. Bergqvist D, Svensson PJ (2010) Treatment of mesenteric vein thrombosis. Semin Vasc Surg 23(1):65–68Article Google Scholar 
  16. Seetharam P, Rodrigues G (2011) Short bowel syndrome: a review of management options. Saudi J Gastroenterol 17(4):229–235Article Google Scholar 
  17. Krothapalli N, Jacob J (2021) A rare case of acute mesenteric ischemia in the setting of COVID-19 infection. Cureus 13(3):0–4Google Scholar 
  18. Haffner MR, Le HV, Saiz AM, Han G, Fine J, Wolinsky P et al (2021) Postoperative In-hospital morbidity and mortality of patients with COVID-19 infection compared with patients without COVID-19 infection. JAMA Netw Open 4(4):10–13Article Google Scholar 
  19. Ucpinar BA, Sahin C (2020) Superior mesenteric artery thrombosis in a patient with COVID-19: a unique presentation. J Coll Physicians Surg Pak 30(10):S112–S114Google Scholar 
  20. Khesrani LS, Chana k, Sadar FZ, Dahdouh A, Ladjadj Y, Bouguermouh D (2020) Intestinal ischemia secondary to Covid-19. J Pediatr Surg Case Rep 61:101604Article Google Scholar 
  21. Norsa L, Valle C, Morotti D, Bonaffini PA, Indriolo A, Sonzogni A (2020) Intestinal ischemia in the COVID-19 era. Dig Liver Dis 52(10):1090–1091CAS Article Google Scholar 
  22. Rodriguez-Nakamura RM, Gonzalez-Calatayud M, Martinez Martinez AR (2020) Acute mesenteric thrombosis in two patients with COVID-19. Two cases report and literature review. Int J Surg Case Rep 76:409–14Article Google Scholar 
  23. VartanogluAktokmakyan T, Tokocin M, Meric S, Celebi F (2021) Is mesenteric ischemia in COVID-19 patients a surprise? Surg Innov 28(2):236–238Article Google Scholar 
  24. Levolger S, Bokkers RPH, Wille J, Kropman RHJ, de Vries JPPM (2020) Arterial thrombotic complications in COVID-19 patients. J Vasc Surg Cases Innov Tech 6(3):454–459Article Google Scholar 
  25. Thuluva SK, Zhu H, Tan MML, Gupta S, Yeong KY, Wah STC et al (2020) A 29-year-old male construction worker from india who presented with left-sided abdominal pain due to isolated superior mesenteric vein thrombosis associated with SARS-CoV-2 infection. Am J Case Rep 21:1–5Article Google Scholar 
  26. Lari E, Lari A, AlQinai S, Abdulrasoul M, AlSafran S, Ameer A et al (2020) Severe ischemic complications in Covid-19—a case series. Int J Surg Case Rep 75(June):131–135Article Google Scholar 
  27. Singh B, Mechineni A, Kaur P, Ajdir N, Maroules M, Shamoon F et al (2020) Acute intestinal ischemia in a patient with COVID-19 infection. Korean J Gastroenterol 76(3):164–166Article Google Scholar 
  28. De Roquetaillade C, Chousterman BG, Tomasoni D, Zeitouni M, Houdart E (2020) Since January 2020 Elsevier has created a COVID-19 resource centre with free information in English and Mandarin on the novel coronavirus COVID- 19. The COVID-19 resource centre is hosted on Elsevier Connect , the company ’ s public news and information. (January)
  29. Sehhat S, Talebzadeh H, Hakamifard A, Melali H, Shabib S, Rahmati A et al (2020) Acute mesenteric ischemia in a patient with COVID-19: a case report. Arch Iran Med 23(9):639–643Article Google Scholar 
  30. Beccara LA, Pacioni C, Ponton S, Francavilla S, Cuzzoli A (2020) Arterial mesenteric thrombosis as a complication of SARS-CoV-2 infection. Eur J Case Rep Intern Med 7(5).
  31. Ignat M, Philouze G, Aussenac-belle L (2020) Since January 2020 Elsevier has created a COVID-19 resource centre with free information in English and Mandarin on the novel coronavirus COVID- 19 . The COVID-19 resource centre is hosted on Elsevier Connect , the company ’ s public news and information. (Jan)
  32. Farina D, Rondi P, Botturi E, Renzulli M, Borghesi A, Guelfi D et al (2021) Gastrointestinal: bowel ischemia in a suspected coronavirus disease (COVID-19) patient. J Gastroenterol Hepatol 36(1):41CAS Article Google Scholar 
  33. Azouz E, Yang S, Monnier-Cholley L, Arrivé L (2020) Systemic arterial thrombosis and acute mesenteric ischemia in a patient with COVID-19. Intensive Care Med 46(7):1464–1465CAS Article Google Scholar 
  34. Vulliamy P, Jacob S, Davenport RA (2020) Acute aorto-iliac and mesenteric arterial thromboses as presenting features of COVID-19. Br J Haematol 189(6):1053–1054CAS Article Google Scholar 
  35. Bianco F, Ranieri AJ, Paterniti G, Pata F, Gallo G (2020) Acute intestinal ischemia in a patient with COVID-19. Tech Coloproctol 24(11):1217–1218CAS Article Google Scholar 
  36. Filho A do C, Cunha B da S (2020) Case report – inferior mesenteric vein thrombosis and COVID-19. 2020060282
  37. Mitchell JM, Rakheja D, Gopal P (2021) SARS-CoV-2-related hypercoagulable state leading to ischemic enteritis secondary to superior mesenteric artery thrombosis. Clin Gastroenterol Hepatol 19(11):e111CAS Article Google Scholar 
  38. English W, Banerjee S (2020) Coagulopathy and mesenteric ischaemia in severe SARS-CoV-2 infection. ANZ J Surg 90(9):1826Article Google Scholar 
  39. de Barry O, Mekki A, Diffre C, Seror M, El Hajjam M, Carlier RY (2020) Arterial and venous abdominal thrombosis in a 79-year-old woman with COVID-19 pneumonia. Radiol Case Rep 15(7):1054–1057Article Google Scholar 
  40. Kraft M, Pellino G, Jofra M, Sorribas M, Solís-Peña A, Biondo S, Espín-Basany E (2021) Incidence, features, outcome and impact on health system of de-novo abdominal surgical diseases in patients admitted with COVID-19. Surg J R Coll Surg Edinb Irel 19:e53–e58Google Scholar 
  41. Besutti G, Bonacini R, Iotti V, Marini G, Riva N, Dolci G et al (2020) Abdominal visceral infarction in 3 patients with COVID-19. Emerg Infect Dis 26(8):1926–1928CAS Article Google Scholar 
  42. Kielty J, Duggan WP, O’Dwyer M (2020) Extensive pneumatosis intestinalis and portal venous gas mimicking mesenteric ischaemia in a patient with SARS-CoV-2. Ann R Coll Surg Engl 102(6):E145–E147CAS Article Google Scholar 
  43. Pang JHQ, Tang JH, Eugene-Fan B (2021) A peculiar case of small bowel stricture in a coronavirus disease 2019 patient with congenital adhesion band and superior mesenteric vein thrombosis. Ann Vasc Surg 70:286–289Article Google Scholar 
  44. Osilli D, Pavlovica J, Mane R, Ibrahim M, Bouhelal A, Jacob S (2020) Case reports: mild COVID-19 infection and acute arterial thrombosis. J Surg Case Rep (9):1–3

Uptake of SARS-CoV-2 spike protein in human cerebrovascular cells

Authors:  Bhavana Kunkalikar Mar 24 2022 Reviewed by Danielle Ellis, B.Sc. BioRxiv

A recent study posted to the bioRxiv* preprint server assessed the uptake of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spike (S) protein in human cerebrovascular cells via the lipid raft ganglioside.  

Study: SARS-CoV-2 spike proteins uptake mediated by lipid raft ganglioside GM1 in human cerebrovascular cells. Image Credit: Dotted Yeti
Study: SARS-CoV-2 spike proteins uptake mediated by lipid raft ganglioside GM1 in human cerebrovascular cells. Image Credit: Dotted Yeti

Various studies have reported the effects of coronavirus disease 2019 (COVID-19) on the respiratory organs and non-respiratory ones, including the brain. However, there is still a lack of knowledge about the SARS-CoV-2 uptake mechanism involved in the viral entry into the human cerebrovasculature cells. 


About the study

The present study investigated the mechanism of SARS-CoV-2 S protein uptake by three types of cerebrovascular cells: endothelial cells, smooth muscle cells, and pericytes.

The team obtained human cerebral microvascular endothelial cells (hCMEC/D3), human
brain vascular smooth muscle cells (HBVSMCs), and human brain vascular pericytes (HBVPs). The cells were expanded separately and then pre-incubated with the inhibitor before being exposed to SARS-CoV-2 S protein in an incubator. S protein uptake without the inhibitor was then estimated as a percentage of control wells. 

The in vitro cell viability of the unlabeled wild type (WT) S protein was evaluated by the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay. The team also used immobilized recombinant human angiotensin-converting enzyme 2 (ACE2) to assess its binding ability to the S protein.  

Images of the whole well were taken, followed by all fluorescence quantification. The custom pixel classifiers measured the fluorescence intensity while the cell count was calculated using Qupath’s cell counter. Furthermore, primary antibodies were used in the immunocytochemistry (ICC) and imaged.


Results 

The study results showed that the uptake mechanism associated with the SARS-CoV-2 WT S proteins (SP-555) was mostly observed on the hCMEC/D3 cell surface while the HBVP and HBVSMC cells showed more internalization. Also, each cell type reached equilibrium after six hours since the 100 nanometers (nm) SP-555 signal started. Furthermore, the endothelial cells showed the lowest ability to uptake S protein compared to the smooth muscle cells and the pericytes, possibly because of the different cell sizes.

Related Stories

Similar binding affinities were observed for the HBVMC and the hCMEC/D3 cells, while ACE2 and SP-555 binding showed lower values than the other two. Notably, SARS-CoV-2 S was not toxic towards the type of cells tested in this study. Also, in the MTT assay, increased levels of formazan were found at higher S concentrations in the hCMEC/D3 cells, indicating elevated metabolic activity in these cells because of the higher mitochondria content present in the cerebral endothelium. 

The team also noted receptor binding in the S uptake patterns in the cell types, highlighting ACE2 as the major binding site for the viral protein. Notably, interactions between ACE2 and SP-555 were also confirmed, while these interactions were localized twice more in the hCMEC/D3 cells than in the other two cell types studied. 

A 40% reduction of SP-555 uptake in the presence of excess unlabeled αACE2 indicated the co-localization of SP-555 with αACE2. On the other hand, excess unlabeled S protein reduced the bound labeled S protein uptake by 50% to 60% for the three cell types. The assessment of S uptake at different temperatures showed that the uptake was 2.2 to 5.5 times higher at 37oC than at 4oC, suggesting greater protein interaction with the cell types at 37oC.

The study showed that a sialic acid-binding lectin, called wheat germ agglutinin (WGA), increased the uptake of SP-555 by 2.4 times in the hCMEC/D3, 3.2 times in the HBVP, and 1.4 times in the HBVMC cell types. In contrast, a polysaccharide glycosaminoglycans (GAGs) called heparin reduced the S uptake by 30% to 60% in the HBVMC and the HBVP cells, while no such change was observed in the hCMEC/D3 cells. Anti-ganglioside 1 (GM1) antibody (αGMI) also reduced the S protein uptake by 60% to 80% in the three cell types. Moreover, the decrease in uptake observed in the presence of both αACE2 and αGM1 antibodies was similar to that observed with αGM1 alone.

Furthermore, in the hCMEC/D3 cells, an increased S uptake of 1.5, 1.9, and 2.8 times was noted for mutations found in SARS-CoV-2 variants of concern, including D614G, N501Y, and E484K, respectively, as compared to the WT S protein. In the HBVP cells, while D614G showed no difference in uptake, an increase of 1.7 times was found for both N501Y and E484K mutants. Lastly, in the HBVSMC cells, an increase of 3.2, 5.0, and 3.8 times was observed in the uptake of the D614G, N501Y, and E484K mutants.  

Conclusion

To summarize, the study findings showed that the mechanism of SARS-CoV-2 S protein uptake via the GM1/lipid raft is crucial as the inhibition of this entry point can serve as a potential target against SARS-CoV-2 infections.

Study evaluates mutation-induced SARS-CoV-2 spike protein fold stability

Authors: Tarun Sai Lomte Mar 24 2022 BioRxiv

In a recent study posted to the bioRxiv* preprint server, researchers evaluated the stability and expression of mutations in the spike (S) protein of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2).

Study: Stability and expression of SARS-CoV-2 spike-protein mutations. Image Credit: Design_Cells/Shutterstock
Study: Stability and expression of SARS-CoV-2 spike-protein mutations. Image Credit: Design_Cells/Shutterstock

Background

The coronavirus disease 2019 (COVID-19) pandemic caused by SARS-CoV-2 has resulted in extensive research into S protein. Its evolution introduces several variations in the protein surface that negatively affect the efficiency of antibodies elicited by vaccines. The virus requires the S protein for host cell entry, and vaccines against SARS-CoV-2 are designed with S protein as the target. The prominent presence of anti-S antibodies in a population might induce selection pressure in the virus to modify its S protein structure to evade vaccine- or infection-induced antibodies. Such antigenic drifts drive the emergence of novel variants with persistent challenges. Moreover, understanding the effects of evolution requires knowledge of the protein’s structure.

The study

The present study assessed whether protein expression levels might serve as a proxy for fold stability. The principal objective was to examine whether expression and ACE2- receptor-binding domain (RBD) binding measured experimentally could relate to the thermodynamic stability of the RBD mutants.

Expression data on the effect of RBD point mutations on ACE2 binding and yeast expression were previously reported. The impact of mutations on expression levels was calculated as the log mean fluorescence intensity difference relative to wildtype. The effect on ACE2 binding was determined from the apparent dissociation constants difference relative to the wildtype.

The free energy change of protein folding (ΔΔG­) was computed using three in silico methods: Deep DDG, SimBa-IB, and mutation cutoff scanning matrix (mCSM) protein stability. In its apostate determined by cryo-electron microscopy, eight experimental structures of S protein were obtained from the protein data bank (PDB). SimBa-IB program calculated the mutated sites’ relative solvent accessible surface area (RSA), and the ΔΔG­ and RSA values were reported as average values.

Results

The authors observed that the effect of mutations on ACE2 binding and expression was strongly correlated. Moreover, the expression levels could affect binding constants even at the same level of ACE2 affinity. The free energy or stability changes were predicted and later compared with binding and expression changes observed experimentally using the three computational methods. The stability effects, as computed, observed that mutations in the 388 – 390 stretch had an impact on the stability of the protein.

Related Stories

The effect of the mutation at each site was calculated as the mean absolute effect of 19 mutations as a surrogate of tolerance at each mutant site. Expression-affecting mutations were mainly inside the core RBD subdomain, particularly the central beta-sheet with the alpha-helices flanking it. The mutations affecting ACE2 binding were primarily observed in the ACE2 binding subdomain or the central beta-sheet.

The mutations affecting the stability of the protein were observed in the structured core of the RBD. RBD mutations affected its expression, binding, and stability differentially, although some overlap between protein expression and stability was observed. Next, the authors quantified the relationship by plotting predicted ΔΔG­ values against the changes observed in the expression and ACE2 binding of RBD for all mutations and each experimental structure with three methods.

RBD expression and ΔΔG­ for individual structures were correlated with varying magnitudes based on the type of prediction. Similarly, ACE2 binding and ΔΔG­ were associated to varying degrees based on the prediction method; nonetheless, the correlations (for binding) were weaker than that for expression, and the observed correlations were statistically significant.

The effects of mutations on protein stability correlated well with ACE2 binding and protein expression, better with the Deep DDG prediction. The expression and binding results were skewed, over-representing data points between 0 and -1. Therefore, the data were grouped into bins; each bin’s mean binding and expression effect and predicted stability energy values were calculated. The research team noted an increase of correlations upon binning, and it is noteworthy that the computational data correlated well with the binned experimental data.

Lastly, the study reported that mutations deeply buried in the protein core have a more significant effect on protein stability. Similar was the case observed for RBD, in which mutations in the core were less tolerated than those on or near the surface. A moderate correlation was observed when the effect of mutations on the binding and expression was studied regarding the surface exposure of RBD residues with a noticeable tolerance overall at sites with increased solvent exposure.

Conclusions

The current study’s findings demonstrated that the computed protein stability effects were significantly correlated with expression levels for all 48 comparative investigations, but to a certain extent with ACE2 binding. Further, there was a correlation between predicted stability changes and surface exposure.

Therefore, experimental mutational properties could be predicted, at least partly, and the phenotypes might correlate because of underlying correlators such as amino acid properties, site solvent exposure, and codon usage. Such correlations impact the S protein’s mutability, affecting phenotype tradeoffs and viral evolution.

ACE2-independent infection of T lymphocytes by SARS-CoV-2

Authors: Xu-Rui ShenRong GengQian LiYing ChenShu-Fen LiQi WangJuan MinYong YangBei LiYong YangBei LiRen-Di JiangXi WangXiao-Shuang ZhengYan ZhuJing-Kun JiaXing-Lou YangMei-Qin LiuQian-Chun GongYu-Lan ZhangZhen-Qiong GuanHui-Ling LiZhen-Hua ZhengZheng-Li ShiHui-Lan ZhangKe Peng & Peng Zhou 

Signal Transduction and Targeted Therapy volume 7, Article number: 83 (2022) 

Abstract

SARS-CoV-2 induced marked lymphopenia in severe patients with COVID-19. However, whether lymphocytes are targets of viral infection is yet to be determined, although SARS-CoV-2 RNA or antigen has been identified in T cells from patients. Here, we confirmed that SARS-CoV-2 viral antigen could be detected in patient peripheral blood cells (PBCs) or postmortem lung T cells, and the infectious virus could also be detected from viral antigen-positive PBCs. We next prove that SARS-CoV-2 infects T lymphocytes, preferably activated CD4 + T cells in vitro. Upon infection, viral RNA, subgenomic RNA, viral protein or viral particle can be detected in the T cells. Furthermore, we show that the infection is spike-ACE2/TMPRSS2-independent through using ACE2 knockdown or receptor blocking experiments. Next, we demonstrate that viral antigen-positive T cells from patient undergone pronounced apoptosis. In vitro infection of T cells induced cell death that is likely in mitochondria ROS-HIF-1a-dependent pathways. Finally, we demonstrated that LFA-1, the protein exclusively expresses in multiple leukocytes, is more likely the entry molecule that mediated SARS-CoV-2 infection in T cells, compared to a list of other known receptors. Collectively, this work confirmed a SARS-CoV-2 infection of T cells, in a spike-ACE2-independent manner, which shed novel insights into the underlying mechanisms of SARS-CoV-2-induced lymphopenia in COVID-19 patients.

Introduction

Since its emergence in December 2019, SARS-CoV-2, the etiology of coronavirus disease 2019 (COVID-19), quickly spread to the majority of countries in the world and posed great threats to public health. The virus shares 79.5% genome identity with SARS-CoV-1 and also uses angiotensin-converting enzyme 2 (ACE2) as a cell entry receptor.1,2,3,4,5 Typical clinical symptoms of COVID-19 patients include fever, fatigue, dry cough, and pneumonia, whereas around 20% of the severe cases may die of multi-organ failure.6,7,8,9

Apart from the respiratory system, multiple organs including the immune system of COVID-19 patients were also targeted by SARS-CoV-2 infection. Notably, lymphopenia was observed in 83.2% of the patients on admission, and fatal infections were associated with more severe lymphopenia over time.6,7,8 Lymphocytes (particularly T cells) play a central role in the human immune system, a decrease of which would result in immune suppression and serious complications.10 It has been proposed that viral-induced lymphopenia might be due to direct infection, cytokine-mediated cell death, tissue sequestration of lymphocytes, or suppression of the bone marrow or thymus for T-cell generation.11 In the case of MERS-CoV, apoptosis induced by direct viral infection of T cells has been observed in vitro, which possibly explained lymphopenia in MERS patients.11 SARS-CoV-1 viral particles were also observed in multiple leukocytes from an autopsy study, suggesting that direct infection might account for the decrease in lymphocytes.12 Similarly, SARS-CoV-2 particles or proteins were also found in the spleen and lymph nodes from a study of 91 deceased COVID-19 cases, suggesting an infection of lymphocytes.13 Furthermore, in COVID-19 immune landscape depicted by single-cell RNA-seq studies, SARS-CoV-2 viral RNA has been found in multiple immune cells, including myeloid cells with phagocytic activity (neutrophil and macrophage) and lymphocytes without phagocytic activity (T, B, and NK cells).14,15 Notably, SARS-CoV-2 RNA-positive immune cells did not co-express the entry factors ACE2 and TMPRSS2, or other hypothesized entry co-factors.14,15 It is speculated that cell-associated SARS-CoV-2 viral positivity may represent a mixture of replicating virus, immune cell engulfment, and virions or virally infected cells attached to the cell surface.14,15

It has been shown that SARS-CoV-2-infected human monocytes, monocyte-derived macrophages, and dendritic cells in vitro, which potentially plays a major role in COVID-19 pathogenesis.16,17 However, whether SARS-CoV-2 infects lymphocytes, which do not express ACE2, to result in lymphopenia is still unknown. This knowledge gap also brings difficulty for our understanding of how lymphocytes lost the ability to control viral infection. Here, we provided evidence that activated T lymphocytes could be infected by SARS-CoV-2 in an ACE2-independent manner. The infection leads to pronounced T-cell apoptosis in vitro or in patients with COVID-19. Our findings shed light on the understanding of SARS-CoV-2 infection-induced lymphopenia.

Results

Presence of SARS-CoV-2 in lymphocytes from patients with COVID-19

Multiple immune cell types, including lymphocytes, have been shown enriched for SARS-CoV-2 viral RNA in multiple single-cell RNA-seq studies.14,15 To determine whether SARS-CoV-2 infects lymphocytes, we analyzed peripheral blood cells (PBCs) collected from COVID-19 patients. PBCs were prepared from 22 patients, who were all at severe condition during the study along with 15 healthy donors. We first analyzed major lymphocyte cell types including T (CD4 + helper T and CD8 + cytotoxic T), B, and natural killer (NK) cells for their population changes or the presence of viral antigen upon infection. For all patients tested, the ratios of blood T lymphocytes declined significantly compared to those in healthy donors, whereas B and NK cells appeared to be unaffected (Fig. 1a). Notably, CD4 + and CD8 + T lymphocytes almost declined to zero in some patients (Fig. 1b). The results suggested that lymphopenia in these patients is likely attributed to a decline of T lymphocytes.

figure 1
Fig. 1

We then analyzed the presence of SARS-CoV-2 viral antigens in PBCs using flow cytometry or by immunofluorescence assay (IFA). The results suggested that T lymphocytes were infected and in certain patient CD4 + T cells showed a high infection rate (Supplementary Fig. S1a). We also confirmed the presence of viral antigen in T lymphocytes from patient blood by immunofluorescence analysis (IFA) (Fig. 1c). Furthermore, we prepared postmortem lung sections from patients with a fatal infection and analyzed T lymphocytes infiltration and virus infection. We found T lymphocytes infiltration in the lung section, and many T lymphocytes were also positive for SARS-CoV-2 NP staining, indicating virus infection (Fig. 1d). A similar finding has also been reported.13 Taken together, we showed the presence of SARS-CoV-2 viral antigen in T lymphocytes either in the blood or in the lung section from the COVID-19 patients.

To further corroborate these findings, virus isolation was attempted from viral NP-positive PBCs. Patient PBCs were collected, determined for viral antigen using flow cytometry, and then co-cultured with Caco2 cells after three washes. Positive detection of viral RNA in the supernatant or viral protein in the Caco2 cells after co-culture indicated successful isolation and amplification of SARS-CoV-2 from PBCs of some COVID-19 patients (3 out of 5) but not from the healthy control (Supplementary Fig. S1b–e). Notably, in the three viral isolation positive samples, two also showed viral positive in the flow cytometry assay (P2 and P4), while the third one (P5) likely carried infectious virus at a level that was under the detection limit of flow cytometric analysis. Above all, we observed SAR-CoV-2 viral RNA and viral protein, and likely infectious virus in T lymphocytes from COVID-19 patients.

SARS-CoV-2 infection of T cells in vitro

Since T lymphocytes population decreased in COVID-19 patients and CD4 + T lymphocytes showed a high viral antigen-positive rate, we then investigated whether SARS-CoV-2 infects CD4 + T lymphocytes. For this purpose, we conducted a serial of experiments to test whether SARS-CoV-2 infects T cells. Upon infection, both viral RNA detection targeting at the receptor-binding domain (RBD) and viral subgenomic mRNA (sgRNA) targeting at M gene were tested. Viral sgRNA is transcribed only in infected cells during viral replication and is not packaged into virions, and therefore indicates the presence of actively infected cells in samples. Viral nucleocapsid protein (NP) and viral particles were also detected using western blot (WB), flow or electron microscopy (EM). Jurkat or MT4 cells, two commonly used CD4 + T cell lines, and primary T cells isolated from healthy donors were infected with SARS-CoV-2 (Fig. 2a). In some experiments, T cells were also activated by Phorbol myristate acetate (PMA) for 2 h for Jurkat cells or by a combination of IL2 + CD3 + CD28 for 3 days for primary T cells before infection, considering a large proportion of T cells is activated in human (Supplementary Fig. S2).

figure 2
Fig. 2

At 0, 24, 48, and 72 h post infection, it was observed that SARS-CoV-2-infected Jurkat T-cell line in a time-dependent manner, and the infection was more robust in activated T cells. Accumulation of viral RNA and sgRNA in cells or viral RNA in the culture supernatant was observed (Fig. 2b). Next, we sought to determine whether the qPCR detection assay represents only partial viral genome replication. We performed RNA-seq analysis of the SARS-CoV-2-infected activated Jurkat T cells at 0 or 24 h p.i. and analyzed the viral reads depth and coverage across the viral genome. Compared to 0 h infected, a much higher depth of viral genomes (as high as 5000 reads depth) can be observed in the 24 h-infected cells, demonstrating an effective replication (Fig. 2c). We then determined viral antigens by WB and flow assay. Our results showed a time-dependent increased level of viral NP in cells or in the supernatant, similar to the findings in viral RNA detection (Fig. 2d, e). We further employed electron microscopy to analyze SARS-CoV-2 infection of T-cell lines. Activated Jurkat or MT4 cells were infected with SARS-CoV-2 for 72 h and viral particles with typical coronavirus morphology were observed in the cytoplasm of the infected cells (Fig. 2f). Finally, to corroborate the findings from T-cell lines, we tested the infectivity of primary T cells isolated from healthy donors. In the three donors, SARS-CoV-2 showed time-dependent infection of T cells that is peaked at 8 h, probably because of extensive cell death induced by the virus at this time point (discussed below). Activation sensitized the cells to SARS-CoV-2 infection in two of the three donors. As comparison, primary colon organoid was also infected, which showed much higher infection efficiency compared to T cells (Fig. 2g, h). Taken together, our data clearly show that SARS-CoV-2 could infect T cells in vitro, although at a lower efficiency compared to tissue cells.

SARS-CoV-2 infection of T cells is ACE2 and TMPRSS2-independent

It is generally believed that ACE2 is the entry receptor for SARS-CoV-2. However, major cell populations in PBCs express extremely low levels of ACE2, raising the question whether ACE2 also mediates SARS-CoV-2 virus entry of T cells. We first tested whether an ACE2 knockdown could dampen SARS-CoV-2 infection of T cells. The data showed ACE2 was successfully knocked down by ACE2-shRNAs in Caco2 cells. Jurkat T cells do not express detectable ACE2 under either mock or knocked down conditions (Fig. 3a). Correspondingly, ACE2 knockdown resulted in dramatically decreased SARS-CoV-2 infection in Caco2 cells but not in Jurkat T cells (Fig. 3b). To further confirm this finding, we did ACE2 knocked out in Caco2 and Jurkat cells (Fig. 3c). Similar to ACE2-knockdown cells, viral load decreased in Caco2-ACE2-KO cells but not in Jurkat-ACE2-KO cells (Fig. 3d). These results suggested that SARS-CoV-2-infected T cells in an ACE2-independent manner.

figure 3
Fig. 3

It was reported that soluble human ACE2 protein could block SARS-CoV-2 infection through competing virus binding with the cellular receptor.3 Thus, ACE2 antibody pre-incubated cells or spike antibody pre-incubated SARS-CoV-2 should also block viral infection, if the infection depends on spike-ACE2 binding. To analyze whether these molecules affect SARS-CoV-2 infection of T cells, we incubated virus with soluble human ACE2 protein or a commercial mAb targeting at RBD-ACE2 binding, or incubated cells with ACE2 blocking antibody before the infection of Caco2 or activated Jurkat T cells. The intracellular viral RNA was analyzed after infection. In Caco2, the three blockers strongly blocked SARS-CoV-2 infection, and ACE2 protein appears to be more potent than the other two treatments. In contrast, none of the three treatments affected the SARS-CoV-2 infection of Jurkat T cells (Fig. 3e).

Lastly, it is known that SARS-CoV-2 uses the serine protease TMPRSS2 for S protein priming before binding to ACE2 receptor, and a TMPRSS2 inhibitor has been approved for clinical use (Camostat) to block SARS-CoV-2 entry.1 The RNA expression of TMPRSS2 in Caco2, Jurkat, and activated Jurkat cells was determined by qPCR. The result suggested that neither unactivated nor activated Jurkat cell-expressed TMPRSS2 (Fig. 3f). We observed that Camostat inhibited SARS-CoV-2 infection of Caco2 cells in a dose-dependent manner. At a dose of 20 μm, Camostat almost completely blocked viral infection of Caco2 cells. In contrast, Camostat showed no inhibitory effect on SARS-CoV-2 infection of Jurkat T cells even at a high dose (Fig. 3g). Collectively, these results suggested that SARS-CoV-2 infection of T cells does not rely on the spike-ACE2/TMPRSS2 interaction.

SARS-CoV-2 infection triggered T-cell death

It is known that severe patients with COVID-19 showed marked decreased lymphocyte populations. To determine whether SARS-CoV-2 infection contributes to T-cell death, we tested PBC T lymphocytes apoptosis collected from patients with COVID-19. T lymphocytes from patients or from healthy donors were dual-labeled with a CD3 antibody and a viral NP antibody, and apoptosis was analyzed with the TUNEL assay. T lymphocytes from COVID-19 patients underwent pronounced apoptosis compared to those from the healthy donors, showing a more than tenfold increase of apoptotic cells. In some patients, most of the apoptotic cells were also viral antigen-positive (e.g., 65% in patient 1), suggesting viral infection played a role in peripheral blood T lymphocytes death in these patients (Fig. 4a).

figure 4
Fig. 4

To confirm the role of viral infection in T-cell death, we experimentally infected primary T cells isolated from healthy donors. With or without activation, cells were experimentally infected with SARS-CoV-2 for 8 h and apoptosis was analyzed with TUNEL assay. It can be observed that SARS-CoV-2 infection induced pronounced apoptosis in infected T cells compared with the mock-treated cells. Activation sensitized T cell to viral infection, as shown by higher apoptotic cells in the activated group (Fig. 4b).

Finally, we determined the cellular responses in T cells upon SARS-CoV-2 infection by bulk RNA-seq analysis. Activated Jurkat T cells were infected with SARS-CoV-2 for 0, 24, 48, and 72 h before they were collected for TUNEL assay. It can be observed that virus induced significant apoptosis at 72 h post infection, compared to mock-infected or cells at other time points (Fig. 4c). We then determined the dynamic cellular responses in cells that have been infected for 24 or 48 h, as the cells in 72 h groups contained too many dead cells and were not suitable for RNA-seq analysis. Compared to the 24 h group, the hypoxia-related GO pathways are significantly upregulated in 48 h group, including “PID HIF1 TF pathway”, “response to hypoxia”, “positive regulation of cell death”, and “intrinsic apoptotic signaling pathway”. It has been shown that SARS-CoV-2 infection triggers mitochondrial ROS production, which induces stabilization of hypoxia-inducible factor-1a (HIF-1a) in monocytes.16 Similarly in T cells, multiple genes involved in this oxidative stress response were upregulated: BNIP3, PFKFB3, FOS, JUN, BHLHE40, GADD45B, PDK1, and DDIT4 (Fig. 4d). To corroborate the findings in T cell lines, we conducted RNA-seq analysis to primary peripheral blood mononuclear cells (PBMCs) collected from three healthy donors and three severe COVID-19 patients. Our data showed an upregulation of cell responses to stimuli, cell death, or response to hypoxia pathways, and a down-regulation of leukocytes activation and signaling pathways, similar to the findings in the T-cell line (Fig. 4e). In summary, SARS-CoV-2 infection induced pronounced T-cell death, which is probably dependent on mitochondria ROS-hypoxia pathways.

Exploration of potential receptors in T cells

Since our results suggested that the infection of SARS-CoV-2 to Jurkat T cell is ACE2-independent, we tried to identify the potential receptors. We first explored the expression of the known SARS-CoV-2 receptors or co-factors that have been identified in primary T cells from public single-cell NGS data14 and in Jurkat T cells in RNA-seq analysis with or without activation, including ACE2/TMPRSS2, AXL, NRP1, KIM-1/TIM-1, ASGR1, and KREMEN1.18,19,20 Moreover, ITGB2 (leukocyte-associated molecule-1, LFA-1), the leukocyte cell Adhesion molecule, has been suggested binding to SARS-CoV-1 ORF7a.21 As SARS-CoV-2 shares similar ORF7a as SARS-CoV-1, it would be interesting to evaluate whether LFA-1 also mediated SARS-CoV-2 infection of T cells.

Our data showed minimal expression of the following molecules in SARS-CoV-2-positive T cells from patients: ACE2, TMPRSS2, ASGR1, KREMEN1, and NRP1 (Fig. 5a and Supplementary Fig. S3a). In contrast, AXL and LFA-1 were expressed in these cells. In Jurkat cells, LFA-1 also showed very high expression, although it was not upregulated following a 2 h activation (Supplementary Fig. S3b). Taken together, AXL and LFA-1 appeared to be promising targets as entry molecules.

figure 5
Fig. 5

AXL was proposed to be a candidate receptor for SARS-CoV-2 in a previous study and the function in mediating SARS-CoV-2 infection is independent of ACE2.19 BEAS-2B that was used as a positive control for AXL-SARS-CoV-2 studies was pretreated with AXL proteins of different concentrations (25, 50, 100 μg/ml) for 30 min and then infected with SARS-CoV-2. The infection of SARS-CoV-2 could be significantly inhibited by AXL protein at a concentration of 25 μg/ml. In contrast, SARS-CoV-2 infection of Jurkat cells could not be inhibited even at 100 μg/ml (Fig. 5b). Next, we constructed AXL-knockdown or overexpression cell lines on Jurkat cells and then tested the effect on viral infection. Our data showed that AXL knockdown could not block SARS-CoV-2 infection, but an AXL overexpression could slightly enhance the infection (1.5-fold) (Fig. 5c). Taken together, AXL should not be a main receptor for SARS-CoV-2 in Jurkat cells but it may contribute to infection.

LFA-1 is widely expressed on the surface of many leukocytes, and T-cell activation changed the structure of LFA-1 to a high-affinity mode, but not expression level.22 We then overexpressed the high-affinity alpha subunit of LFA-1 protein in ACE2 knockdown Caco2 cells (Caco2-ACE2-shRNA) and Jurkat cells. Our qPCR data showed that the LFA-1 overexpression successfully restored the dampened infection in ACE2 knockdown Caco2 cells, and also enhanced viral infection in Jurkat cells (threefold increase), as shown in cellular viral RNA levels (Fig. 5d, e). To corroborate the finding, we also performed IFA to detect viral NP expression. After an 8 h infection, viral NP-positive cells were compared. Our data showed a dampened SARS-CoV-2 infection in ACE2-knockdown cells, and a much higher NP in LFA-1 overexpression ACE2-knowckdown cells (Fig. 5f, g).

Finally, the LFA-1-knockdown Jurkat cell line was constructed and infected by SARS-CoV-2 (MOI = 0.01). At a 24 h post infection, viral load in the knockdown cell line was significantly decreased compared to the control cell line (Fig. 5h). Lifitegrast, an inhibitor that blocked LFA-1 binding to its extracellular ligand, was also used to pretreat activated Jurkat cells before infection. The qPCR results showed that at a concentration of 200 nM, Lifitegrast could also reduce the viral load in Jurkat cells (Fig. 5i). Collectively, our results suggested that LFA-1 should be an attachment factor or potential entry molecular for SARS-CoV-2 during its infection in Jurkat cells.

Discussion

Here, we showed that SARS-CoV-2 infected T lymphocytes, mainly CD4 + T cells, in an ACE2-independent manner. SARS-CoV-2 infection triggered pronounced T-cell death, which potentially contributed to lymphopenia in patients with COVID-19. T-cell infection may also pose profound influences on patients. Infected T lymphocytes not only lost the ability to control viral infection but may also carry viruses to other parts of the body through blood circulation. In addition, this ACE2-independent infection mode may compromise the therapeutic effect of neutralizing antibodies targeting at spike-ACE2 binding. These may synergistically result in more severe infection outcomes in patients with COVID-19.

It has been debated whether SARS-CoV-2 impaired the functionality of immune cell populations through direct infection. Our results provided evidence to show that SARS-CoV-2-infected T cells, as viral RNA, viral sgRNA, viral protein, and the infectious virus could be detected from T cell upon infection or from patient PBCs, although the production of infectious virus particles may stay at a low level. Several recent studies also revealed that multiple immune cells carry viral antigen or viral RNA, including neutrophils, macrophages, inflammatory monocytes, plasma B cells, T cells, and NK cells through postmortem histology analysis and single-cell/single-nuclear RNA-seq to lung or BALF.13,14,15 This suggests that SARS-CoV-2 should have a broad tropism of target cells, including major immune cells populations.

Human ACE2 and TMPRSS2 proteins were recognized as the main proteins that mediated SARS-CoV-2 cell entry.14 The newly discovered binding molecules AXL and NRP1 are still dependent on ACE2 as the main receptor.18,19 Our discovery of ACE2-independent infection of T cells is surprising, but is also supported by previous discoveries that there are SARS-CoV-2 RNA+ cells which did not co-express ACE2 and TMPRSS2.15 In our data, SARS-CoV-2 showed significant infection of activated T cells, suggesting there should be a new entry mechanism in T cells. The identification of LFA-1, as an entry molecule that contributed to a SARS-CoV-2 infection of T cells would be important for developing clinical therapeutics, although future questions remain. For example, what is the LFA-1 binding protein in SARS-CoV-2 virion if it is not the spike protein. Since LFA-1 is expressed in a number of other leukocytes, it can be expected that other immune cells (including macrophages or monocytes) could also be infected by SARS-CoV-2 potentially through binding with LFA-1. These questions should be addressed in future studies.

The infection of CD4 + T lymphocytes by SARS-CoV-2 virus may be a major contributor of virus induced pathogenesis. Armed T cells play a pivotal role against pathogen infection.10 As shown in our data, these T cells are likely to be targets of SARS-CoV-2 infection and undergo apoptosis in the HIF-1a-dependent pathway. These events may lead to T-cell dysfunction, depletion, and eventually lymphopenia in patients. In addition, the dying CD4 + T lymphocytes could trigger excessive inflammation that leads to severe immunopathogenesis in patients. Notably, the population of CD8 + T lymphocytes is also significantly decreased in COVID-19 patients. Unlike CD4 + T lymphocytes, these cells were not determined to contain SARS-CoV-2 viral antigen in flow cytometry. The mechanism underlying SARS-CoV-2 infection-induced CD8 + T lymphocytes depletion is currently unknown. Besides viral infection, several mechanisms, including the presence of endogenous or exogenous glucocorticoids, over-activated neutrophil releasing inhibitors of T cell activation (Arginase 1 and CD274) and cytokine-regulated selective differentiation of bone marrow cells, might also contribute to lymphocytes depletion.11,23 Further in-depth investigation is needed to address the potentially multi-mode mechanisms that lead to lymphopenia in the COVID-19 patients. Considering the apparent correlation between lymphopenia and disease progression in COVID-19 patients, it is important to develop strategies to prevent virus-induced lymphopenia.

Materials and methods

Samples and ethics

Human blood and tissue samples from patients with COVID-19 or from healthy donors were collected by Tongji hospital with consent from all persons. Fresh lung biopsy sections were prepared from a deceased patient. The ethics committee of the designated hospitals for emerging infectious diseases approved all human samplings.

Cell lines and virus culture

Vero E6, Caco2, 293T-sg, GP2-293, and BEAS-2B in DMEM + 10% FBS, or MT4 and Jurkat T cells in RPMI1640 + 10% FBS (Gibco, C22400500BT), or A549 cells in DMEM/F12 + 10% FBS, or primary T cells in X-vivo (Lonza, 04-418Q) medium containing IL-2 (Peprotech, 200-02) were cultured at 37 °C in a humidified atmosphere of 5% CO2. All cell lines were tested free of mycoplasma contamination and applied to species identification and authenticated by microscopic morphologic evaluation. None of cell lines was on the list of commonly misidentified cell lines (by ICLAC). SARS-CoV-2 isolate WIV04 (GISAID accession number EPI_ISL_402124) was used in this study. WIV04 was isolated from Huh7 cells from the original sample and was passaged in Caco2 cells. Viral titer (TCID50/ml) was determined in Vero E6 cells.

Proteins and antibodies for SARS-CoV-2

SARS-CoV-2 strain WIV04 NP and predicted RBD were inserted into pCAGGS vector with an N-terminal S-tag. Constructed plasmids were transiently transfected into HEK293T-17. Supernatant collected for protein purification was purified using S-tag resin, the purity and yield were tested using anti-S-tag mAb (generated in-house). Rabbits were immunized with purified NP proteins three times at a dose of 700 ng/each, 2 weeks interval. Rabbit serum was collected at 10 days after the final immunization. Antibody titer was determined in an ELISA using purified NP protein as a detection antigen.

Peripheral blood cells (PBCs) preparation and SARS-CoV-2 infection

The blood samples from patients with COVID-19 or healthy donors were processed in BSL3 lab at WIV. In all, 1× RBC lysis buffer was made from eBioscience™ 10× RBC Lysis Buffer before the experiment (Multi-species, Invitrogen). Human blood samples were centrifuged at 500 × g for 10 min before being treated with 2 ml 1× RBC lysis buffer for no more than 15 min at room temperature. Cells were spun down at 500 × g for 10 min, followed by treatment using 2 ml 1× RBC lysis buffer for another 10 min at room temperature to remove the residue red blood cells. Cells were ready for use after centrifugation. Cells were spin washed (500 × g for 10 min each time) three times with PBS containing 2% BSA before staining of cell marker antibodies.

For infection, PBCs were seeded into 24-well plates in Roswell Park Memorial Institute 1640 culture medium (RPMI1640, ThermoFisher, 22400500BT) supplemented with 10% fetal bovine serum (FBS, Life Technologies, 10099141) at a density of 1 × 106 cells/ml. PBCs were infected with SARS-CoV-2 at 0.1 MOI. One hour after incubation, cells were spin washed for three times using RPMI1640. PBCs were then seeded with RPMI1640 supplemented with 10% FBS in new 24-well plates at 37 °C supplied with 5% CO2 for 12 h or 24 h before being collected for further analysis.

For IFA on patient PBCs, overnight fixed cells were evenly smeared over a glass coverslip. The presence of viral NP was detected with rabbit pAb against the SARS-CoV-2 NP protein (generated in-house, 1:1000) and a Cy3-conjugated goat anti-rabbit IgG (1:200, Abcam, ab6939). T lymphocytes were detected using a rabbit anti-human CD3 antibody (1:100, Abcam, ab5690). Nuclei were stained with DAPI (Beyotime, C1002). Staining patterns were examined using confocal microscopy on a FV1200 microscope (Olympus).

For immunohistochemistry analysis on patient lung, the biopsy tissues from a deceased patient were fixed with 4% paraformaldehyde for 24 h, paraffin-embedded and cut into 5-μm sections. Multiplex immunofluorescence staining was obtained using PANO 7-plex IHC kit (0004100100, Panovue, Beijing, China). Slides were deparaffinized and rehydrated, followed by 15-min heat-induced antigen retrieval with EDTA pH 9.0. The slides were washed with PBS/0.02% Triton X-100 then blocked with 10% BSA at RT for 30 min, rabbit pAb against the SARS-CoV-2 NP protein (generated in-house, 1:1000) and rabbit anti-human CD3 antibody (1:100, Abcam, ab5690) were then used in incubation at 37 °C 1 h, followed by horseradish peroxidase-conjugated secondary antibody incubation and tyramide signal amplification. The slides were microwave heat-treated after each TSA operation. Nuclei were stained with 4’-6’-diamidino-2-phenylindole (DAPI, Beyotime, C1002) at the final stage of staining. To obtain multispectral images, the stained slides were scanned using the Mantra System (PerkinElmer). The scans were combined to build a single stack image. Unstained images and single-stained sections were used to extract the spectrum of autofluorescence of tissues or each fluorescein, respectively. The extracted images were further used to establish a spectral library required for multispectral immixing by InForm image analysis software (PerkinElmer). Using this spectral library, we obtained reconstructed images of sections with the autofluorescence removed.

PBCs co-cultured with Caco2 cells

PBCs from five patients were washed three times with PBS before co-cultured with Caco2 cells for 4 days and tested for SARS-CoV-2 viral RNA in the supernatant or antigen in Caco2 cells. In the meantime, PBCs were analyzed for the presence of viral antigen by flow cytometry.

Human colon organoids culture and SARS-CoV-2 infection

Human colon organoids were generated and cultured as described in the previous study.24 Briefly, colon organoids in matrigel were digested and washed twice with medium before infection. SARS-CoV-2 was added to infect colon organoids at an MOI of 0.01. 24 h later, colon organoids were then spun down and washed twice with medium. Viral RNA in colon organoids was determined by qPCR.

Activation of Jurkat and primary T cells

To activate Jurkat cells, 2.5E + 06 of cells were seeded to a well of a six-well plate containing 2.5 ml of RPMI1640 medium containing 10% FBS. In total, 40 ng/ml of PMA (Invivogen, tlrl-pma) was added to cells and incubated at 37 °C for 2 h. Cells were centrifuged at 300 × g at room temperature for 10 min before discarding the supernatant and cultured with fresh RPMI1640 medium containing 10% FBS. Primary human CD3 T lymphocytes were isolated from blood of healthy donors using CD3 Microbeads of Human (Miltenyi, 130-050-101). To activate primary T cells, frozen T cells were thawed and cultured with X-vivo (Lonza, 04-418Q) containing 1 μg/ml of IL-2 (Peprotech, 200-02). Cells were cultured with a volume of 7.5 μl of T Cell TransAct (Miltenyi Biotec) in the medium for 3 days at 37 °C. Cells were then spun down and cultured with fresh IL-2/X-vivo medium before viral infection.

T-cells infection

Jurkat T cells or primary human CD3 T lymphocytes were infected with SARS-CoV-2 at a MOI of 0.01, 0.1, or 1 depending on the purpose of the experiment. Supernatant or cells were harvested at 0, 24, 48, or 72 hpi after three times PBS washing for Jurkat T cells, or 0, 4, 8, and 12 hpi for primary T cells. Cellular or supernatant viral RNA or protein expression was determined by qPCR, RNA-seq, WB, or flow cytometry. GAPDH was used in qPCR as internal control and beta-tubulin was used in WB (1:5000, 66240-1-Ig from Proteintech) as an internal control.

Flow cytometry analysis of human peripheral blood samples

For surface staining, PBCs were incubated with fluorochrome-labeled antibodies specific for humans before fixation: AF-700-anti-CD45 (2D1), percp-anti-CD19 (HIB19), APC/CY7-anti-CD3 (UCHT1), BV510-anti-CD4 (OKT4) and percp/Cy5.5-anti-CD8a (HTT8a). Antibody-stained PBCs were fixed overnight with 4% PFA at 4 °C and taken out of BSL3 lab for downstream analysis. Cells were stained further with in-house-made SARS-CoV-1 NP pAb (1:500) at 4 °C for 30 min after permeabilization. Then cells were stained with FITC-anti-Rabbit IgG (H + L) at room temperature for 30 min. AF-700-anti-CD45 (2D1), APC/CY7-anti-CD3 (UCHT1), BV510-anti-CD4, and percp/Cy5.5-anti-CD8a antibodies were purchased from Biolegend and all were used at 1:100. FITC-anti-Rabbit IgG (H + L) was from Proteintech (SA00003-2).

RNA extraction and qPCR

Whenever commercial kits were used, the manufacturer’s instructions were followed without modification. RNA was extracted from 140 μl of samples with the QIAamp® Viral RNA Mini Kit (QIAGEN). RNA was eluted in 50 μl of elution buffer and used as the template. The qPCR detection of SARS-CoV-2 was performed using HiScript® II One-Step qPCR SYBR® Green Kit plus One-Step qPCR Probe kit targeting at either M for sgRNA (designed in house) or RBD of spike gene (commercial) following the instructions of the manufacturer (Q222-CN, Vazyme Biotech Co., Ltd). QPCR was run in a Step-One Plus real-time PCR machine (ABI) machine using default settings.

SARS-CoV-2 genome depth and coverage analysis

RNA was extracted from SARS-CoV-2 24 h-infected activated Jurkat T cells with the RNAprep Pure Cell/Bacteria Kit (TIANGEN, DP430). RNA was eluted in 50 μl of elution buffer and used as the template for RNA-seq. Clean reads were mapping to SARS-CoV-2 genome (WIV04) using software HISAT2 v2.1.0. After sorted and indexed with samtools v1.10-24, the coverage was calculated using genomeCoverageBed function from bedtools v2.29.2.

Transcriptome analysis

The SARS-CoV-2 24 h- and 48 h-infected Jurkat T cells (3 replicates each), blood samples from three healthy donors, and 3 severe COVID-19 patients were subjected for RNA-seq analysis. After mapping clean reads to GRCh38.p13 with HISAT2 v2.1.0 and format conversion with samtools v1.10-24, we used stringtie v2.1.0 to assemble and quantitate transcripts. Reads counts table of transcriptome generated by prepDE.py, a tool in stringtie, was used for gene differential expression analysis in R v4.1.0 with package DESeq2 v1.32.0. The gene with log2 fold change >2 and P value <0.05 was selected to perform enrichment analysis using online tools Metascape.

Public single-cell NGS data analysis

Public single-cell NGS data were downloaded, COVID-19 patients’ data were downloaded from GSE15805514 and healthy donors’ data were from GSE134355 (human cell landscape). According to the original information of each article, we extracted data of primary T cells from lung, thymus, and peripheral blood of healthy donors and virus-positive T cells of COVID-19 patients. Following the standard Seurat v4.0.4 workflow, we normalized the data and scaled it with UMI information. The expression of candidate receptors or co-factors was visualized with Seurat function FeaturePlot.

Western blot (WB) analysis

Infected or transduced cells were harvested at the indicated time point and lysed with RIPA Lysis Buffer (Beyotime, P0013C) for WB. Proteins in cell lysates were then separated on 10–12% SDS-polyacrylamide gel electrophoresis (PAGE) and further transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, SLHVR33RB). Blots were incubated with rabbit polyclonal anti-ACE2 (Servicebio, GB11267, 1:1000 dilution), rabbit polyclonal anti-2019-nCoV NP (1:1000 dilution), mouse monoclonal anti-beta-tubulin (Proteintech, 66240-1-Ig, 1:5000 dilution), and then appropriate rabbit or mouse peroxidase-conjugated secondary antibodies (Proteintech, 1:5000 dilution, SA00001-2, or SA00001-1). Immobilon western chemiluminescent HRP substrate (Millipore, WBKLS0500) was used for protein detection.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay

The TUNEL Assay kit purchased from Beyotime Biotechnology (C1088) was used to detect apoptosis in SARS-CoV-2-infected cells according to the manufacturer’s instructions. Briefly, cells fixed in 4% paraformaldehyde were permeabilized with 0.25% Triton X-100 for 20 min at 4 °C. Then the TdT reaction mixture containing TdT enzyme and fluorescent labeling solution was added to the cells to label the fragmented DNA. Cells were further stained with Rp3-CoV NP pAb (1:8000) or Rabbit anti-SARS-CoV-2 NP pAb (1:500) and CY3-anti-Rabbit IgG (H + L) (Proteintech, SA00009-2) after fixation. Labeled cells were analyzed with a flow cytometer (BD LSRFortessa).

ACE2 competition inhibition and antibody blocking experiments

Human recombinant full-length ACE2-Fc protein (GenScript, Z03484), Anti-ACE2 Ab (R&D, AF933) and RD#4-anti-Spike Ab (house-made monoclonal antibodies) were used. ACE2-Fc protein was diluted to 20 μg/μl in culture medium and then incubated with SARS-CoV-2 virus solution (MOI = 0.01) at a volume of 1:1 at 37 °C for 30 min. The RD#4-anti-Spike Ab was diluted to 320 ng/μl in culture medium and then incubated with SARS-CoV-2 virus solution (MOI = 0.01) at a volume of 1:1 at 37 °C for 30 min. The virus-ACE2 or virus–antibody mixtures were then added to Jurkat cells or Caco2 cells. Cells were collected for further analysis at 24 h post infection. For anti-ACE2 antibody blocking experiments, Jurkat cells or Caco2 cells were pretreated with 3.33 ng/μl anti-ACE2 antibody (R&D Systems, goat, AF933) at 37 °C for 30 min before infection.

Generation of KO, KD, overexpression cell lines

KO, KD, and overexpression plasmids were constructed on different vectors (pLenti-V2 for knockout, pLKO.1 vector for knockdown, and pQCXIH vector for overexpression). Knockout of ACE2 was accomplished by transduction of Caco2 and Jurkat cells with lentiviruses expressing specific sgRNAs targeting ACE2 (F: CACCG GCCTCCATCGATATTAGCAA; R: AAAC TTGCTAATATCGATGGAGGCC).

Knockdown of ACE2, AXL, LFA-1 was accomplished by transduction of Caco2 or Jurkat cells with lentiviruses expressing specific siRNAs (ACE2: 5′-GCCGAAGACCTGTTCTATCAA-3′; AXL: 5′- CCTGTGGTCATCTTACCTT-3′; LFA-1: 5′-GCCATCAATTATGTCGCGACA-3′ or scramble siRNA).

Then the transduced cells were cultured with puromycin (5 μg/ml for Caco2 or 1.5 μg/ml for Jurkat) for 7 days.

For overexpression, the full length of AXL or domain I of LFA-1 alpha subunit were amplified from Hep G2 cells or Jurkat cells respectively. Lentivirus transduced cells were cultured with hygromycin (35 μg/ml for Caco2 and Jurkat cells) for 7 days. For the infection, virus was added to the cells until the end of the experiment with 0.01 MOI. Infected cells were harvested at 24 hpi after twice washing with PBS. Intracellular viral protein expression was determined by western blotting assay with antibody against virus NP protein and viral RNA in the cytoplasm was determined by qPCR.

TMPRSS2 blocking assay

Camostat mesylate (MCE, HY-13512-10 mM) was diluted to a final concentration of 20 μM or 2 μM. In total, 100 μl (for a 48-well plate) or 200 μl (for a 24-well plate) of Camostat solutions were added to cells. One hour later, activated Jurkat and Caco2 cells were infected with SARS-CoV-2 at 0.01 MOI. The cell lysate was harvested at 24 hpi and viral RNA in the cytoplasm was determined by qPCR. Viral NP was analyzed by western blot.

Candidate receptor proteins competition inhibition experiments

Recombinant Human AXL Protein (MedChemExpress, HY-P7622) was diluted to different concentrations with culture medium and then incubated with SARS-CoV-2 virus (MOI = 0.01) at a volume of 1:1 at 37 °C for 30 min. Mixtures were then added to infect activated Jurkat cells and BEAS-2B cells. Samples were harvested at 24 hpi and cellular viral RNA was determined by qPCR.

LFA-1 inhibition experiment

Lifitegrast (MedChemExpress, HY-19344) was diluted to different concentrations and pretreated activated Jurkat cells at 37 °C before infection. Thirty minutes later, cells were infected with SARS-CoV-2 (MOI = 0.01) and samples were harvested at 24 hpi. Viral RNA in the cytoplasm was determined by qPCR.

Electron microscopy

Activated Jurkat and MT4 cells were infected with the SARS-CoV-2 (MOI = 1) for 72 h. Cells were collected and fixed with 2.5% (w/v) glutaraldehyde and 1% osmium tetroxide, dehydrated through a graded series of ethanol concentrations (from 30 to 100%), and embedded with epoxy resin. Ultrathin sections (80 nm) of embedded cells were prepared, deposited onto Formvar-coated copper grids (200 mesh), stained with uranyl acetate and lead citrate, and analyzed using a 200-kV Tecnai G2 electron microscope.

Statistical analysis

Data analyses were performed using GraphPad Prism 7.0 software. Data were shown as mean ± SD. Data were analyzed with Shapiro–Wilk normality test and confirmed to the Gaussian distribution. Statistical analysis was performed using Student’s t test with two-tailed, 95% confidence. P values less than 0.05 were considered statistically significant.

Data availability

Data presented in this study are available on request from the corresponding authors. The data are not publicly available due to limitations in the material transfer agreement.

References

  1. Hoffmann, M. et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell 181, 271–280 e278 (2020).CAS Article Google Scholar 
  2. Li, W. et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 426, 450–454 (2003).CAS Article Google Scholar 
  3. Monteil, V. et al. Inhibition of SARS-CoV-2 infections in engineered human tissues using clinical-grade soluble human ACE2. Cell 181, 905–913 e907 (2020).CAS Article Google Scholar 
  4. Wang, Q. et al. Structural and functional basis of SARS-CoV-2 entry by using human ACE2. Cell 181, 894–904 e899 (2020).CAS Article Google Scholar 
  5. Zhou, P. et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579, 270–273 (2020).
  6. Guan, W. J. et al. Clinical characteristics of coronavirus disease 2019 in China. N. Engl. J. Med. 382, 1708–1720 (2020).CAS Article Google Scholar 
  7. Huang, C. et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 395, 497–506 (2020).CAS Article Google Scholar 
  8. Wang, D. et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in Wuhan, China. JAMA 323, 1061–1069 (2020).CAS Article Google Scholar 
  9. Xu, Z. et al. Pathological findings of COVID-19 associated with acute respiratory distress syndrome. Lancet Respir. Med. 8, 420–422 (2020).CAS Article Google Scholar 
  10. Kumar, B. V., Connors, T. J. & Farber, D. L. Human T cell development, localization, and function throughout life. Immunity 48, 202–213 (2018).CAS Article Google Scholar 
  11. Chu, H. et al. Middle east respiratory syndrome coronavirus efficiently infects human primary T lymphocytes and activates the extrinsic and intrinsic apoptosis pathways. J. Infect. Dis. 213, 904–914 (2016).CAS Article Google Scholar 
  12. Gu, J. et al. Multiple organ infection and the pathogenesis of SARS. J. Exp. Med. 202, 415–424 (2005).CAS Article Google Scholar 
  13. Bian, X. W., COVID-19 Pathology Team. Autopsy of COVID-19 victims in China. Natl Sci. Rev. 7, 1414–1418 (2020).CAS Article Google Scholar 
  14. Ren, X. et al. COVID-19 immune features revealed by a large-scale single-cell transcriptome atlas. Cell 184, 1895–1913 e1819 (2021).CAS Article Google Scholar 
  15. Delorey, T. M. et al. COVID-19 tissue atlases reveal SARS-CoV-2 pathology and cellular targets. Nature 595, 107–113 (2021).CAS Article Google Scholar 
  16. Codo, A. C. et al. Elevated glucose levels favor SARS-CoV-2 infection and monocyte response through a HIF-1alpha/glycolysis-dependent axis. Cell Metab. 32, 498–499 (2020).CAS Article Google Scholar 
  17. Zheng, J. et al. Severe acute respiratory syndrome coronavirus 2-induced immune activation and death of monocyte-derived human macrophages and dendritic cells. J. Infect. Dis. 223, 785–795 (2021).CAS Article Google Scholar 
  18. Cantuti-Castelvetri, L. et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science 370, 856–860 (2020).CAS Article Google Scholar 
  19. Wang, S. et al. AXL is a candidate receptor for SARS-CoV-2 that promotes infection of pulmonary and bronchial epithelial cells. Cell Res. 31, 126–140 (2021).CAS Article Google Scholar 
  20. Gu, Y. et al. Receptome profiling identifies KREMEN1 and ASGR1 as alternative functional receptors of SARS-CoV-2. Cell Res. 32, 24–37 (2022).CAS Article Google Scholar 
  21. Hanel, K. & Willbold, D. SARS-CoV accessory protein 7a directly interacts with human LFA-1. Biol. Chem. 388, 1325–1332 (2007).Article Google Scholar 
  22. Mao, D., Lu, S., Li, N., Zhang, Y. & Long, M. Conformational stability analyses of alpha subunit I domain of LFA-1 and Mac-1. PLoS ONE 6, e24188 (2011).CAS Article Google Scholar 
  23. Darcy, C. J. et al. Neutrophils with myeloid derived suppressor function deplete arginine and constrain T cell function in septic shock patients. Crit. Care. 18, R163 (2014).Article Google Scholar 
  24. Crespo, M. et al. Colonic organoids derived from human induced pluripotent stem cells for modeling colorectal cancer and drug testing. Nat. Med. 23, 878–884 (2017).CAS Article Google Scholar 

OPINION

Here’s how to detox from the COVID spike protein – from the jab or the virus


Spike proteins can circulate in your body after infection or injection, causing damage to cells, tissues and organs, but the World Council for Health has compiled a list of medications to prevent this.

Thu Dec 23, 2021 – 10:38 am EST

Note: This article is an opinion and the treatments that are recommended in it have not been proven as an effective means to eliminate the spike protein from COVID or mRNA vaccines. Damage to endothelial linings of vessels and organs by the COVID-19 spike protein and how to reverse it requires new research and randomized clinical trials to determine if any treatment can detox the body of the spike protein that causes Long-haul diseases.

STORY AT-A-GLANCE

  • If you had COVID-19 or received a COVID-19 injection, you may have dangerous spike proteins circulating in your body
  • Spike proteins can circulate in your body after infection or injection, causing damage to cells, tissues and organs
  • The World Council for Health has released a spike protein detox guide, which provides straightforward steps you can take to potentially lessen the effects of toxic spike protein in your body
  • Spike protein inhibitors and neutralizers include pine needles, ivermectin, neem, N-acetylcysteine (NAC) and glutathione
  • The top 10 spike protein detox essentials include vitamin D, vitamin C, nigella seed, quercetin, zinc, curcumin, milk thistle extract, NAC, ivermectin and magnesium

(Mercola) – Have you had COVID-19 or received a COVID-19 injection? Then you likely have dangerous spike proteins circulating in your body. While a spike protein is naturally found in SARS-CoV-2, no matter the variant, it’s also produced in your body when you receive a COVID-19 shot. In its native form in SARS-CoV-2, the spike protein is responsible for the pathologies of the viral infection.

In its wild form it’s known to open the blood-brain barrier, cause cell damage (cytotoxicity) and, as Dr. Robert Malone – the inventor of the mRNA and DNA vaccine core platform technology – said in a commentary on News Voice, the protein “is active in manipulating the biology of the cells that coat the inside of your blood vessels — vascular endothelial cells, in part through its interaction with ACE2, which controls contraction in the blood vessels, blood pressure and other things.”

It’s also been revealed that the spike protein on its own is enough to cause inflammation and damage to the vascular system, even independent of a virus.

Now, the World Council for Health (WCH) – a worldwide coalition of health-focused organizations and civil society groups that seek to broaden public health knowledge – has released a spike protein detox guide, which provides straightforward steps you can take to potentially lessen the effects of toxic spike protein. You can view their full guide of natural remedies, including dosages, at the end of this article.

Why should you consider a spike protein detox?

Spike proteins can circulate in your body after infection or injection, causing damage to cells, tissues and organs. “Spike protein is a deadly protein,” Dr. Peter McCullough, an internist, cardiologist and trained epidemiologist, says in a video. It may cause inflammation and clotting in any tissue in which it accumulates.

For instance, Pfizer’s biodistribution study, which was used to determine where the injected substances end up in the body, showed the COVID spike protein from the shots accumulated in “quite high concentrations” in the ovaries.

Further, a Japanese biodistribution study for Pfizer’s jab found that vaccine particles move from the injection site to the blood, after which circulating spike proteins are free to travel throughout the body, including to the ovaries, liver, neurological tissues and other organs. WCH noted:

“The virus spike protein has been linked to adverse effects, such as: blood clots, brain fog, organizing pneumonia, and myocarditis. It is probably responsible for many of the Covid-19 [injection] side effects … Even if you have not had any symptoms, tested positive for Covid-19, or experienced adverse side effects after a jab, there may still be lingering spike proteins inside your body.

In order to clear these after the jab or an infection, doctors and holistic practitioners are suggesting a few simple actions. It is thought that cleansing the body of spike protein … as soon as possible after an infection or jab may protect against damage from remaining or circulating spike proteins.”

Spike protein inhibitors and neutralizers

A group of international doctors and holistic practitioners who have experience helping people recover from COVID-19 and post-injection illness compiled natural options for helping to reduce your body’s spike protein load. The following are spike protein inhibitors, which means they inhibit the binding of the spike protein to human cells:

Prunella vulgarisPine needles
EmodinNeem
Dandelion leaf extractIvermectin

Ivermectin, for example, docks to the SARS-CoV-2 spike receptor-bending domain attached to ACE2, which may interfere with its ability to attach to the human cell membrane. They also compiled a list of spike protein neutralizers, which render it unable to cause further damage to cells. This includes:

N-acetylcysteine (NAC)Glutathione
Fennel teaStar anise tea
Pine needle teaSt. John’s wort
Comfrey leafVitamin C

The plant compounds in the table above contain shikimic acid, which may counteract blood clot formation and reduce some of the spike protein’s toxic effects. Nattokinase, a form of fermented soy, may also help to reduce the occurrence of blood clots.

How to protect your ACE2 receptors and detox IL-6

Spike protein attaches to your cells’ ACE2 receptors, impairing the receptors’ normal functioning. This blockage may alter tissue functioning and could be responsible for triggering autoimmune disease or causing abnormal bleeding or clotting, including vaccine-induced thrombotic thrombocytopenia.

 SUBSCRIBE TO OUR DAILY HEADLINES US Canada Catholic

Ivermectin, hydroxychloroquine (with zinc), quercetin (with zinc) and fisetin (a flavonoid) are examples of substances that may naturally protect your ACE2 receptors. Ivermectin works in this regard by binding to ACE2 receptors, preventing the spike protein from doing so.

Interleukin 6 (IL-6) is a proinflammatory cytokine that is expressed post-injection, and its levels increase in people with COVID-19. It’s for this reason that the World Health Organization recommends IL-6 inhibitors for people who are severely ill with COVID-19. Many natural IL-6 inhibitors, or anti-inflammatories, exist and may be useful for those seeking to detox from COVID-19 or COVID-19 injections:

Boswellia serrata (frankincense)Dandelion leaf extract
Black cumin (Nigella sativa)Curcumin
Krill oil and other fatty acidsCinnamon
FisetinApigenin
QuercetinResveratrol
LuteolinVitamin D3 (with vitamin K)
ZincMagnesium
Jasmine teaSpices
Bay leavesBlack pepper
NutmegSage

How to detox from Furin and Serine Protease

To gain entry into your cells, SARS-CoV-2 must first bind to an ACE2 or CD147 receptor on the cell. Next, the spike protein subunit must be proteolytically cleaved (cut). Without this protein cleavage, the virus would simply attach to the receptor and not get any further.

“The furin site is why the virus is so transmissible, and why it invades the heart, the brain and the blood vessels,” Dr. Steven Quay, a physician and scientist, explained at a GOP House Oversight and Reform Subcommittee on Select Coronavirus Crisis hearing.

The existence of a novel furin cleavage site on SARS-CoV-2, while other coronaviruses do not contain a single example of a furin cleavage site, is a significant reason why many believe SARS-CoV-2 was created through gain-of-function (GOF) research in a laboratory. Natural furin inhibitors, which prevent cleavage of the spike protein, can help you detox from furin and include:

  • Rutin
  • Limonene
  • Baicalein
  • Hesperidin

Serine protease is another enzyme that’s “responsible for the proteolytic cleavage of the SARS-CoV-2 spike protein, enabling host cell fusion of the virus.” Inhibiting serine protease may therefore prevent spike protein activation and viral entry into cells. WCH compiled several natural serine protease inhibitors, which include:

Green teaPotato tubers
Blue green algaeSoybeans
N-acetyl cysteine (NAC)Boswellia

Time-restricted eating and healthy diet for all

In addition to the targeted substances mentioned above, WCH was wise to note that a healthy diet is the first step to a healthy immune system. Reducing your consumption of processed foods and other proinflammatory foods, including vegetable (seed) oils, is essential for an optimal immune response.

Time-restricted eating, which means condensing your meals into a six- to eight-hour window, is also beneficial. This will improve your health in a variety of ways, primarily by improving your mitochondrial health and metabolic flexibility. It can also increase autophagy, which helps your body clear out damaged cells. As noted by WCH:

“This method … is used to induce autophagy, which is essentially a recycling process that takes place in human cells, where cells degrade and recycle components. Autophagy is used by the body to eliminate damaged cell proteins and can destroy harmful viruses and bacteria post-infection.”

Another strategy to boost your health and longevity, and possibly to help detox spike protein, is regular sauna usage. As your body is subjected to reasonable amounts of heat stress, it gradually becomes acclimated to the heat, prompting a number of beneficial changes to occur in your body.

These adaptations include increased plasma volume and blood flow to your heart and muscles (which increase athletic endurance) along with increased muscle mass due to greater levels of heat-shock proteins and growth hormone. It’s a powerful detoxification method due to the sweating it promotes.

Top 10 spike protein detox essentials and the full guide

Below you can find WCH’s full guide of useful substances to detox from toxic spike proteins, including recommended doses, which you can confirm with your holistic health care practitioner. If you’re not sure where to start, the following 10 compounds are the “essentials” when it comes to spike protein detox. This is a good place to begin as you work out a more comprehensive health strategy:

Vitamin DVitamin C
NACIvermectin
Nigella seedQuercetin
ZincMagnesium
CurcuminMilk thistle extract

World Council for Health’s spike protein detox guide

SubstanceNatural Source(s)Where to GetRecommended Dose
IvermectinSoil bacteria (avermectin)On prescription0.4 mg/kg weekly for 4 weeks, then monthly
*Check package instructions to determine if there are contraindications prior to use
HydroxychloroquineOn prescription200 mg weekly for 4 weeks
*Check package instructions to determine if there are contraindications prior to use
Vitamin CCitrus fruits (e.g. oranges) and vegetables (broccoli, cauliflower, brussels sprouts)Supplement: health food stores, pharmacies, dietary supplement stores, online6-12 g daily (divided evenly between sodium ascorbate (several grams), liposomal vitamin C (3-6 g) & ascorbyl palmitate (1–3 g)
Prunella Vulgaris (commonly known as self-heal)Self-heal plantSupplement: health food stores, pharmacies, dietary supplement stores, online7 ounces (207 ml) daily
Pine NeedlesPine treeSupplement: health food stores, pharmacies, dietary supplement stores, onlineConsume tea 3 x daily (consume oil/resin that accumulates in the tea also)
NeemNeem treeSupplement: health food stores, pharmacies, dietary supplement stores, onlineAs per your practitioner’s or preparation instructions
Dandelion Leaf ExtractDandelion plantSupplement (dandelion tea, dandelion coffee, leaf tincture): natural food stores, pharmacies, dietary supplement stores, onlineTincture as per your practitioner’s or preparation instructions
N-Acetyl Cysteine (NAC)High-protein foods (beans, lentils, spinach, bananas, salmon, tuna)Supplement: health food stores, pharmacies, dietary supplement stores, onlineUp to 1,200 mg daily (in divided doses)
Fennel TeaFennel plantSupplement: health food stores, pharmacies, dietary supplement stores, onlineNo upper limit. Start with 1 cup and monitor body’s reaction
Star Anise TeaChinese evergreen tree (Illicium verum)Supplement: health food stores, pharmacies, dietary supplement stores, onlineNo upper limit. Start with 1 cup and monitor body’s reaction
St John’s WortSt John’s wort plantSupplement: health food stores, pharmacies, dietary supplement stores, onlineAs directed on supplement
Comfrey LeafSymphytum plant genusSupplement: health food stores, pharmacies, dietary supplement stores, onlineAs directed on supplement
Lumbrokinase
Serrapeptidase
Or Nattokinase
Natto (Japanese soybean dish)Supplement: health food stores, pharmacies, dietary supplement stores, online2-6 capsules 3-4 times a day on empty stomach one hour before or two hours after a meal
Boswellia serrataBoswellia serrata treeSupplement: health food stores, pharmacies, dietary supplement stores, onlineAs directed on supplement
Black Cumin (Nigella Sativa)Buttercup plant familyGrocery stores, health food stores
CurcuminTurmericGrocery stores, health food stores
Fish OilFatty/oily fishGrocery stores, health food storesUp to 2,000 mg daily
CinnamonCinnamomum tree genusGrocery store
Fisetin (Flavonoid)Fruits: strawberries, apples, mangoes Vegetables: onions, nuts, wineSupplement: health food stores, pharmacies, dietary supplement stores, onlineUp to 100 mg daily Consume with fats
ApigeninFruits, veg & herbs parsley, chamomile, vine-spinach, celery, artichokes, oreganoSupplement: health food stores, pharmacies, dietary supplement stores, online50 mg daily
Quercetin (Flavonoid)Citrus fruits, onions, parsley, red wineSupplement: health food stores, pharmacies, dietary supplement stores, onlineUp to 500 mg twice daily, Consume with zinc
ResveratrolPeanuts, grapes, wine, blueberries, cocoaSupplement: health food stores, pharmacies, dietary supplement stores, onlineUp to 1,500 mg daily for up to 3 months
LuteolinVegetables: celery, parsley, onion leaves
Fruits: apple skins, chrysanthemum flowers
Supplement: health food stores, pharmacies, dietary supplement stores, online100-300 mg daily (Typical manufacturer recommendations)
Vitamin D3Fatty fish, fish liver oilsSupplement: health food stores, pharmacies, dietary supplement stores, online5,000–10,000 IU daily or whatever it takes to get to 60-80 ng/ml as tested in your blood
Vitamin KGreen leafy vegetablesSupplement: health food stores, pharmacies, dietary supplement stores, online90-120 mg daily (90 for women, 120 for men)
ZincRed meat, poultry, oysters, whole grains, milk productsSupplement: health food stores, pharmacies, dietary supplement stores, online11-40 mg daily
MagnesiumGreens, whole grains, nutsSupplement: health food stores, pharmacies, dietary supplement stores, onlineUp to 350 mg daily
Jasmine TeaLeaves of common jasmine or Sampaguita plantsGrocery store, health food storesUp to 8 cups per day
SpicesGrocery store
Bay LeavesBay leaf plantsGrocery store
Black PepperPiper nigrum plantGrocery store
NutmegMyristica fragrans tree seedGrocery store
SageSage plantGrocery store
RutinBuckwheat, asparagus, apricots, cherries, black tea, green tea, elderflower teaSupplement: health food stores, pharmacies, dietary supplement stores, online500-4,000 mg daily (consult health care provider before taking higher-end doses)
LimoneneRind of citrus fruits such as lemons, oranges, and limesSupplement: health food stores, pharmacies, dietary supplement stores, onlineUp to 2,000 mg daily
BaicaleinScutellaria plant genusSupplement: health food stores, pharmacies, dietary supplement stores, online100-2,800 mg
HesperidinCitrus fruitSupplement: health food stores, pharmacies, dietary supplement stores, onlineUp to 150 mg twice daily
Green TeaCamellia sinensis plant leavesGrocery storeUp to 8 cups of tea a day or as directed on supplement
Potatoes tubersPotatoesGrocery store
Blue Green AlgaeCyanobacteriaSupplement: health food stores, pharmacies, dietary supplement stores, online1-10 grams daily
Andrographis PaniculataGreen chiretta plantSupplement: health food stores, pharmacies, dietary supplement stores, online400 mg x 2 daily
*Check for contraindications
Milk Thistle ExtractSilymarinSupplement; Health food stores, pharmacies, dietary supplement stores, online200 mg x 3 daily
Soybeans (organic)SoybeansGrocery store, health food stores

Reprinted with permission from Mercola

The spike protein of SARS-CoV-2 induces endothelial inflammation through integrin α5β1 and NF-κB signaling

Authors: Juan Pablo Robles 1Magdalena Zamora 1Elva Adan-CastroLourdes Siqueiros-MarquezGonzalo Martinez de la EscaleraCarmen Clapp

Open AccessDOI:https://doi.org/10.1016/j.jbc.2022.101695

Vascular endothelial cells (ECs) form a critical interface between blood and tissues that maintains whole-body homeostasis. In COVID-19, disruption of the EC barrier results in edema, vascular inflammation, and coagulation, hallmarks of this severe disease. However, the mechanisms by which ECs are dysregulated in COVID-19 are unclear. Here, we show that the spike protein of SARS-CoV-2 alone activates the EC inflammatory phenotype in a manner dependent on integrin ⍺5β1 signaling. Incubation of human umbilical vein ECs with whole spike protein, its receptor-binding domain, or the integrin-binding tripeptide RGD induced the nuclear translocation of NF-κB and subsequent expression of leukocyte adhesion molecules (VCAM1 and ICAM1), coagulation factors (TF and FVIII), proinflammatory cytokines (TNF⍺, IL-1β, and IL-6), and ACE2, as well as the adhesion of peripheral blood leukocytes and hyperpermeability of the EC monolayer. In addition, inhibitors of integrin ⍺5β1 activation prevented these effects. Furthermore, these vascular effects occur in vivo, as revealed by the intravenous administration of spike, which increased expression of ICAM1, VCAM1, CD45, TNFα, IL-1β, and IL-6 in the lung, liver, kidney, and eye, and the intravitreal injection of spike, which disrupted the barrier function of retinal capillaries. We suggest that the spike protein, through its RGD motif in the receptor-binding domain, binds to integrin ⍺5β1 in ECs to activate the NF-κB target gene expression programs responsible for vascular leakage and leukocyte adhesion. These findings uncover a new direct action of SARS-CoV-2 on EC dysfunction and introduce integrin ⍺5β1 as a promising target for treating vascular inflammation in COVID-19.

Click The Link Below For Full Details:

https://www.jbc.org/action/showPdf?pii=S0021-9258%2822%2900135-1

COVID‐19‐induced endotheliitis: emerging evidence and possible therapeutic strategies

Authors: Eleonora Calabretta, 1 , 12 Jose M. Moraleda, 2 Massimo Iacobelli, 3 Ruben Jara, 4 Israel Vlodavsky, 5 Peter O’Gorman, 6 Antonio Pagliuca, 7 Clifton Mo, 8 Rebecca M. Baron, 9 Alessio Aghemo, 10 , 12 Robert Soiffer, 8 Jawed Fareed, 11 Carmelo Carlo‐Stella, 1 , 12 , * and Paul Richardson 8 , *

Br J Haematol. 2021 Apr; 193(1): 43–51.Published online 2021 Feb 4.  doi:  10.1111/bjh.17240 PMCID:  PMC8014053PMID: 33538335

Introduction

The coronavirus disease 2019 (COVID‐19) pandemic, a viral illness caused by the severe acute respiratory syndrome coronavirus‐2 (SARS‐CoV‐2), 1 has produced at the time of this writing nearly 33 million cases of infection, with over a million deaths in 235 countries, 2 causing an unprecedented burden on healthcare systems and a severe global socioeconomic crisis. As the pandemic spreads, knowledge on the disease course, as well as potential risk factors and predictors of severity is increasing daily, and initial data from randomised controlled studies have allowed care providers to refine therapeutic strategies. Nonetheless, mortality is markedly elevated among those presenting with severe disease, long‐term sequelae among survivors are unknown, and vaccine‐based therapies currently remain at early stages of development.

Most reported cases are asymptomatic or present with mild symptoms; however, 7–26% of hospitalised patients experience severe disease, often requiring admission to intensive care units (ICUs), with progressive multiple organ dysfunction and high mortality. 3 Such differences in clinical outcomes have led physicians to initiate diverse pharmacological therapies at various stages of the disease, generating challenges as to the most appropriate therapeutic choice for COVID‐19. In this context, the use of dexamethasone has significantly reduced mortality rates in critically ill patients requiring supplemental oxygen or mechanical ventilation, 6 and remdesivir has demonstrated clinical benefit in hospitalised patients, but with unknown survival benefit to date 7 ; additional effective treatment options are therefore urgently needed.

In an initial attempt to provide a uniform and widely reproducible methodology to guide systematic treatment strategies, a three‐stage classification of COVID‐19 has been proposed. 8 The Stage I or ‘early infection’ occurs at the initial establishment of disease with high viral replication, and commonly presents with a range of complaints that can include mild and often non‐specific influenza‐like signs and symptoms. Stage II is the ‘pulmonary phase’, with preferential viral‐mediated injury of the lung parenchyma and this is characterised by shortness of breath, hypoxia and pulmonary infiltrates with some degree of lung inflammation. Stage III is characterised by an exaggerated host immune‐inflammatory response to the virus, leading to acute respiratory distress syndrome (ARDS) and multi‐organ failure (MOF).Go to:

Endothelial cells are a preferential target of COVID‐19 resulting in widespread endotheliitis

Emerging evidence suggests that endothelial damage and subsequent morphological and functional changes in the endothelium play important roles in COVID‐19‐induced hyperinflammation. The virus, which binds to the angiotensin‐converting enzyme 2 (ACE2) receptor, 9 displays a profound tropism for human lung and small intestine epithelium, as well as the vascular endothelium. 10 In an important case series from Varga et al., 11 postmortem histology from three patients affected by late‐stage COVID‐19, revealed viral inclusions in endothelial apoptotic cells and microvascular lymphocytic endotheliitis, with infiltration of inflammatory cells around the vessels and endothelial cells (ECs), as well as evidence of endothelial apoptotic cell death in the lung, kidney, small bowel and heart. Additionally, autopsy findings of 27 patients in another series confirmed the detection of the SARS‐CoV‐2 in multiple organs, including the respiratory tract, pharynx, heart, liver, brain, and kidneys. 12 Immunofluorescence of kidney specimens from six of the 27 patients showed the presence of SARS‐CoV‐2 protein in all renal compartments, and in three of the patients preferentially in the endothelium of the glomerulus. Similar microscopic findings were also noted in lung specimens from seven patients with COVID‐19, which displayed small vessel endotheliitis, microvascular thrombosis and angiogenesis, along with the presence of SARS‐CoV‐2 in pulmonary ECs, an observation strongly supporting the vascular tropism of the virus. 13 Lastly, Stahl et al. 14 have identified in the plasma and serum of 19 critically ill patients with COVID‐19 evidence of disruption of the endothelial glycocalyx, reflected by increased levels of the Tie‐2 receptor and syndecan‐1 (SDC‐1), a heparan sulphate (HS) proteoglycan. This particular observation is of interest as the endothelial glycocalyx covers the luminal surface of ECs, and its integrity is vital for the maintenance of vascular homeostasis.

Such findings suggest that virus‐mediated apoptosis may promote endothelial barrier disruption with interstitial oedema and increased recruitment of circulating activated immune cells, thus causing widespread endothelial dysfunction, as well as activation of platelets and the coagulation cascade leading to venous and arterial thrombosis. 15 Altered pro‐inflammatory and pro‐thrombotic status is confirmed by the presence of elevated inflammation‐related indices (e.g. C‐reactive protein and serum ferritin), humoral biomarkers [interleukin (IL)‐2, IL‐6, IL‐7, granulocyte‐colony stimulating factor (G‐CSF), tumour necrosis factor‐alpha (TNF‐α)], and indicators of an increased pro‐coagulant‐fibrinolytic state [e.g. von Willebrand factor (VWF), D‐dimer, fibrinogen]. Further, factor VIII (FVIII), a potent and key factor in the coagulation process, is greatly increased in ICU patients with COVID‐19. 16

In this setting, it has been proposed that the systemic hyperinflammation observed in severe COVID‐19 is comparable to a cytokine release syndrome (CRS), or cytokine storm. IL‐6 has a central role in the generation of the cytokine storm, and is commonly elevated in the serum of severely ill patients with COVID‐19. 17 High levels of IL‐6 activate ECs, thus resulting in vascular leakage, further cytokine secretion and activation of the complement and coagulation cascades. 18 Interestingly, a population of IL‐6 producing monocytes was found to be expanded in the peripheral blood of ICU patients 19 and an aberrant macrophage response exhibiting increased levels of pro‐inflammatory cytokines has been detected in bronchoalveolar fluid, especially in severely ill patients. 20 Although the exact driver of monocyte activation remains unclear, such cells are attracted to the endothelium, where the release of highly noxious molecules, such as reactive oxygen species (ROS), contributes to endothelial dysfunction and promotes hyperinflammation. 21 Further, activated monocytes enhance tissue factor expression and form aggregates with platelets through P‐selectin interaction and hence augmenting the pro‐coagulant response. 22 Indeed, significantly increased levels of VWF and FVIII and thrombomodulin, 16 aberrant coagulation, thrombosis and microangiopathy are very common in critically ill patients with COVID‐19, resulting in a disseminated intravascular coagulation (DIC)‐like syndrome characterised by massive fibrin formation and organ dysfunction. 23 Likewise, adaptive immunity actively participates in the establishment of the inflammatory response; specifically, activated and proliferating CD8+ T cells are prevalent in mild COVID‐19, whereas critically ill patients display higher levels of hyperactive IL‐6‐producing CD4+ T cells, which may contribute to disease severity, even after viral clearance. 17 Interestingly, T cells show phenotypical signs of an exhausted, functionally unresponsive state, thus allowing viral escape from immune surveillance. 22 Once initiated, the endotheliitis and resultant cytokine storm become self‐sustaining, leading to widespread organ damage. Some patients may also display features of haemophagocytic lymphohistiocytosis, such as cytopenias, hyperferritinaemia and rapid onset of MOF.

Overall, once hyperinflammation and CRS develop, rates of mortality significantly increase. 24 25 26 As direct viral activation of the vascular endothelium has an important role in initiating and maintaining the hyperinflammatory response, attempting to blunt such a response with endothelial‐protective agents is a very rational strategy. Controlled clinical trials focussing on the use of anti‐cytokine antibodies, including tocilizumab (IL‐6 inhibitor), have failed to show significant activity in this stage of the disease. 27 However, increasing evidence suggests that the altered homeostasis of the endothelium may be a key initiating event in the pathogenesis of the disease, therefore representing a potentially more promising target. 28Go to:

Endothelial cell‐related disorders in haematology: post‐bone marrow transplantation syndromes and sickle cell disease and the overlap with the pathobiology of COVID‐19

Clinically and histopathologically, COVID‐19‐associated endotheliitis resembles a spectrum of post‐bone marrow and stem cell transplantation (BMT) syndromes characterised by disruption of endothelial homeostasis and consequently dysregulation of coagulation, vascular tone, endothelial permeability and vascular inflammation. 29 These disorders include hepatic veno‐occlusive disease (VOD)/sinusoidal obstruction syndrome (SOS), idiopathic pneumonia syndrome (IPS), transplant‐associated thrombotic microangiopathy and graft‐versus‐host disease (GvHD).

Hepatic VOD/SOS develops as a result of endothelial damage to hepatic sinusoids and subsequent hepatocyte necrosis 30 . Damage to the ECs leads to a hypercoagulable state, production of inflammatory mediators, and the upregulation as well as release of heparanase. 31 Heparanase degrades the heparan sulphate scaffold of the subendothelial basement membrane, consequently allowing the extravasation of blood‐borne cells, including activated T lymphocytes, neutrophils and macrophages. 32 This cascade of events leads to postsinusoidal hypertension, hyperinflammation and ultimately MOF. Severe VOD/SOS associated with MOF without effective therapy is fatal in >80% of cases. 33 Interestingly, the histopathological examination of lung lesions in VOD/SOS shows early alveolar epithelial and lung endothelial injury, resulting in accumulation of protein‐ and fibrin‐rich inflammatory oedematous fluid in the alveolar space and progression to interstitial fibrosis, 34 35 as is also seen in fatal COVID‐19 cases.

Similarly, IPS, a widespread alveolar injury in the absence of identifiable infectious or non‐infectious causes, is characterised by histological evidence of EC injury with fibrin accumulation, luminal thrombosis and fibrotic processes. Adhesion molecules, such as intercellular adhesion molecule 1 (ICAM‐1) and/or vascular cell adhesion molecule 1 (VCAM‐1), are commonly upregulated, thus reflecting profound endothelial activation. 36 It has been suggested that TNF‐α directly causes endothelial injury, and increased levels of angiopoietin‐2 (Ang‐2), have been recently reported in cases of acute exacerbations of IPS, 37 similar to that seen in severely ill patients with COVID‐19. 38

Likewise, multifactorial endothelial damage has been also implicated in the development of transplant‐associated thrombotic microangiopathy, where micro‐vessel intimal swelling and necrosis lead to the formation of luminal microthrombi and subsequent microangiopathic haemolytic anaemia. Plasma levels of markers of EC injury and inflammation, such as thrombomodulin, plasminogen activator inhibitor‐1 (PAI‐1), ICAM‐1, VCAM‐1, IL‐1, TNF‐α, interferon gamma and IL‐8 are commonly elevated. 39 40 Endothelial dysfunction predominantly affects the kidneys and the brain, but may become widespread and progress to MOF, which in turn is associated with high mortality.

Lastly, acute GvHD (aGvHD) develops as a consequence of the activation of the immune system. Antigen‐presenting cells become activated by endothelial and tissue damage derived from direct toxicity of the conditioning regimen, thus initiating an alloreactive T‐cell response directed against recipient tissues. 41 As a result, SDC‐1 is commonly elevated in the serum of patients with GvHD and correlates with disease severity. 42 In addition to cell‐mediated cytotoxic damage, the cytokine storm generated in response to T‐cell activation and proliferation causes targeted organ damage involving mainly the skin, liver and gut. 43 It has recently been suggested that endothelial vulnerability and pro‐thrombotic shift precedes clinically evident aGvHD and that angiogenesis driven by early endothelial activation is an initiating event. 44 Indeed, increased plasma levels of VWF, 45 Ang‐2 46 and TNF receptor 1 47 have been detected in patients prior to development of aGvHD, correlating with response to therapy.

Similarly, markers of endothelial dysfunction and inflammatory activation have been detected also in the serum of patients with sickle cell disease (SCD), especially during vaso‐occlusive episodes. SCD is characterised by a chronic course of relapsing‐remitting episodes of ischaemia and then reperfusion. The polymerisation of defective haemoglobin S upon deoxygenation initiates many pathological processes, such as complement activation, generation of ROS and pro‐thrombotic molecules, secretion of numerous pro‐inflammatory cytokines and chemokines and ultimately leucocyte recruitment. 48 Oxidative stress and endothelial dysregulation plays a key role in vaso‐occlusion; ECs activated by substances released by the haemolytic process and by red blood cell adhesion initiate production and release of soluble mediators such as IL‐1β, IL‐8, IL‐6, IL‐1α and PAI‐1, 49 50 and increase the expression of adhesion molecules such as VCAM‐1, ICAM‐1, E‐selectin and P‐selectin, 51 52 reflecting a pro‐inflammatory and pro‐thrombotic shift. Vaso‐occlusive phenomena commonly affect the lung vasculature, provoking acute chest syndrome (ACS), a spectrum of diseases ranging from mild pneumonia to ARDS and MOF, which is the leading cause of morbidity and mortality in SCD. 53 Lung specimens from ACS cases showed micro‐thrombotic occlusion, endothelial VWF deposition and arterial vessel re‐modelling with initial fibrotic processes, 54 fascinatingly all comparable to the histopathological findings in COVID‐19. 55 Importantly, heme‐mediated endothelial damage to alveolar cells is regulated by the p38 mitogen‐activated protein kinase (MAPK) pathway, which plays a crucial role in the biosynthesis of pro‐inflammatory cytokines and collagen production. 56 This key pathway is also upregulated in COVID‐19 as a result of decreased ACE2 tissue functionality consequent to viral binding, and may consequently promote endotheliitis, hypercoagulation and end‐stage fibrosis. 57 58

In summary, post‐BMT syndromes, vaso‐occlusive organ dysfunction in SCD and COVID‐19‐associated endotheliitis share common pathological mechanisms including: i) dysregulation of the homeostasis of the endothelial milieu toward a pro‐inflammatory and pro‐thrombotic phenotype with thrombotic microangiopathy; ii) hyperproduction of inflammatory cytokines such as IL‐6, IL‐8 and TNF‐α; 59 60 61 62 and iii) small vessel endotheliitis and endothelial barrier dysfunction, leading to oedema of the microvascular bed, protein and fibrin accumulation and subsequent fibrotic shift. 34 36 All these conditions if untreated irremediably lead to MOF and display similar microscopic and macroscopic features in target organs upon pathological examination. At the molecular level, the p38 MAPK pathway may also be critical in promoting vasoconstrictive and inflammatory phenomena; its activation is described in SCD, COVID‐19 and also as a result of conditioning regimen‐induced endothelial damage in BMT. 63 Together, these findings support the notion that the pleiotropic character of the endothelium as a key regulator of the internal homeostasis, vascular tone, blood coagulation and the inflammatory process and therefore of so called ‘immune‐thrombosis’ events, make it an intriguing therapeutic target for post‐BMT disorders, SCD, and COVID‐19.Go to:

Agents targeting EC‐related disorders

Heparins

Classically, heparins have been the most widely used drugs for the treatment and prevention of endothelial cell disorders. Several animal studies and clinical trials have suggested that, in addition to its well‐known anticoagulant effects, heparin also possesses anti‐inflammatory properties, mainly mediated by inhibition of IL‐6 release and its activity, 64 a phenomena also demonstrated in patients with COVID‐19 treated with low‐molecular‐weight heparin. 65 Further, heparin is structurally related to HS, 66 a negatively charged glycosaminoglycan as described earlier, which serves as binding sites for growth factors, cytokines, selectins, extracellular‐matrix molecules, and a large number of human viruses, 67 including the SARS‐CoV‐2 virus. 68 69 Indeed, Clausen et al. 70 have recently demonstrated that the SARS‐CoV‐2 spike protein must bind both the ACE2 receptor and HS to enter human cells. The structural analogies between heparin and HS may result in competitive inhibition, where heparin and related compounds compete with the cell surface HS for viral binding to target cells, 68 69 thus potentially blocking or at least attenuating viral entry. The beneficial effects of heparin‐based therapies are also linked to their inhibition of circulating heparanase enzymatic activity. 32 Heparanase, an endo‐β‐glucuronidase, physiologically cleaves HS chains located in extracellular matrices and on cell surfaces. 32 It is often overexpressed during viral infections and act as a regulator of virus release after replication has occurred, promoting its dissemination. 71 72 73 74 Additionally, it may be upregulated by pro‐inflammatory molecules such as IL‐1 and TNF‐α. Once activated, heparanase stimulates the expression and release of pro‐inflammatory cytokines, including TNF‐α, IL‐1 and IL‐6. 75 The enzyme has been implicated in cancer progression, inflammation, 76 VOD/SOS development 77 and other vascular pathologies. 71

Currently, numerous clinical trials are underway to investigate the therapeutic potential of intravenous and subcutaneous heparin, as well as the appropriate dose regimen in COVID‐19. Further, nebulised heparin delivered directly to the airways may be effective in preventing infection and mitigating lung disease (clinicaltrials.gov; NCT04545541NCT04511923). Notwithstanding their anticoagulant, anti‐inflammatory and anti‐viral properties, the use of heparins is associated with a substantially increased risk of systemic bleeding, and other challenging ‘off‐target’ effects, making its use potentially part of the standard of care, but not without qualification, as well as highlighting the need for combination approaches.

Defibrotide

The use of defibrotide (DF), which has both comparable but distinct properties from heparins and negligible haemorrhagic risk 78 may therefore be warranted, especially given the established propensity for the development of DIC later in the COVID‐19 clinical course. DF is a naturally derived, complex mixture of poly‐deoxyribonuleotides extracted originally from bovine lung and now exclusively from porcine gut mucosa. 79 80 Since its original isolation >30 years ago, DF has demonstrated locally acting pro‐fibrinolytic, 81 82 83 84 anti‐thrombotic, 85 86 anti‐ischaemic and anti‐inflammatory activities, which exert protective effects on small vessel endothelia. It is currently approved for the treatment of paediatric and adult hepatic VOD/SOS with MOF. 87 88 89 In this setting, DF has demonstrated efficacy and safety in critically ill patients with MOF, as well as a significant reduction in PAI‐1 and other markers of endothelial stress in patients with VOD/SOS and MOF successfully treated with DF. 89 90 91 Furthermore, in a pivotal Phase III trial, DF prophylaxis reduced the incidence and severity of VOD/SOS in high‐risk children undergoing BMT. 92 In a more recent study, Palomo et al. 93 demonstrated that DF directly interacts with the cell membrane and becomes internalised by ECs, thus providing physical evidence of its endothelial‐protective properties. In particular, DF appears to decrease levels of pro‐inflammatory proteins, such as TNF‐α, 94 IL‐6, vascular endothelial growth factor (VEGF) 95 and to downregulate major histocompatibility complex (MHC) Class I and Class II molecules, 96 97 therefore attenuating both the inflammatory and immune responses. Furthermore, it appears to decrease interaction between leucocytes and ECs by downregulating P‐selectin, 98 ICAM‐1 95 and VCAM‐1. 99 Lastly, DF displays potent adenosine agonism. 100 Such activity may be clinically relevant, not least based on substantial improvement observed in an animal model of acute lung injury upon treatment with adenosine receptor agonists. 101

Based on such properties, the use of DF can be reasonably extended to other post‐BMT syndromes and other microangiopathies involving CRS complicating a variety of disease states and treatment modalities, such as chimeric antigen receptor (CAR) T‐cell therapy. 102 Indeed, paediatric and adult patients receiving DF as VOD/SOS prophylaxis also exhibited a reduced incidence of aGvHD, 92 103 a finding that is strongly supported by a preclinical model of aGvHD. 99 Additionally, a retrospective survey from paediatric patients treated with DF for transplant‐associated thrombotic microangiopathy showed resolution of clinical disease in 77% of patients. 104 Currently, Phase II studies investigating the use of DF for prevention of transplant‐associated thrombotic microangiopathy and VOD, and in the same context the treatment of ACS are ongoing (clinicaltrials.gov; NCT03384693NCT03805581NCT02675959). Notably, DF suppresses the expression of heparanase transcripts, cell surface expression and enzymatic activity, 95 suggesting that DF may have anti‐viral properties, although this remains to be confirmed. 71 72 73 Heparanase is putatively upregulated by the cytokine storm of advanced COVID‐19 and may contribute to further inflammation, oedema of the microvascular bed and coagulopathy. 28 75 105 106 DF is a potent inhibitor of heparanase in terms of both cell surface and gene expression, and therefore is especially attractive. Furthermore, the therapeutic use of DF in a murine model of IPS significantly improved survival compared to untreated controls by reducing, among other biomarkers, the levels of Ang‐2, 107 which is known to correlate with ARDS and is markedly elevated in critically ill patients with COVID‐19. 38

In addition, ICU‐admitted patients with COVID‐19 may display increased platelet activation and subsequent formation of platelet‐monocyte aggregates upon interaction with P‐selectin, thus stimulating monocyte‐induced inflammation and thrombosis. 22 By reducing P‐selectin and other adhesion molecules expression, DF may inhibit monocyte‐derived inflammatory and pro‐coagulant signals. Lastly and most importantly, DF has also been shown to decrease the activity of p38 MAPK and its pathway, 93 the importance of which is increasingly recognised in the pathogenesis of the COVID‐19 hyperinflammation syndrome and this may be a key therapeutic target in this process. 58 108

In summary, the multitargeted endothelial‐based therapeutic properties of DF and its relative safety, as well as its regulatory approval, make it an ideal potential therapeutic candidate for the treatment of COVID‐19 vascular complications. 28 In contrast to heparin, DF also exhibits broader anti‐cytokine, anti‐inflammatory and endothelial‐stabilising properties. Importantly, by acting on the heparanase‐HS axis, 74 102 DF may limit viral infectivity given its capacity to i) compete with HS and thereby possibly inhibit virus–cell adhesion and entry, ii) inhibit heparanase enzymatic activity and thereby attenuate virus detachment/release and spread 74 and iii) inhibit heparanase‐mediated activation of immune cells and thereby upregulation of pro‐inflammatory cytokines and the associated self‐sustaining systemic inflammatory host response (Fig 1). Actively accruing, international Phase II clinical trials are now underway and should shed critical light on DF’s therapeutic potential in patients with COVID‐19 (examples include clinicaltrials.gov; NCT04348383NCT04335201). Strikingly, two critically ill paediatric patients treated with DF for a SARS‐CoV‐2‐associated multisystem inflammatory syndrome experienced complete resolution and no attributable toxicity, with correlative studies supporting the mechanistic effects described above, as well as favourable effects seen on complement activation. 109 Similarly, preliminary results from the current studies as part of the international DEFACOVID (Defibrotide as Prevention and Treatment of Respiratory Distress and Cytokine Release Syndrome of COVID‐19) study group support both safety and promising potential efficacy to date.Fig 1

Potential mechanisms of action of defibrotide in the treatment of COVID‐19. Left, defibrotide limits viral attachment by interfering with Syndecan‐1, the primary cell surface heparan sulfate on ECs, and reduces viral dissemination, by inhibiting HPSE‐mediated viral release. Right, effects of defibrotide on endothelial‐mediated pathological processes. Viral infection of ECs promotes apoptosis with breakdown of endothelial barrier and exposure of the subendothelium, with subsequent platelet activation and thrombotic phenomena. Defibrotide inhibits platelet activation and leukocyte recruitment and blocks the generation of the cytokine storm; specifically, HPSE‐mediated activation of immune cells is suppressed, thus limiting the development of cytokine release syndrome. Sars‐Cov‐2, severe acute respiratory syndrome coronavirus‐2; ACE2, angiotensin‐converting enzyme 2; Ang‐2, angiopoietin‐2; GI, gastrointestinal; IL, interleukin; NFKB, nuclear factor kappa‐light chain‐enhancer of activated B cells; TNF‐α, tumor necrosis factor‐alpha; VWF, von Willebrand Factor.

Other heparanase inhibitors

Given the heparanase‐inhibiting activity of heparin, effort has been directed towards modifications of its structure to endow candidate molecules with potentiated anti‐heparanase activity while limiting anticoagulant effects. Specifically, N‐acetylated and glycol‐split heparins are promising agents presenting such characteristics. Indeed, administration of N‐acetylheparin (NAH) in murine models of sepsis ameliorated lung and intestinal injury and subsequent oedema by reducing tissue neutrophilic infiltration and suppressing IL‐6, IL‐1β and TNF‐α production. 110 111 Furthermore, roneparstat, the most developed glycol‐split NAH, restored pathological renal cellular damage caused by ischaemia‐reperfusion by reducing release of pro‐inflammatory cytokines and reverted established fibrotic processes, thus restoring normal tissue histology in preclinical models. 112 This aspect is especially relevant, considering the extensive formation of fibrosis and irreversible end‐organ damage in post‐BMT syndromes, SCD and advanced COVID‐19.

Additionally, much interest has been directed towards the novel heparanase‐inhibiting agent pixatimod, a modified oligosaccharide glycoside with heparan sulphate‐mimetic properties. Pixatimod is a potent inhibitor of Type 1 T‐helper cells (Th1)/Th17 effector functions, 113 IL‐6 expression, 114 M2 macrophage activation, 115 angiogenesis and tumour progression in vivo. Furthermore, it exhibits mild anticoagulant activity and despite transient infusion reactions is otherwise generally well tolerated. Guimond et al. 116 have recently demonstrated that pixatimod interacts with the SARS‐CoV‐2 spike protein binding site, and this is coherent with its heparan sulphate‐mimetic activity. Moreover, pixatimod was found to markedly inhibit SARS‐CoV‐2 infectivity, 116 supporting its clinical application as a novel therapeutic intervention for prophylaxis and treatment of COVID‐19. Taken together, heparanase emerges as a host‐encoded virulence factor that once activated enhances viral spread and triggers downstream inflammatory cascades. These preliminary data indicate that heparanase inhibitors currently under development are possible candidates for multisystem inflammatory conditions, such as COVID‐19, sepsis, thrombotic microangiopathies and cancer, but as of now studies remain preclinical with clinical application pending.

Conclusions

In conclusion, increasing evidence suggests that the SARS‐CoV‐2 directly targets ECs, promoting the release of pro‐inflammatory and pro‐thrombotic molecules. Endothelial dysfunction appears to be a crucial initiating step in the pathogenesis of the disease and its ensuing morbidity and mortality. Endotheliitis with the hyperproduction of cytokines leading to CRS, hypercoagulability and thrombotic microangiopathy are hallmarks shared by COVID‐19, VOD/SOS and other endothelial injury syndromes, underpinned by inflammation and including the vaso‐occlusive crises of SCD, so providing a common pathobiology across these respective syndromes. Most importantly, endothelial‐protective agents, such as DF, represent a promising and rational therapeutic strategy in COVID‐19, with DF currently under investigation in a variety of settings and combinations. As a unifying concept, heparanase inhibition, with the modulation of related pathways and other effects on endothelial stress responses may thus be crucial in mediating anti‐viral and anti‐inflammatory activity. In particular, as this relates to endotheliitis, it may directly abrogate CRS and its sequelae, which in turn may lead to improved patient outcome.

Author Contributions

Eleonora Calabretta, Jose M. Moraleda, Israel Vlodavsky, Ruben Jara, Carmelo Carlo‐Stella and Paul Richardson drafted the manuscript; all authors participated in the critical revision and approval of the final report.Go to:

Conflict of interest

Jose M. Moraleda declares Advisory Board fees from Jazz Pharmaceuticals; Antonio Pagliuca has received Advisory Board and Speaker fees from Jazz Pharmaceuticals; Rebecca M. Baron is on a Merck Advisory Board and a Consultant for Genentech. Robert Soiffer serves on the Board of Directors for Kiadis and Be The Match/National Marrow Donor Program; provided consulting for Gilead, Rheos Therapeutics, Cugene, Precision Bioscience, Mana Therapeutics, VOR Biopharma, and Novartis; and Data Safety Monitoring Board for Juno/Celgene; Paul Richardson is an Advisory Committee Member for Jazz Pharmaceuticals; Carmelo Carlo‐Stella is a Consultant/Advisory Board Member for Genente Science srl, ADC Therapeutics, Novartis, Roche, Karyopharm, Sanofi, Boehringer Igelheim and Servier. The remaining authors declare nothing to disclose.

Acknowledgments

This work was supported in part by a grant from the Italian Association for Cancer Research (AIRC, grant #20575 to CC‐S).Go to:

Contributor Information

Carmelo Carlo‐Stella, Email: ue.deminuh@alletsolrac.olemrac.

Paul Richardson, Email: ude.dravrah.icfd@nosdrahcir_luap.Go to:

References

1. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395:497–506. [PMC free article] [PubMed] [Google Scholar]

2. World Health Orgnization (WHO) . Coronavirus disease (COVID‐19) pandemic. Available at: https://www.who.int. Accessed January 2021

3. Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus‐infected pneumonia in Wuhan, China. JAMA. 2020;323:1061–9. [PMC free article] [PubMed] [Google Scholar]

4. Onder G, Rezza G, Brusaferro S. Case‐fatality rate and characteristics of patients dying in relation to COVID‐19 in Italy. JAMA. 2020;323:1775–6. [PubMed] [Google Scholar]

5. Grasselli G, Zangrillo A, Zanella A, Antonelli M, Cabrini L, Castelli A, et al. Baseline characteristics and outcomes of 1591 patients infected with SARS‐CoV‐2 admitted to ICUs of the Lombardy Region, Italy. JAMA. 2020;323:1574–81. [PMC free article] [PubMed] [Google Scholar]

6. Horby P, Lim WS, Emberson JR, Mafham M, Bell JL, Linsell L, et al. Dexamethasone in Hospitalized Patients with Covid‐19 – preliminary report. N Engl J Med. 2020. [Online ahead of print]. 10.1056/NEJMoa2021436. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

7. Beigel JH, Tomashek KM, Dodd LE, Mehta AK, Zingman BS, Kalil AC, et al. Remdesivir for the treatment of Covid‐19 – final report. N Engl J Med. 2020;383:1813–26. [PMC free article] [PubMed] [Google Scholar]

8. Siddiqi HK, Mehra MR. COVID‐19 illness in native and immunosuppressed states: a clinical‐therapeutic staging proposal. J Heart Lung Transplant. 2020;39:405–7. [PMC free article] [PubMed] [Google Scholar]

9. Wan Y, Shang J, Graham R, Baric RS, Li F. Receptor Recognition by the Novel Coronavirus from Wuhan: an Analysis Based on Decade‐Long Structural Studies of SARS Coronavirus. J Virol. 2020. [Online ahead of print]. DOI: 10.1128/JVI.00127‐20. [PMC free article] [PubMed] [Google Scholar]

10. Ferrario CM, Trask AJ, Jessup JA. Advances in biochemical and functional roles of angiotensin‐converting enzyme 2 and angiotensin‐(1–7) in regulation of cardiovascular function. Am J Physiol Heart Circ Physiol. 2005;289:H2281–90. [PMC free article] [PubMed] [Google Scholar]

11. Varga Z, Flammer AJ, Steiger P, Haberecker M, Andermatt R, Zinkernagel AS, et al. Endothelial cell infection and endotheliitis in COVID‐19. Lancet. 2020;395:1417–8. [PMC free article] [PubMed] [Google Scholar]

12. Puelles VG, Lütgehetmann M, Lindenmeyer MT, Sperhake JP, Wong MN, Allweiss L, et al. Multiorgan and renal tropism of SARS‐CoV‐2. N Engl J Med. 2020;383:590–2. [PMC free article] [PubMed] [Google Scholar]

13. Ackermann M, Verleden SE, Kuehnel M, Haverich A, Welte T, Laenger F, et al. Pulmonary Vascular Endothelialitis, Thrombosis, and Angiogenesis in Covid‐19. N Engl J Med. 2020;383:120–8. [PMC free article] [PubMed] [Google Scholar]

14. Stahl K, Gronski PA, Kiyan Y, Seeliger B, Bertram A, Pape T, et al. Injury to the Endothelial Glycocalyx in Critically Ill COVID‐19 Patients. Am J Respir Crit Care Med. 2020. [PMC free article] [PubMed] [Google Scholar]

15. Azouz E, Yang S, Monnier‐Cholley L, Arrivé L. Systemic arterial thrombosis and acute mesenteric ischemia in a patient with COVID‐19. Intensive Care Med. 2020;46:1464–5. [PMC free article] [PubMed] [Google Scholar]

16. Goshua G, Pine AB, Meizlish ML, Chang CH, Zhang H, Bahel P, et al. Endotheliopathy in COVID‐19‐associated coagulopathy: evidence from a single‐centre, cross‐sectional study. Lancet Haematol. 2020;7:e575–82. [PMC free article] [PubMed] [Google Scholar]

17. Wu C, Chen X, Cai Y, Xia J, Zhou X, Xu S, et al. Risk factors associated with acute respiratory distress syndrome and death in patients with coronavirus disease 2019 pneumonia in Wuhan, China. JAMA Intern Med. 2020;180:934–43. [PMC free article] [PubMed] [Google Scholar]

18. Moore JB, June CH. Cytokine release syndrome in severe COVID‐19. Science. 2020;368:473–4. [PubMed] [Google Scholar]

19. Zhou Y, Fu B, Zheng X, Wang D, Zhao C, Qi Y, et al. Pathogenic T‐cells and inflammatory monocytes incite inflammatory storms in severe COVID‐19 patients. Nati Sci Rev. 2020;7:998–1002. [Google Scholar]

20. Liao M, Liu Y, Yuan J, Wen Y, Xu G, Zhao J, et al. Single‐cell landscape of bronchoalveolar immune cells in patients with COVID‐19. Nat Med. 2020;26:842–4. [PubMed] [Google Scholar]

21. Merad M, Martin JC. Pathological inflammation in patients with COVID‐19: a key role for monocytes and macrophages. Nat Rev Immunol. 2020;20:355–62. [PMC free article] [PubMed] [Google Scholar]

22. Hottz ED, Azevedo‐Quintanilha IG, Palhinha L, Teixeira L, Barreto EA, Pão CRR, et al. Platelet activation and platelet‐monocyte aggregate formation trigger tissue factor expression in patients with severe COVID‐19. Blood. 2020;136:1330–41. [PMC free article] [PubMed] [Google Scholar]

23. Tang N, Li D, Wang X, Sun Z. Abnormal coagulation parameters are associated with poor prognosis in patients with novel coronavirus pneumonia. J Thromb Haemost. 2020;18:844–7. [PMC free article] [PubMed] [Google Scholar]

24. Ruan Q, Yang K, Wang W, Jiang L, Song J. Clinical predictors of mortality due to COVID‐19 based on an analysis of data of 150 patients from Wuhan, China. Intensive Care Med. 2020;46:846–8. [PMC free article] [PubMed] [Google Scholar]

25. Chen G, Wu D, Guo W, Cao Y, Huang D, Wang H, et al. Clinical and immunological features of severe and moderate coronavirus disease 2019. J Clin Investig. 2020;130:2620–9. [PMC free article] [PubMed] [Google Scholar]

26. Price CC, Altice FL, Shyr Y, Koff A, Pischel L, Goshua G, et al. Tocilizumab treatment for cytokine release syndrome in hospitalized COVID‐19 patients: survival and clinical outcomes. Chest. 2020;158:1397–1408. [PMC free article] [PubMed] [Google Scholar]

27. Rosas I, Bräu N, Waters M, Go RC, Hunter BD, Bhagani S, et al. Tocilizumab in hospitalized patients with COVID‐19 pneumonia. medRxiv. 2020;2020.08.27.20183442. [Google Scholar]

28. Teuwen LA, Geldhof V, Pasut A, Carmeliet P. COVID‐19: the vasculature unleashed. Nat Rev Immunol. 2020;20:389–91. [PMC free article] [PubMed] [Google Scholar]

29. Hildebrandt GC, Chao N. Endothelial cell function and endothelial‐related disorders following haematopoietic cell transplantation. Br J Haematol. 2020;190:508–19. [PMC free article] [PubMed] [Google Scholar]

30. Valla DC, Cazals‐Hatem D. Sinusoidal obstruction syndrome. Clin Res Hepatol Gastroenterol. 2016;40:378–85. [PubMed] [Google Scholar]

31. Richardson PG, Corbacioglu S, Ho VT, Kernan NA, Lehmann L, Maguire C, et al. Drug safety evaluation of defibrotide. Expert Opin Drug Saf. 2013;12:123–36. [PubMed] [Google Scholar]

32. Vlodavsky I, Ilan N, Sanderson RD. Forty years of basic and translational heparanase research. Adv Exp Med Biol. 2020;1221:3–59. [PMC free article] [PubMed] [Google Scholar]

33. Coppell JA, Richardson PG, Soiffer R, Martin PL, Kernan NA, Chen A, et al. Hepatic veno‐occlusive disease following stem cell transplantation: incidence, clinical course, and outcome. Biol Blood Marrow Transplant. 2010;16:157–68. [PMC free article] [PubMed] [Google Scholar]

34. Bunte MC, Patnaik MM, Pritzker MR, Burns LJ. Pulmonary veno‐occlusive disease following hematopoietic stem cell transplantation: a rare model of endothelial dysfunction. Bone Marrow Transplant. 2008;41:677–86. [PubMed] [Google Scholar]

35. Mandel J, Mark EJ, Hales CA. Pulmonary veno‐occlusive disease. Am J Respir Crit Care Med. 2000;162:1964–73. [PubMed] [Google Scholar]

36. Altmann T, Slack J, Slatter MA, O’Brien C, Cant A, Thomas M, et al. Endothelial cell damage in idiopathic pneumonia syndrome. Bone Marrow Transplant. 2018;53:515–8. [PubMed] [Google Scholar]

37. Ando M, Miyazaki E, Abe T, Ehara C, Goto A, Masuda T, et al. Angiopoietin‐2 expression in patients with an acute exacerbation of idiopathic interstitial pneumonias. Respir Med. 2016;117:27–32. [PubMed] [Google Scholar]

38. Smadja DM, Guerin CL, Chocron R, Yatim N, Boussier J, Gendron N, et al. Angiopoietin‐2 as a marker of endothelial activation is a good predictor factor for intensive care unit admission of COVID‐19 patients. Angiogenesis. 2020;23:611–20. [PMC free article] [PubMed] [Google Scholar]

39. Batts ED, Lazarus HM. Diagnosis and treatment of transplantation‐associated thrombotic microangiopathy: real progress or are we still waiting? Bone Marrow Transplant. 2007;40:709–19. [PubMed] [Google Scholar]

40. Seaby EG, Gilbert RD. Thrombotic microangiopathy following haematopoietic stem cell transplant. Pediatr Nephrol. 2018;33(9):1489–500. [PMC free article] [PubMed] [Google Scholar]

41. Ghimire S, Weber D, Mavin E, Wang XN, Dickinson AM, Holler E. Pathophysiology of GvHD and Other HSCT‐related major complications. Front Immunol. 2017;8:79. [PMC free article] [PubMed] [Google Scholar]

42. Seidel C, Ringdén O, Remberger M. Increased levels of syndecan‐1 in serum during acute graft‐versus‐host disease. Transplantation. 2003;76:423–6. [PubMed] [Google Scholar]

43. Holtan SG, Pasquini M, Weisdorf DJ. Acute graft‐versus‐host disease: a bench‐to‐bedside update. Blood. 2014;124:363–73. [PMC free article] [PubMed] [Google Scholar]

44. Riesner K, Shi Y, Jacobi A, Kräter M, Kalupa M, McGearey A, et al. Initiation of acute graft‐versus‐host disease by angiogenesis. Blood. 2017;129:2021–32. [PubMed] [Google Scholar]

45. Mir E, Palomo M, Rovira M, Pereira A, Escolar G, Penack O, et al. Endothelial damage is aggravated in acute GvHD and could predict its development. Bone Marrow Transplant. 2017;52:1317–25. [PubMed] [Google Scholar]

46. Dietrich S, Falk CS, Benner A, Karamustafa S, Hahn E, Andrulis M, et al. Endothelial vulnerability and endothelial damage are associated with risk of graft‐versus‐host disease and response to steroid treatment. Biol Blood Marrow Transplant. 2013;19:22–7. [PubMed] [Google Scholar]

47. Choi SW, Kitko CL, Braun T, Paczesny S, Yanik G, Mineishi S, et al. Change in plasma tumor necrosis factor receptor 1 levels in the first week after myeloablative allogeneic transplantation correlates with severity and incidence of GVHD and survival. Blood. 2008;112:1539–42. [PMC free article] [PubMed] [Google Scholar]

48. Conran N, Belcher JD. Inflammation in sickle cell disease. Clin Hemorheol Microcirc. 2018;68:263–99. [PMC free article] [PubMed] [Google Scholar]

49. Pathare A, Al Kindi S, Alnaqdy AA, Daar S, Knox‐Macaulay H, Dennison D. Cytokine profile of sickle cell disease in Oman. Am J Hematol. 2004;77:323–8. [PubMed] [Google Scholar]

50. Sakamoto TM, Lanaro C, Ozelo MC, Garrido VT, Olalla‐Saad ST, Conran N, et al. Increased adhesive and inflammatory properties in blood outgrowth endothelial cells from sickle cell anemia patients. Microvasc Res. 2013;90:173–9. [PubMed] [Google Scholar]

51. Duits AJ, Pieters RC, Saleh AW, van Rosmalen E, Katerberg H, Berend K, et al. Enhanced levels of soluble VCAM‐1 in sickle cell patients and their specific increment during vasoocclusive crisis. Clin Immunol Immunopathol. 1996;81:96–8. [PubMed] [Google Scholar]

52. Embury SH, Matsui NM, Ramanujam S, Mayadas TN, Noguchi CT, Diwan BA, et al. The contribution of endothelial cell P‐selectin to the microvascular flow of mouse sickle erythrocytes in vivo. Blood. 2004;104:3378–85. [PubMed] [Google Scholar]

53. Platt OS, Brambilla DJ, Rosse WF, Milner PF, Castro O, Steinberg MH, et al. Mortality in sickle cell disease. Life expectancy and risk factors for early death. N Engl J Med. 1994;330:1639–44. [PubMed] [Google Scholar]

54. Anea CB, Lyon M, Lee IA, Gonzales JN, Adeyemi A, Falls G, et al. Pulmonary platelet thrombi and vascular pathology in acute chest syndrome in patients with sickle cell disease. Am J Hematol. 2016;91:173–8. [PMC free article] [PubMed] [Google Scholar]

55. Hanley B, Naresh KN, Roufosse C, Nicholson AG, Weir J, Cooke GS, et al. Histopathological findings and viral tropism in UK patients with severe fatal COVID‐19: a post‐mortem study. Lancet. Microbe. 2020;1:e245–53. [PMC free article] [PubMed] [Google Scholar]

56. James J, Srivastava A, Varghese MV, Eccles CA, Zemskova M, Rafikova O, et al. Heme induces rapid endothelial barrier dysfunction via the MKK3/p38MAPK axis. Blood. 2020;136:749–54. [PMC free article] [PubMed] [Google Scholar]

57. Gheblawi M, Wang K, Viveiros A, Nguyen Q, Zhong JC, Turner AJ, et al. Angiotensin‐Converting Enzyme 2: SARS‐CoV‐2 Receptor and Regulator of the Renin‐Angiotensin System: Celebrating the 20th Anniversary of the Discovery of ACE2. Circ Res. 2020;126:1456–74. [PMC free article] [PubMed] [Google Scholar]

58. Grimes JM, Grimes KV. p38 MAPK inhibition: a promising therapeutic approach for COVID‐19. J Mol Cell Cardiol. 2020;144:63–5. [PMC free article] [PubMed] [Google Scholar]

59. Schots R, Kaufman L, Van Riet I, Ben Othman T, De Waele M, Van Camp B, et al. Proinflammatory cytokines and their role in the development of major transplant‐related complications in the early phase after allogeneic bone marrow transplantation. Leukemia. 2003;17:1150–6. [PubMed] [Google Scholar]

60. Gugliotta L, Catani L, Vianelli N, Gherlinzoni F, Miggiano MC, Bandini G, et al. High plasma levels of tumor necrosis factor‐alpha may be predictive of veno‐occlusive disease in bone marrow transplantation. Blood. 1994;83:2385–6. [PubMed] [Google Scholar]

61. Symington FW, Symington BE, Liu PY, Viguet H, Santhanam U, Sehgal PB. The relationship of serum IL‐6 levels to acute graft‐versus‐host disease and hepatorenal disease after human bone marrow transplantation. Transplantation. 1992;54:457–62. [PubMed] [Google Scholar]

62. Remberger M, Ringden O. Serum levels of cytokines after bone marrow transplantation: increased IL‐8 levels during severe veno‐occlusive disease of the liver. Eur J Haematol. 1997;59:254–62. [PubMed] [Google Scholar]

63. Palomo M, Diaz‐Ricart M, Rovira M, Escolar G, Carreras E. Defibrotide prevents the activation of macrovascular and microvascular endothelia caused by soluble factors released to blood by autologous hematopoietic stem cell transplantation. Biol Blood Marrow Transplant. 2011;17:497–506. [PubMed] [Google Scholar]

64. Li X, Ma X. The role of heparin in sepsis: much more than just an anticoagulant. Br J Haematol. 2017;179:389–98. [PubMed] [Google Scholar]

65. Shi C, Wang C, Wang H, Yang C, Cai F, Zeng F, et al. The potential of low molecular weight heparin to mitigate cytokine storm in severe COVID‐19 patients: a retrospective clinical study. Clin Transl Sci. 2020;13:1087–95. [PMC free article] [PubMed] [Google Scholar]

66. Lindahl U, Li JP. Heparin – an old drug with multiple potential targets in Covid‐19 therapy. J Thromb Haemost. 2020;18:2422–2424. [PMC free article] [PubMed] [Google Scholar]

67. Agelidis A, Deepak S. Heparanase, heparan sulfate and viral infection. Adv Exp Med Biol. 2020;1221:759–70. [PubMed] [Google Scholar]

68. Mycroft‐West C, Su D, Elli S, Guimond S, Miller G, Turnbull J, et al.The 2019 coronavirus (SARS‐CoV‐2) surface protein (Spike) S1 receptor binding domain undergoes conformational change upon heparin binding. bioRxiv 2020; 2020.02.29.971093.

69. Hondermarck H, Bartlett NW, Nurcombe V. The role of growth factor receptors in viral infections: an opportunity for drug repurposing against emerging viral diseases such as COVID‐19? FASEB Bioadv. 2020;2:296–303. [PMC free article] [PubMed] [Google Scholar]

70. Clausen TM, Sandoval DR, Spliid CB, Pihl J, Perrett HR, Painter CD, et al. SARS‐CoV‐2 infection depends on cellular heparan sulfate and ACE2. Cell. 2020;183:1043–57. [PMC free article] [PubMed] [Google Scholar]

71. Khanna M, Ranasinghe C, Browne AM, Li JP, Vlodavsky I, Parish CR. Is host heparanase required for the rapid spread of heparan sulfate binding viruses? Virology. 2019;529:1–6. [PubMed] [Google Scholar]

72. Hadigal SR, Agelidis AM, Karasneh GA, Antoine TE, Yakoub AM, Ramani VC, et al. Heparanase is a host enzyme required for herpes simplex virus‐1 release from cells. Nat Commun. 2015;6:6985. [PMC free article] [PubMed] [Google Scholar]

73. Agelidis AM, Hadigal SR, Jaishankar D, Shukla D. Viral activation of Heparanase drives pathogenesis of herpes simplex virus‐1. Cell Rep. 2017;20:439–50. [PMC free article] [PubMed] [Google Scholar]

74. Koganti R, Suryawanshi R, Shukla D. Heparanase, cell signaling, and viral infections. Cell Mol Life Sci. 2020;77:5059–77. [PMC free article] [PubMed] [Google Scholar]

75. Goodall KJ, Poon IK, Phipps S, Hulett MD. Soluble heparan sulfate fragments generated by heparanase trigger the release of pro‐inflammatory cytokines through TLR‐4. PLoS One. 2014;9:e109596. [PMC free article] [PubMed] [Google Scholar]

76. Mayfosh AJ, Baschuk N, Hulett MD. Leukocyte heparanase: a double‐edged sword in tumor progression. Front Oncol. 2019;9:331. [PMC free article] [PubMed] [Google Scholar]

77. Seifert C, Wittig S, Arndt C, Gruhn B. Heparanase polymorphisms: influence on incidence of hepatic sinusoidal obstruction syndrome in children undergoing allogeneic hematopoietic stem cell transplantation. J Cancer Res Clin Oncol. 2015;141:877–85. [PubMed] [Google Scholar]

78. Palmer KJ, Defibrotide GK. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic use in vascular disorders. Drugs. 1993;45:259–94. [PubMed] [Google Scholar]

79. Thiemermann C, Thomas GR, Vane JR. Defibrotide reduces infarct size in a rabbit model of experimental myocardial ischaemia and reperfusion. Br J Pharmacol. 1989;97:401–8. [PMC free article] [PubMed] [Google Scholar]

80. Stein C, Castanotto D, Krishnan A, Nikolaenko L. Defibrotide (Defitelio): a new addition to the stockpile of food and drug administration‐approved oligonucleotide drugs. Mol Ther Nucleic Acids. 2016;5:e346. [PMC free article] [PubMed] [Google Scholar]

81. Pescador R, Mantovani M, Prino G, Madonna M. Pharmacokinetics of Defibrotide and of its profibrinolytic activity in the rabbit. Thromb Res. 1983;30:1–11. [PubMed] [Google Scholar]

82. Falanga A, Vignoli A, Marchetti M, Barbui T. Defibrotide reduces procoagulant activity and increases fibrinolytic properties of endothelial cells. Leukemia. 2003;17:1636–42. [PubMed] [Google Scholar]

83. Cella G, Sbarai A, Mazzaro G, Motta G, Carraro P, Andreozzi GM, et al. Tissue factor pathway inhibitor release induced by defibrotide and heparins. Clin Appl Thromb Hemost. 2001;7:225–8. [PubMed] [Google Scholar]

84. Echart CL, Graziadio B, Somaini S, Ferro LI, Richardson PG, Fareed J, et al. The fibrinolytic mechanism of defibrotide: effect of defibrotide on plasmin activity. Blood Coagul Fibrinolysis. 2009;20:627–34. [PubMed] [Google Scholar]

85. Niada R, Mantovani M, Prino G, Pescador R, Berti F, Omini C, et al. Antithrombotic activity of a polydeoxyribonucleotidic substance extracted from mammalian organs: a possible link with prostacyclin. Thromb Res. 1981;23:233–46. [PubMed] [Google Scholar]

86. Francischetti IM, Oliveira CJ, Ostera GR, Yager SB, Debierre‐Grockiego F, Carregaro V, et al. Defibrotide interferes with several steps of the coagulation‐inflammation cycle and exhibits therapeutic potential to treat severe malaria. Arterioscler Thromb Vasc Biol. 2012;32:786–98. [PMC free article] [PubMed] [Google Scholar]

87. U.S. Food & Drug Administration (FDA) . Defitelio (defibrotide sodium). Available at: https://www.fda.gov/drugs/resources‐information‐approved‐drugs/defitelio‐defibrotide‐sodium. Accessed January 2021

88. Richardson PG, Riches ML, Kernan NA, Brochstein JA, Mineishi S, Termuhlen AM, et al. Phase 3 trial of defibrotide for the treatment of severe veno‐occlusive disease and multi‐organ failure. Blood. 2016;127:1656–65. [PMC free article] [PubMed] [Google Scholar]

89. Richardson PG, Grupp SA, Pagliuca A, Krishnan A, Ho VT, Corbacioglu S. Defibrotide for the treatment of hepatic veno‐occlusive disease/sinusoidal obstruction syndrome with multiorgan failure. Int J Hematol Oncol. 2017;6:75–93. [PMC free article] [PubMed] [Google Scholar]

90. Richardson PG, Soiffer RJ, Antin JH, Uno H, Jin Z, Kurtzberg J, et al. Defibrotide for the treatment of severe hepatic veno‐occlusive disease and multiorgan failure after stem cell transplantation: a multicenter, randomized, dose‐finding trial. Biol Blood Marrow Transplant. 2010;16:1005–17. [PMC free article] [PubMed] [Google Scholar]

91. Richardson PG, Murakami C, Jin Z, Warren D, Momtaz P, Hoppensteadt D, et al. Multi‐institutional use of defibrotide in 88 patients after stem cell transplantation with severe veno‐occlusive disease and multisystem organ failure: response without significant toxicity in a high‐risk population and factors predictive of outcome. Blood. 2002;100:4337–43. [PubMed] [Google Scholar]

92. Corbacioglu S, Cesaro S, Faraci M, Valteau‐Couanet D, Gruhn B, Rovelli A, et al. Defibrotide for prophylaxis of hepatic veno‐occlusive disease in paediatric haemopoietic stem‐cell transplantation: an open‐label, phase 3, randomised controlled trial. Lancet. 2012;379:1301–9. [PubMed] [Google Scholar]

93. Palomo M, Mir E, Rovira M, Escolar G, Carreras E, Diaz‐Ricart M. What is going on between defibrotide and endothelial cells? Snapshots reveal the hot spots of their romance. Blood. 2016;127:1719–27. [PMC free article] [PubMed] [Google Scholar]

94. Schröder H. Defibrotide protects endothelial cells, but not L929 tumour cells, from tumour necrosis factor‐alpha‐mediated cytotoxicity. J Pharm Pharmacol. 1995;47:250–2. [PubMed] [Google Scholar]

95. Mitsiades CS, Rouleau C, Echart C, Menon K, Teicher B, Distaso M, et al. Preclinical studies in support of defibrotide for the treatment of multiple myeloma and other neoplasias. Clin Cancer Res. 2009;15:1210–21. [PMC free article] [PubMed] [Google Scholar]

96. Eissner G, Multhoff G, Gerbitz A, Kirchner S, Bauer S, Haffner S, et al. Fludarabine induces apoptosis, activation, and allogenicity in human endothelial and epithelial cells: protective effect of defibrotide. Blood. 2002;100:334–40. [PubMed] [Google Scholar]

97. Ferraresso M, Rigotti P, Stepkowski SM, Chou TC, Kahan BD. Immunosuppressive effects of defibrotide. Transplantation. 1993;56:928–33. [PubMed] [Google Scholar]

98. Scalia R, Kochilas L, Campbell B, Lefer AM. Effects of defibrotide on leukocyte‐endothelial cell interaction in the rat mesenteric vascular bed: role of P‐selectin. Methods Find Exp Clin Pharmacol. 1996;18:669–76. [PubMed] [Google Scholar]

99. García‐Bernal D, Palomo M, Martínez CM, Millán‐Rivero JE, García‐Guillén AI, Blanquer M, et al. Defibrotide inhibits donor leucocyte‐endothelial interactions and protects against acute graft‐versus‐host disease. J Cell Mol Med. 2020;24:8031–44. [PMC free article] [PubMed] [Google Scholar]

100. Bianchi G, Barone D, Lanzarotti E, Tettamanti R, Porta R, Moltrasio D, et al. Defibrotide, a single‐stranded polydeoxyribonucleotide acting as an adenosine receptor agonist. Eur J Pharmacol. 1993;238:327–34. [PubMed] [Google Scholar]

101. Ko IG, Hwang JJ, Chang BS, Kim SH, Jin JJ, Hwang L, et al. Polydeoxyribonucleotide ameliorates lipopolysaccharide‐induced acute lung injury via modulation of the MAPK/NF‐κB signaling pathway in rats. Int Immunopharmacol. 2020;83:106444. [PubMed] [Google Scholar]

102. Richardson PG, Carreras E, Iacobelli M, Nejadnik B. The use of defibrotide in blood and marrow transplantation. Blood Adv. 2018;2:1495–509. [PMC free article] [PubMed] [Google Scholar]

103. Tekgündüz E, Kaya AH, Bozdağ SC, Koçubaba Ş, Kayıkçı Ö, Namdaroğlu S, et al. Does defibrotide prophylaxis decrease the risk of acute graft versus host disease following allogeneic hematopoietic cell transplantation? Transfus Apher Sci. 2016;54:30–4. [PubMed] [Google Scholar]

104. Yeates L, Slatter MA, Bonanomi S, Lim FL, Ong SY, Dalissier A, et al. Use of defibrotide to treat transplant‐associated thrombotic microangiopathy: a retrospective study of the Paediatric Diseases and Inborn Errors Working Parties of the European Society of Blood and Marrow Transplantation. Bone Marrow Transplant. 2017;52:762–4. [PubMed] [Google Scholar]

105. Nadir Y. Heparanase in the coagulation system. Adv Exp Med Biol. 2020;1221:771–84. [PubMed] [Google Scholar]

106. Buijsers B, Yanginlar C, Grondman I, de Nooijer A, Maciej‐Hulme ML, Jonkman I, et al. Increased plasma heparanase activity in COVID‐19 patients. medRxiv. 2020;2020.06.12.20129304. [PMC free article] [PubMed] [Google Scholar]

107. Klein OR, Choi S, Haile A, Ktena YP, Pierce E, Smith M, et al. Defibrotide Modulates Pulmonary Endothelial Cell Activation and Protects Against Lung Inflammation in Pre‐Clinical Models of LPS‐Induced Lung Injury and Idiopathic Pneumonia. Syndrome. 2020;26:S138–9. [Google Scholar]

108. Richardson E, Carlo‐Stella C, Jara R, Vlodavsky I, Iacobelli M, Fareed J, et al. Response to Maccio et al., “Multifactorial Pathogenesis of COVID‐19‐related Coagulopathy: Can defibrotide have a role in the early phases of coagulation disorders?. J Thromb Haemost. 2020;18:3111–3. [PubMed] [Google Scholar]

109. Lang P, Eichholz T, Bakchoul T, Streiter M, Petrasch M, Bösmüller H, et al. Defibrotide for the treatment of PIMS‐TS in two pediatric patients. J Pediatr Infect Dis Soc. 2020;9:622–5. [Google Scholar]

110. Chen S, He Y, Hu Z, Lu S, Yin X, Ma X, et al. Heparanase Mediates Intestinal Inflammation and Injury in a Mouse Model of Sepsis. J Histochem Cytochem. 2017;65:241–9. [PMC free article] [PubMed] [Google Scholar]

111. Huang X, Han S, Liu X, Wang T, Xu H, Xia B, et al. Both UFH and NAH alleviate shedding of endothelial glycocalyx and coagulopathy in LPS‐induced sepsis. Exp Ther Med. 2020;19:913–22. [PMC free article] [PubMed] [Google Scholar]

112. Masola V, Bellin G, Vischini G, Dall’Olmo L, Granata S, Gambaro G, et al. Inhibition of heparanase protects against chronic kidney dysfunction following ischemia/reperfusion injury. Oncotarget. 2018;9:36185–201. [PMC free article] [PubMed] [Google Scholar]

113. Koliesnik IO, Kuipers HF, Medina CO, Zihsler S, Liu D, Van Belleghem JD, et al. The heparan sulfate mimetic PG545 modulates T cell responses and prevents delayed‐type hypersensitivity. Front Immunol. 2020;11:132. [PMC free article] [PubMed] [Google Scholar]

114. Abassi Z, Hamoud S, Hassan A, Khamaysi I, Nativ O, Heyman SN, et al. Involvement of heparanase in the pathogenesis of acute kidney injury: nephroprotective effect of PG545. Oncotarget. 2017;8:34191–204. [PMC free article] [PubMed] [Google Scholar]

115. Ostapoff KT, Awasthi N, Cenik BK, Hinz S, Dredge K, Schwarz RE, et al. PG545, an angiogenesis and heparanase inhibitor, reduces primary tumor growth and metastasis in experimental pancreatic cancer. Mol Cancer Ther. 2013;12:1190–201. [PubMed] [Google Scholar]

116. Guimond SE, Mycroft‐West CJ, Gandhi NS, Tree JA, Buttigieg KR, Coombes N, et al. Pixatimod (PG545), a clinical‐stage heparan sulfate mimetic, is a potent inhibitor of the SARS‐CoV‐2 virus. bioRxiv. 2020;2020.06.24.169334. [Google Scholar]