Impacts of COVID on the immune system

Authors: Lara Herrero, The Conversation Medical Xpress September 19, 2022

So you’ve had COVID and have now recovered. You don’t have ongoing symptoms and luckily, you don’t seem to have developed long COVID.

But what impacts has COVID had on your overall immune system?

It’s early days yet. But growing evidence suggests there are changes to your immune system that may put you at risk of other infectious diseases.

Here’s what we know so far.

A round of viral infections

Over this past winter, many of us have had what seemed like a continual round of viral illness. This may have included COVID, influenza or infection with respiratory syncytial virus. We may have recovered from one infection, only to get another.

Then there is the re-emergence of infectious diseases globally such as monkeypox or polio.

Could these all be connected? Does COVID somehow weaken the immune system to make us more prone to other infectious diseases?

There are many reasons for infectious diseases to emerge in new locations, after many decades, or in new populations. So we cannot jump to the conclusion COVID infections have given rise to these and other viral infections.

But evidence is building of the negative impact of COVID on a healthy individual’s immune system, several weeks after symptoms have subsided.

What happens when you catch a virus?

There are three possible outcomes after a viral infection:

  1. your immune system clears the infection and you recover (for instance, with rhinovirus which causes the common cold)
  2. your immune system fights the virus into “latency” and you recover with a virus dormant in our bodies (for instance, varicella zoster virus, which causes chickenpox)
  3. your immune system fights, and despite best efforts the virus remains “chronic,” replicating at very low levels (this can occur for hepatitis C virus).

Ideally we all want option 1, to clear the virus. In fact, most of us clear SARS-CoV-2, the virus that causes COVID. That’s through a complex process, using many different parts of our immune system.

But international evidence suggests changes to our immune cells after SARS-CoV-2 infection may have other impacts. It may affect our ability to fight other viruses, as well as other pathogens, such as bacteria or fungi.

How much do we know?

An Australian study has found SARS-CoV-2 alters the balance of immune cells up to 24 weeks after clearing the infection.

There were changes to the relative numbers and types of immune cells between people who had recovered from COVID compared with healthy people who had not been infected.

This included changes to cells of the innate immune system (which provides a non-specific immune response) and the adaptive immune system (a specific immune response, targeting a recognised foreign invader).

Another study focused specifically on dendritic cells—the immune cells that are often considered the body’s “first line of defence.”

Researchers found fewer of these cells circulating after people recovered from COVID. The ones that remained were less able to activate white blood cells known as T-cells, a critical step in activating anti-viral immunity.

Other studies have found different impacts on T-cells, and other types of white blood cells known as B-cells (cells involved in producing antibodies).

After SARS-CoV-2 infection, one study found evidence many of these cells had been activated and “exhausted.” This suggests the cells are dysfunctional, and might not be able to adequately fight a subsequent infection. In other words, sustained activation of these immune cells after a SARS-CoV-2 infection may have an impact on other inflammatory diseases.

One study found people who had recovered from COVID have changes in different types of B-cells. This included changes in the cells’ metabolism, which may impact how these cells function. Given B-cells are critical for producing antibodies, we’re not quite sure of the precise implications.

Could this influence how our bodies produce antibodies against SARS-CoV-2 should we encounter it again? Or could this impact our ability to produce antibodies against pathogens more broadly—against other viruses, bacteria or fungi? The study did not say.

What impact will these changes have?

One of the main concerns is whether such changes may impact how the immune system responds to other infections, or whether these changes might worsen or cause other chronic conditions.

So more work needs to be done to understand the long-term impact of SARS-CoV-2 infection on a person’s immune system.

For instance, we still don’t know how long these changes to the immune system last, and if the immune system recovers. We also don’t know if SARS-CoV-2 triggers other chronic illnesses, such as chronic fatigue syndrome (myalgic encephalomyelitis). Research into this is ongoing.

What we do know is that having a healthy immune system and being vaccinated (when a vaccine has been developed) is critically important to have the best chance of fighting any infection.

Bone Marrow Suppression Secondary to the COVID-19 Booster Vaccine: A Case Report

TAuthors: oral Shastri 1Navkiran Randhawa 2Ragia Aly 3Masood Ghouse 3 PMID: 35210894PMCID: PMC8863340DOI: 10.2147/JBM.S350290 J Blood Med.  2022; 13: 69–74.Published online 2022 Feb 18. doi: 10.2147/JBM.S350290

Abstract

As of September 2021, SARS-CoV-2 booster shots became widely available in the US to ensure continued protection against the virus. A temporal relationship has been previously reported between the first or second dose of the COVID-19 vaccine and the development of thrombocytopenia. However, adverse events related to the third COVID-19 vaccine are still being reported and studied. We report a 74-year-old male who developed bone marrow suppression and pancytopenia recorded seven days after receiving the Pfizer SARS-CoV-2 vaccine. During his hospital stay, the patient’s hemoglobin, white blood cell, and platelet levels continued to trend downwards. However, all three levels showed improvement one week after discharge without robust intervention. Global vaccination is of utmost importance, as is understanding and documenting post-vaccination reactions including bone marrow suppression. Prompt evaluation and patient education are imperative to improve patient outcomes and combat hesitancy against vaccine administration.

Introduction

Since its emergence in December of 2019, the rapid spread of severe acute respiratory syndrome coronavirus (SARS-CoV-2) has quickly affected millions of lives across every continent.1 This highly transmittable and pathogenic viral infection has led to massive mitigation efforts and allocation of resources to prevent the spread of transmission and high mortality related to complications.2 The establishment of higher levels of community (herd) immunity and protection against SARS-CoV-2 via the widespread deployment of effective vaccines has become a global effort.3 In December of 2020, the FDA issued an Emergency use Authorization for the Pfizer-BioNTech and Moderna COVID-19 Vaccine as a two-dose series.4 In September 2021, booster vaccines became widely administered in the US due to waning immunity of the COVID-19 vaccines against variants of SARS-CoV-2 along with ensuring continued protection against the virus.5

Serious adverse events such as anaphylaxis, Guillain-Barre Syndrome, myocarditis, pericarditis, thrombocytopenia, and death have been previously reported following the first and/or second dose of vaccine.6 To our knowledge, no cases have been reported regarding bone marrow suppression related to the third COVID-19 vaccine. Adverse events reported between August 12-September 19, 2021 from the COVID-19 booster vaccine supported similar reactions to those after dose two.7 According to the Centers for Disease Control and Prevention (CDC), these initial findings indicate no unexpected patterns of adverse reactions after an additional dose of COVID-19 vaccination.7 However, adverse events related to the COVID-19 booster are still being reported and studied.6 This report presents a case of bone marrow suppression occurring after the third COVID-19 vaccine without a similar reaction after the first or second dose.Go to:

Case Report

A 74-year-old male with a history of polychondritis and hypothyroidism presented to the hospital after falling out of his chair and inability to ambulate. The patient was found to be mildly confused upon arrival to the emergency room, limiting our ability to obtain a full verbal history. Chart review revealed the patient had received his third Pfizer Covid vaccine shot seven days before admission followed by fatigue, decreased appetite, fever, and chills. The patient had received the second Pfizer Covid-19 shot nine months before the booster. No reactions to the previous two shots were noted.

Upon initial evaluation, vital signs were within normal limits and a physical exam revealed significant tenderness in the upper arm and no gross bleeding (Figure 1). Computed tomography (CT) imaging (Figure 2) was significant for enhancement of the left axillary lymph node. The patient’s initial complete blood count (CBC) was remarkable for a hemoglobin count of 9.9 g/dl and platelet count of 84 x 109/L; both values lower than his prior hemoglobin count of 13.7 g/dl and platelet count of 180 x 109/L from December of 2020. His mean corpuscular volume (MCV) was elevated at 101.3 femtolitres from his prior MCV value of 95.8 femtolitres in December of 2020. His white blood cell (WBC) count was recorded at 7.6 x 109/L.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0001.jpg

Figure 1

The patient’s upper arm showed erythema with no gross bleeding near the injection site

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0002.jpg

Figure 2

The patient’s CT imaging of the thoracic region showed enhancement of the left axillary lymph node.

The hemoglobin, WBC, and platelet count further down trended from his baseline (Figures 3​5).5). Anemia labs including ferritin levels (554 ng/mL), vitamin B12 (253 pg/mL), total bilirubin (0.5 mg/dL), and reticulocyte count (0.8%) were nonsignificant during the patient’s hospital stay. The patient’s left shoulder presented with extensive bruising, erythema, papular rash, warmth, and tenderness on palpation during the hospitalization. An improvement in WBC and platelet levels was noted on day 4 of hospitalization.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0003.jpg

Figure 3

The patient’s hemoglobin count throughout his hospital course and 6 days after discharge.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0004.jpg

Figure 4

The patient’s WBC count throughout his hospital course and 6 days after discharge.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0005.jpg

Figure 5

The patient’s platelet count throughout his hospital course and 6 days after discharge.

Before discharge, the patient was fully alert and oriented and reported improvement in his symptoms. Examination of his lateral left arm showed decreased erythema and bruising with slight petechiae. The patient was discharged due to stabilization of labs and encouraged to take oral vitamin B12 supplements. During his outpatient follow-up six days after hospitalization, his hemoglobin increased to 10.5 g/dl, WBC count increased to 4.9 x 109/L, and platelets increased to 101 x 109/L.

Discussion

This paper presents a patient with pancytopenia recorded seven days after receiving the Pfizer booster vaccine. Interestingly, this patient did not report any reactions after the first or second dose of the Pfizer vaccine against SARS-CoV-2. Pancytopenia refers to a decrease in all peripheral bloodlines and is present when all three cell lines are below the normal reference range.8 The patient’s physical exam showed no signs of active bleeding along with his labs indicating no evidence of hemolysis. The patient’s hemoglobin, platelet, and white blood cell count presented below baseline followed by a decrease and slight improvement during his hospital stay. Six days after hospitalization, all three cell lines showed improvement. The temporal association with the booster vaccine and negative infectious disease workup raised suspicion for vaccine-induced bone marrow suppression. In addition, the patient’s reticulocyte count and lactate dehydrogenase value were consistent with hypoproliferation within the bone marrow.

Currently, there is a gap in knowledge of adverse events specific to the third vaccine against SARS-CoV-2 due to the recent initiation of administration and ongoing reporting of events.6 To our knowledge, bone marrow suppression after any dose of vaccine against SARS-CoV-2 has not been previously reported. However, a prior case of pancytopenia after the third vaccination with a recombinant hepatitis B vaccine has previously been reported.9 The patient’s bone marrow biopsy within this case displayed a paucity of late myeloid elements and CD8+ T cells.9 It was believed the patient’s CD8+T cells were causing excessive production of IFN-γ; a stimulant of negative regulators of hematopoiesis such as tumor necrosis factor and lymphotoxin.10 IFN-γ has also previously been reported to create immunological effects comprising an upregulation of histocompatibility gene transcription and alteration in class I and II antigen expression at the cell surface.11 It was predicted these changes resulted in an autoimmune reaction causing suppression of maturation of hematopoietic progenitor cells and pancytopenia.9 Via a similar mechanism, we believe that our patient’s pancytopenia was immune-mediated, potentially triggered by the vaccination.

Vaccines against SARS-CoV-2 (first or second dose) and the induction of Idiopathic Thrombocytopenic Purpura (ITP) have also been recently acknowledged in multiple cases.12 Our patient presented with low platelet levels and associated petechiae and purpura at the site of the vaccination. However, the patient’s presentation of low hemoglobin and white blood cells along with normal reticulocyte levels was more indicative of pancytopenia secondary to bone marrow suppression. In patients presenting with pancytopenia, the history and the physical exam should help assess the severity of the pancytopenia and comorbid illnesses that may complicate the disorder.13 In addition, suspicious medications and exposure to toxic agents should be ruled out.13 Initial screening laboratory evaluation should include the patient’s complete blood count, peripheral blood smear examination, reticulocyte count, complete metabolic panel, prothrombin time/partial thromboplastin time, and blood type and screen. Common interventions to alleviate bone marrow suppression and pancytopenia include treating the underlying cause and utilizing supplements to boost red blood cell production if indicated.

Vaccines against SARS-CoV-2 undergo continuous safety monitoring; adverse events are very rare.14 However, vaccine hesitancy remains a barrier towards full population inoculation against SARS-CoV-2 and is influenced by misinformation regarding vaccine safety.15 One study using an anonymous online questionnaire found a person’s trust in the effectiveness of the vaccine was a major facilitative factor affecting willingness to vaccinate.16 The same study also found that 66.7% of unvaccinated participants thought the vaccine’s safety was not enough, making it the main reason for reluctance or hesitance to be vaccinated.16 Therefore, education of adverse events and available interventions post-vaccination is imperative to prevent the spread of misinformation and combat hesitancy towards vaccination.15

As of September 19, 2021, about 2.2 million people in the United States received a third vaccine against SARS-CoV-2.17 Among those who received the vaccine, 22,000 people reported the effects of the vaccine with no unexpected patterns of adverse reactions.17 Our patient demonstrates abnormal pancytopenia first recorded seven days after receiving the booster vaccine, possibly indicating a rare adverse event from the vaccination given the temporal relationship. While additional studies and observations are indicated to verify bone marrow suppression as an adverse reaction, this case report provides an opportunity for patient education and treatment planning before symptoms arise.

Conclusion

Our case report highlights pancytopenia secondary to bone marrow suppression following Pfizer vaccination against SARS-CoV-2. It is important to consider the possibility of bone marrow suppression following the third vaccine against SARS-CoV-2. Although additional studies are indicated to determine the risk factors and pathogenesis of vaccine-induced bone marrow suppression, prompt evaluation and initiation of interventions can improve patient outcomes.

References

1. Fernandes A, Chaudhari S, Jamil N, Gopalakrishnan G. COVID-19 vaccine. Endocr Pract. 2021;27(2):170–172. doi:10.1016/j.eprac.2021.01.013 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

2. Johansson MA, Quandelacy TM, Kada S, et al. SARS-CoV-2 transmission from people without COVID-19 symptoms. JAMA Network Open. 2021;4(1):e2035057–e2035057. doi:10.1001/jamanetworkopen.2020.35057 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

3. Graham BS. Rapid COVID-19 vaccine development. Science. 2020;368(6494):945–946. doi:10.1126/science.abb8923 [PubMed] [CrossRef] [Google Scholar]

4. Gee J, Marquez P, Su J, et al. First month of COVID-19 vaccine safety monitoring—United States, December 14, 2020–January 13. Morb Mortal Wkly Rep. 2021;70(8):283. doi:10.15585/mmwr.mm7008e3 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

5. Mahase E. Covid-19 booster vaccines: what we know and who’s doing what. BMJ. 2021. doi: 10.1136/bmj.n2082 [PubMed] [CrossRef] [Google Scholar]

6. Centers for Disease Control and Prevention. Selected adverse events reported after COVID-19 vaccination. Centers for Disease Control and Prevention. Available from: https://www.cdc.gov/coronavirus/2019-ncov/vaccines/safety/adverse-events.html. Accessed November 8, 2021. [Google Scholar]

7. Hause AM. Safety monitoring of an additional dose. Centers for Disease Control and Prevention; 2021. Available from: https://www.cdc.gov/mmwr/volumes/70/wr/mm7039e4.htm. Accessed February 11, 2022. [Google Scholar]

8. Valent P. Low blood counts: immune mediated, idiopathic, or myelodysplasia. Hematology. 2012;2012(1):485–491. doi:10.1182/asheducation.V2012.1.485.3798522 [PubMed] [CrossRef] [Google Scholar]

9. Viallard JF, Boiron JM, Parrens M, et al. Severe pancytopenia triggered by recombinant hepatitis B vaccine. Br J Haematol. 2000;110(1):230–233. doi:10.1046/j.1365-2141.2000.02171.x [PubMed] [CrossRef] [Google Scholar]

10. Collart MA, Belin D, Vassalli JD, De Kossodo S, Vassalli P. Gamma interferon enhances macrophage transcription of the tumor necrosis factor/cachectin, interleukin 1, and urokinase genes, which are controlled by short-lived repressors. J Exp Med. 1986;164(6):2113–2118. doi:10.1084/jem.164.6.2113 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

11. Wallach D, Fellous M, Revel M. Preferential effect of gamma interferon on the synthesis of HLA antigens and their mRNAs in human cells. Nature. 1982;299(5886):833–836. doi:10.1038/299833a0 [PubMed] [CrossRef] [Google Scholar]

12. Shah SRA, Dolkar S, Mathew J, et al. COVID-19 vaccination associated severe immune thrombocytopenia. Exp Hematol Oncol. 2021;10:42. doi:10.1186/s40164-021-00235-0 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

13. Elizabeth P, Weinzierl MD, Daniel A, Arber MD. The differential diagnosis and bone marrow evaluation of new-onset pancytopenia. Am J Clin Pathol. 2013;139(1):9–29. doi:10.1309/AJCP50AEEYGREWUZ [PubMed] [CrossRef] [Google Scholar]

14. Centers for Disease Control and Prevention. COVID-19 vaccination; 2020. Available from: https://www.cdc.gov/coronavirus/2019-ncov/vaccines/safety/safety-of-vaccines.html. Accessed February 11, 2022.

15. Dror AA, Eisenbach N, Taiber S, et al. Vaccine hesitancy: the next challenge in the fight against COVID-19. Eur J Epidemiol. 2020;35:775–779. doi:10.1007/s10654-020-00671-y [PMC free article] [PubMed] [CrossRef] [Google Scholar]

16. Gan L, Chen Y, Hu P, et al. Willingness to receive SARS-CoV-2 vaccination and associated factors among Chinese adults: a cross sectional survey. Int J Environ Res Public Health. 2021;18(4):1993. doi:10.3390/ijerph18041993 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

17. STAT. Early data suggest side effects after Covid booster similar to second dose; 2021. Available from: https://www.statnews.com/2021/09/28/side-effect-rates-from-a-third-covid-19-vaccine-dose-similar-to-those-after-second-shot-early-data-indicate/.

ACE2-independent infection of T lymphocytes by SARS-CoV-2

Authors: Xu-Rui ShenRong GengQian LiYing ChenShu-Fen LiQi WangJuan MinYong YangBei LiYong YangBei LiRen-Di JiangXi WangXiao-Shuang ZhengYan ZhuJing-Kun JiaXing-Lou YangMei-Qin LiuQian-Chun GongYu-Lan ZhangZhen-Qiong GuanHui-Ling LiZhen-Hua ZhengZheng-Li ShiHui-Lan ZhangKe Peng & Peng Zhou 

Signal Transduction and Targeted Therapy volume 7, Article number: 83 (2022) 

Abstract

SARS-CoV-2 induced marked lymphopenia in severe patients with COVID-19. However, whether lymphocytes are targets of viral infection is yet to be determined, although SARS-CoV-2 RNA or antigen has been identified in T cells from patients. Here, we confirmed that SARS-CoV-2 viral antigen could be detected in patient peripheral blood cells (PBCs) or postmortem lung T cells, and the infectious virus could also be detected from viral antigen-positive PBCs. We next prove that SARS-CoV-2 infects T lymphocytes, preferably activated CD4 + T cells in vitro. Upon infection, viral RNA, subgenomic RNA, viral protein or viral particle can be detected in the T cells. Furthermore, we show that the infection is spike-ACE2/TMPRSS2-independent through using ACE2 knockdown or receptor blocking experiments. Next, we demonstrate that viral antigen-positive T cells from patient undergone pronounced apoptosis. In vitro infection of T cells induced cell death that is likely in mitochondria ROS-HIF-1a-dependent pathways. Finally, we demonstrated that LFA-1, the protein exclusively expresses in multiple leukocytes, is more likely the entry molecule that mediated SARS-CoV-2 infection in T cells, compared to a list of other known receptors. Collectively, this work confirmed a SARS-CoV-2 infection of T cells, in a spike-ACE2-independent manner, which shed novel insights into the underlying mechanisms of SARS-CoV-2-induced lymphopenia in COVID-19 patients.

Introduction

Since its emergence in December 2019, SARS-CoV-2, the etiology of coronavirus disease 2019 (COVID-19), quickly spread to the majority of countries in the world and posed great threats to public health. The virus shares 79.5% genome identity with SARS-CoV-1 and also uses angiotensin-converting enzyme 2 (ACE2) as a cell entry receptor.1,2,3,4,5 Typical clinical symptoms of COVID-19 patients include fever, fatigue, dry cough, and pneumonia, whereas around 20% of the severe cases may die of multi-organ failure.6,7,8,9

Apart from the respiratory system, multiple organs including the immune system of COVID-19 patients were also targeted by SARS-CoV-2 infection. Notably, lymphopenia was observed in 83.2% of the patients on admission, and fatal infections were associated with more severe lymphopenia over time.6,7,8 Lymphocytes (particularly T cells) play a central role in the human immune system, a decrease of which would result in immune suppression and serious complications.10 It has been proposed that viral-induced lymphopenia might be due to direct infection, cytokine-mediated cell death, tissue sequestration of lymphocytes, or suppression of the bone marrow or thymus for T-cell generation.11 In the case of MERS-CoV, apoptosis induced by direct viral infection of T cells has been observed in vitro, which possibly explained lymphopenia in MERS patients.11 SARS-CoV-1 viral particles were also observed in multiple leukocytes from an autopsy study, suggesting that direct infection might account for the decrease in lymphocytes.12 Similarly, SARS-CoV-2 particles or proteins were also found in the spleen and lymph nodes from a study of 91 deceased COVID-19 cases, suggesting an infection of lymphocytes.13 Furthermore, in COVID-19 immune landscape depicted by single-cell RNA-seq studies, SARS-CoV-2 viral RNA has been found in multiple immune cells, including myeloid cells with phagocytic activity (neutrophil and macrophage) and lymphocytes without phagocytic activity (T, B, and NK cells).14,15 Notably, SARS-CoV-2 RNA-positive immune cells did not co-express the entry factors ACE2 and TMPRSS2, or other hypothesized entry co-factors.14,15 It is speculated that cell-associated SARS-CoV-2 viral positivity may represent a mixture of replicating virus, immune cell engulfment, and virions or virally infected cells attached to the cell surface.14,15

It has been shown that SARS-CoV-2-infected human monocytes, monocyte-derived macrophages, and dendritic cells in vitro, which potentially plays a major role in COVID-19 pathogenesis.16,17 However, whether SARS-CoV-2 infects lymphocytes, which do not express ACE2, to result in lymphopenia is still unknown. This knowledge gap also brings difficulty for our understanding of how lymphocytes lost the ability to control viral infection. Here, we provided evidence that activated T lymphocytes could be infected by SARS-CoV-2 in an ACE2-independent manner. The infection leads to pronounced T-cell apoptosis in vitro or in patients with COVID-19. Our findings shed light on the understanding of SARS-CoV-2 infection-induced lymphopenia.

Results

Presence of SARS-CoV-2 in lymphocytes from patients with COVID-19

Multiple immune cell types, including lymphocytes, have been shown enriched for SARS-CoV-2 viral RNA in multiple single-cell RNA-seq studies.14,15 To determine whether SARS-CoV-2 infects lymphocytes, we analyzed peripheral blood cells (PBCs) collected from COVID-19 patients. PBCs were prepared from 22 patients, who were all at severe condition during the study along with 15 healthy donors. We first analyzed major lymphocyte cell types including T (CD4 + helper T and CD8 + cytotoxic T), B, and natural killer (NK) cells for their population changes or the presence of viral antigen upon infection. For all patients tested, the ratios of blood T lymphocytes declined significantly compared to those in healthy donors, whereas B and NK cells appeared to be unaffected (Fig. 1a). Notably, CD4 + and CD8 + T lymphocytes almost declined to zero in some patients (Fig. 1b). The results suggested that lymphopenia in these patients is likely attributed to a decline of T lymphocytes.

figure 1
Fig. 1

We then analyzed the presence of SARS-CoV-2 viral antigens in PBCs using flow cytometry or by immunofluorescence assay (IFA). The results suggested that T lymphocytes were infected and in certain patient CD4 + T cells showed a high infection rate (Supplementary Fig. S1a). We also confirmed the presence of viral antigen in T lymphocytes from patient blood by immunofluorescence analysis (IFA) (Fig. 1c). Furthermore, we prepared postmortem lung sections from patients with a fatal infection and analyzed T lymphocytes infiltration and virus infection. We found T lymphocytes infiltration in the lung section, and many T lymphocytes were also positive for SARS-CoV-2 NP staining, indicating virus infection (Fig. 1d). A similar finding has also been reported.13 Taken together, we showed the presence of SARS-CoV-2 viral antigen in T lymphocytes either in the blood or in the lung section from the COVID-19 patients.

To further corroborate these findings, virus isolation was attempted from viral NP-positive PBCs. Patient PBCs were collected, determined for viral antigen using flow cytometry, and then co-cultured with Caco2 cells after three washes. Positive detection of viral RNA in the supernatant or viral protein in the Caco2 cells after co-culture indicated successful isolation and amplification of SARS-CoV-2 from PBCs of some COVID-19 patients (3 out of 5) but not from the healthy control (Supplementary Fig. S1b–e). Notably, in the three viral isolation positive samples, two also showed viral positive in the flow cytometry assay (P2 and P4), while the third one (P5) likely carried infectious virus at a level that was under the detection limit of flow cytometric analysis. Above all, we observed SAR-CoV-2 viral RNA and viral protein, and likely infectious virus in T lymphocytes from COVID-19 patients.

SARS-CoV-2 infection of T cells in vitro

Since T lymphocytes population decreased in COVID-19 patients and CD4 + T lymphocytes showed a high viral antigen-positive rate, we then investigated whether SARS-CoV-2 infects CD4 + T lymphocytes. For this purpose, we conducted a serial of experiments to test whether SARS-CoV-2 infects T cells. Upon infection, both viral RNA detection targeting at the receptor-binding domain (RBD) and viral subgenomic mRNA (sgRNA) targeting at M gene were tested. Viral sgRNA is transcribed only in infected cells during viral replication and is not packaged into virions, and therefore indicates the presence of actively infected cells in samples. Viral nucleocapsid protein (NP) and viral particles were also detected using western blot (WB), flow or electron microscopy (EM). Jurkat or MT4 cells, two commonly used CD4 + T cell lines, and primary T cells isolated from healthy donors were infected with SARS-CoV-2 (Fig. 2a). In some experiments, T cells were also activated by Phorbol myristate acetate (PMA) for 2 h for Jurkat cells or by a combination of IL2 + CD3 + CD28 for 3 days for primary T cells before infection, considering a large proportion of T cells is activated in human (Supplementary Fig. S2).

figure 2
Fig. 2

At 0, 24, 48, and 72 h post infection, it was observed that SARS-CoV-2-infected Jurkat T-cell line in a time-dependent manner, and the infection was more robust in activated T cells. Accumulation of viral RNA and sgRNA in cells or viral RNA in the culture supernatant was observed (Fig. 2b). Next, we sought to determine whether the qPCR detection assay represents only partial viral genome replication. We performed RNA-seq analysis of the SARS-CoV-2-infected activated Jurkat T cells at 0 or 24 h p.i. and analyzed the viral reads depth and coverage across the viral genome. Compared to 0 h infected, a much higher depth of viral genomes (as high as 5000 reads depth) can be observed in the 24 h-infected cells, demonstrating an effective replication (Fig. 2c). We then determined viral antigens by WB and flow assay. Our results showed a time-dependent increased level of viral NP in cells or in the supernatant, similar to the findings in viral RNA detection (Fig. 2d, e). We further employed electron microscopy to analyze SARS-CoV-2 infection of T-cell lines. Activated Jurkat or MT4 cells were infected with SARS-CoV-2 for 72 h and viral particles with typical coronavirus morphology were observed in the cytoplasm of the infected cells (Fig. 2f). Finally, to corroborate the findings from T-cell lines, we tested the infectivity of primary T cells isolated from healthy donors. In the three donors, SARS-CoV-2 showed time-dependent infection of T cells that is peaked at 8 h, probably because of extensive cell death induced by the virus at this time point (discussed below). Activation sensitized the cells to SARS-CoV-2 infection in two of the three donors. As comparison, primary colon organoid was also infected, which showed much higher infection efficiency compared to T cells (Fig. 2g, h). Taken together, our data clearly show that SARS-CoV-2 could infect T cells in vitro, although at a lower efficiency compared to tissue cells.

SARS-CoV-2 infection of T cells is ACE2 and TMPRSS2-independent

It is generally believed that ACE2 is the entry receptor for SARS-CoV-2. However, major cell populations in PBCs express extremely low levels of ACE2, raising the question whether ACE2 also mediates SARS-CoV-2 virus entry of T cells. We first tested whether an ACE2 knockdown could dampen SARS-CoV-2 infection of T cells. The data showed ACE2 was successfully knocked down by ACE2-shRNAs in Caco2 cells. Jurkat T cells do not express detectable ACE2 under either mock or knocked down conditions (Fig. 3a). Correspondingly, ACE2 knockdown resulted in dramatically decreased SARS-CoV-2 infection in Caco2 cells but not in Jurkat T cells (Fig. 3b). To further confirm this finding, we did ACE2 knocked out in Caco2 and Jurkat cells (Fig. 3c). Similar to ACE2-knockdown cells, viral load decreased in Caco2-ACE2-KO cells but not in Jurkat-ACE2-KO cells (Fig. 3d). These results suggested that SARS-CoV-2-infected T cells in an ACE2-independent manner.

figure 3
Fig. 3

It was reported that soluble human ACE2 protein could block SARS-CoV-2 infection through competing virus binding with the cellular receptor.3 Thus, ACE2 antibody pre-incubated cells or spike antibody pre-incubated SARS-CoV-2 should also block viral infection, if the infection depends on spike-ACE2 binding. To analyze whether these molecules affect SARS-CoV-2 infection of T cells, we incubated virus with soluble human ACE2 protein or a commercial mAb targeting at RBD-ACE2 binding, or incubated cells with ACE2 blocking antibody before the infection of Caco2 or activated Jurkat T cells. The intracellular viral RNA was analyzed after infection. In Caco2, the three blockers strongly blocked SARS-CoV-2 infection, and ACE2 protein appears to be more potent than the other two treatments. In contrast, none of the three treatments affected the SARS-CoV-2 infection of Jurkat T cells (Fig. 3e).

Lastly, it is known that SARS-CoV-2 uses the serine protease TMPRSS2 for S protein priming before binding to ACE2 receptor, and a TMPRSS2 inhibitor has been approved for clinical use (Camostat) to block SARS-CoV-2 entry.1 The RNA expression of TMPRSS2 in Caco2, Jurkat, and activated Jurkat cells was determined by qPCR. The result suggested that neither unactivated nor activated Jurkat cell-expressed TMPRSS2 (Fig. 3f). We observed that Camostat inhibited SARS-CoV-2 infection of Caco2 cells in a dose-dependent manner. At a dose of 20 μm, Camostat almost completely blocked viral infection of Caco2 cells. In contrast, Camostat showed no inhibitory effect on SARS-CoV-2 infection of Jurkat T cells even at a high dose (Fig. 3g). Collectively, these results suggested that SARS-CoV-2 infection of T cells does not rely on the spike-ACE2/TMPRSS2 interaction.

SARS-CoV-2 infection triggered T-cell death

It is known that severe patients with COVID-19 showed marked decreased lymphocyte populations. To determine whether SARS-CoV-2 infection contributes to T-cell death, we tested PBC T lymphocytes apoptosis collected from patients with COVID-19. T lymphocytes from patients or from healthy donors were dual-labeled with a CD3 antibody and a viral NP antibody, and apoptosis was analyzed with the TUNEL assay. T lymphocytes from COVID-19 patients underwent pronounced apoptosis compared to those from the healthy donors, showing a more than tenfold increase of apoptotic cells. In some patients, most of the apoptotic cells were also viral antigen-positive (e.g., 65% in patient 1), suggesting viral infection played a role in peripheral blood T lymphocytes death in these patients (Fig. 4a).

figure 4
Fig. 4

To confirm the role of viral infection in T-cell death, we experimentally infected primary T cells isolated from healthy donors. With or without activation, cells were experimentally infected with SARS-CoV-2 for 8 h and apoptosis was analyzed with TUNEL assay. It can be observed that SARS-CoV-2 infection induced pronounced apoptosis in infected T cells compared with the mock-treated cells. Activation sensitized T cell to viral infection, as shown by higher apoptotic cells in the activated group (Fig. 4b).

Finally, we determined the cellular responses in T cells upon SARS-CoV-2 infection by bulk RNA-seq analysis. Activated Jurkat T cells were infected with SARS-CoV-2 for 0, 24, 48, and 72 h before they were collected for TUNEL assay. It can be observed that virus induced significant apoptosis at 72 h post infection, compared to mock-infected or cells at other time points (Fig. 4c). We then determined the dynamic cellular responses in cells that have been infected for 24 or 48 h, as the cells in 72 h groups contained too many dead cells and were not suitable for RNA-seq analysis. Compared to the 24 h group, the hypoxia-related GO pathways are significantly upregulated in 48 h group, including “PID HIF1 TF pathway”, “response to hypoxia”, “positive regulation of cell death”, and “intrinsic apoptotic signaling pathway”. It has been shown that SARS-CoV-2 infection triggers mitochondrial ROS production, which induces stabilization of hypoxia-inducible factor-1a (HIF-1a) in monocytes.16 Similarly in T cells, multiple genes involved in this oxidative stress response were upregulated: BNIP3, PFKFB3, FOS, JUN, BHLHE40, GADD45B, PDK1, and DDIT4 (Fig. 4d). To corroborate the findings in T cell lines, we conducted RNA-seq analysis to primary peripheral blood mononuclear cells (PBMCs) collected from three healthy donors and three severe COVID-19 patients. Our data showed an upregulation of cell responses to stimuli, cell death, or response to hypoxia pathways, and a down-regulation of leukocytes activation and signaling pathways, similar to the findings in the T-cell line (Fig. 4e). In summary, SARS-CoV-2 infection induced pronounced T-cell death, which is probably dependent on mitochondria ROS-hypoxia pathways.

Exploration of potential receptors in T cells

Since our results suggested that the infection of SARS-CoV-2 to Jurkat T cell is ACE2-independent, we tried to identify the potential receptors. We first explored the expression of the known SARS-CoV-2 receptors or co-factors that have been identified in primary T cells from public single-cell NGS data14 and in Jurkat T cells in RNA-seq analysis with or without activation, including ACE2/TMPRSS2, AXL, NRP1, KIM-1/TIM-1, ASGR1, and KREMEN1.18,19,20 Moreover, ITGB2 (leukocyte-associated molecule-1, LFA-1), the leukocyte cell Adhesion molecule, has been suggested binding to SARS-CoV-1 ORF7a.21 As SARS-CoV-2 shares similar ORF7a as SARS-CoV-1, it would be interesting to evaluate whether LFA-1 also mediated SARS-CoV-2 infection of T cells.

Our data showed minimal expression of the following molecules in SARS-CoV-2-positive T cells from patients: ACE2, TMPRSS2, ASGR1, KREMEN1, and NRP1 (Fig. 5a and Supplementary Fig. S3a). In contrast, AXL and LFA-1 were expressed in these cells. In Jurkat cells, LFA-1 also showed very high expression, although it was not upregulated following a 2 h activation (Supplementary Fig. S3b). Taken together, AXL and LFA-1 appeared to be promising targets as entry molecules.

figure 5
Fig. 5

AXL was proposed to be a candidate receptor for SARS-CoV-2 in a previous study and the function in mediating SARS-CoV-2 infection is independent of ACE2.19 BEAS-2B that was used as a positive control for AXL-SARS-CoV-2 studies was pretreated with AXL proteins of different concentrations (25, 50, 100 μg/ml) for 30 min and then infected with SARS-CoV-2. The infection of SARS-CoV-2 could be significantly inhibited by AXL protein at a concentration of 25 μg/ml. In contrast, SARS-CoV-2 infection of Jurkat cells could not be inhibited even at 100 μg/ml (Fig. 5b). Next, we constructed AXL-knockdown or overexpression cell lines on Jurkat cells and then tested the effect on viral infection. Our data showed that AXL knockdown could not block SARS-CoV-2 infection, but an AXL overexpression could slightly enhance the infection (1.5-fold) (Fig. 5c). Taken together, AXL should not be a main receptor for SARS-CoV-2 in Jurkat cells but it may contribute to infection.

LFA-1 is widely expressed on the surface of many leukocytes, and T-cell activation changed the structure of LFA-1 to a high-affinity mode, but not expression level.22 We then overexpressed the high-affinity alpha subunit of LFA-1 protein in ACE2 knockdown Caco2 cells (Caco2-ACE2-shRNA) and Jurkat cells. Our qPCR data showed that the LFA-1 overexpression successfully restored the dampened infection in ACE2 knockdown Caco2 cells, and also enhanced viral infection in Jurkat cells (threefold increase), as shown in cellular viral RNA levels (Fig. 5d, e). To corroborate the finding, we also performed IFA to detect viral NP expression. After an 8 h infection, viral NP-positive cells were compared. Our data showed a dampened SARS-CoV-2 infection in ACE2-knockdown cells, and a much higher NP in LFA-1 overexpression ACE2-knowckdown cells (Fig. 5f, g).

Finally, the LFA-1-knockdown Jurkat cell line was constructed and infected by SARS-CoV-2 (MOI = 0.01). At a 24 h post infection, viral load in the knockdown cell line was significantly decreased compared to the control cell line (Fig. 5h). Lifitegrast, an inhibitor that blocked LFA-1 binding to its extracellular ligand, was also used to pretreat activated Jurkat cells before infection. The qPCR results showed that at a concentration of 200 nM, Lifitegrast could also reduce the viral load in Jurkat cells (Fig. 5i). Collectively, our results suggested that LFA-1 should be an attachment factor or potential entry molecular for SARS-CoV-2 during its infection in Jurkat cells.

Discussion

Here, we showed that SARS-CoV-2 infected T lymphocytes, mainly CD4 + T cells, in an ACE2-independent manner. SARS-CoV-2 infection triggered pronounced T-cell death, which potentially contributed to lymphopenia in patients with COVID-19. T-cell infection may also pose profound influences on patients. Infected T lymphocytes not only lost the ability to control viral infection but may also carry viruses to other parts of the body through blood circulation. In addition, this ACE2-independent infection mode may compromise the therapeutic effect of neutralizing antibodies targeting at spike-ACE2 binding. These may synergistically result in more severe infection outcomes in patients with COVID-19.

It has been debated whether SARS-CoV-2 impaired the functionality of immune cell populations through direct infection. Our results provided evidence to show that SARS-CoV-2-infected T cells, as viral RNA, viral sgRNA, viral protein, and the infectious virus could be detected from T cell upon infection or from patient PBCs, although the production of infectious virus particles may stay at a low level. Several recent studies also revealed that multiple immune cells carry viral antigen or viral RNA, including neutrophils, macrophages, inflammatory monocytes, plasma B cells, T cells, and NK cells through postmortem histology analysis and single-cell/single-nuclear RNA-seq to lung or BALF.13,14,15 This suggests that SARS-CoV-2 should have a broad tropism of target cells, including major immune cells populations.

Human ACE2 and TMPRSS2 proteins were recognized as the main proteins that mediated SARS-CoV-2 cell entry.14 The newly discovered binding molecules AXL and NRP1 are still dependent on ACE2 as the main receptor.18,19 Our discovery of ACE2-independent infection of T cells is surprising, but is also supported by previous discoveries that there are SARS-CoV-2 RNA+ cells which did not co-express ACE2 and TMPRSS2.15 In our data, SARS-CoV-2 showed significant infection of activated T cells, suggesting there should be a new entry mechanism in T cells. The identification of LFA-1, as an entry molecule that contributed to a SARS-CoV-2 infection of T cells would be important for developing clinical therapeutics, although future questions remain. For example, what is the LFA-1 binding protein in SARS-CoV-2 virion if it is not the spike protein. Since LFA-1 is expressed in a number of other leukocytes, it can be expected that other immune cells (including macrophages or monocytes) could also be infected by SARS-CoV-2 potentially through binding with LFA-1. These questions should be addressed in future studies.

The infection of CD4 + T lymphocytes by SARS-CoV-2 virus may be a major contributor of virus induced pathogenesis. Armed T cells play a pivotal role against pathogen infection.10 As shown in our data, these T cells are likely to be targets of SARS-CoV-2 infection and undergo apoptosis in the HIF-1a-dependent pathway. These events may lead to T-cell dysfunction, depletion, and eventually lymphopenia in patients. In addition, the dying CD4 + T lymphocytes could trigger excessive inflammation that leads to severe immunopathogenesis in patients. Notably, the population of CD8 + T lymphocytes is also significantly decreased in COVID-19 patients. Unlike CD4 + T lymphocytes, these cells were not determined to contain SARS-CoV-2 viral antigen in flow cytometry. The mechanism underlying SARS-CoV-2 infection-induced CD8 + T lymphocytes depletion is currently unknown. Besides viral infection, several mechanisms, including the presence of endogenous or exogenous glucocorticoids, over-activated neutrophil releasing inhibitors of T cell activation (Arginase 1 and CD274) and cytokine-regulated selective differentiation of bone marrow cells, might also contribute to lymphocytes depletion.11,23 Further in-depth investigation is needed to address the potentially multi-mode mechanisms that lead to lymphopenia in the COVID-19 patients. Considering the apparent correlation between lymphopenia and disease progression in COVID-19 patients, it is important to develop strategies to prevent virus-induced lymphopenia.

Materials and methods

Samples and ethics

Human blood and tissue samples from patients with COVID-19 or from healthy donors were collected by Tongji hospital with consent from all persons. Fresh lung biopsy sections were prepared from a deceased patient. The ethics committee of the designated hospitals for emerging infectious diseases approved all human samplings.

Cell lines and virus culture

Vero E6, Caco2, 293T-sg, GP2-293, and BEAS-2B in DMEM + 10% FBS, or MT4 and Jurkat T cells in RPMI1640 + 10% FBS (Gibco, C22400500BT), or A549 cells in DMEM/F12 + 10% FBS, or primary T cells in X-vivo (Lonza, 04-418Q) medium containing IL-2 (Peprotech, 200-02) were cultured at 37 °C in a humidified atmosphere of 5% CO2. All cell lines were tested free of mycoplasma contamination and applied to species identification and authenticated by microscopic morphologic evaluation. None of cell lines was on the list of commonly misidentified cell lines (by ICLAC). SARS-CoV-2 isolate WIV04 (GISAID accession number EPI_ISL_402124) was used in this study. WIV04 was isolated from Huh7 cells from the original sample and was passaged in Caco2 cells. Viral titer (TCID50/ml) was determined in Vero E6 cells.

Proteins and antibodies for SARS-CoV-2

SARS-CoV-2 strain WIV04 NP and predicted RBD were inserted into pCAGGS vector with an N-terminal S-tag. Constructed plasmids were transiently transfected into HEK293T-17. Supernatant collected for protein purification was purified using S-tag resin, the purity and yield were tested using anti-S-tag mAb (generated in-house). Rabbits were immunized with purified NP proteins three times at a dose of 700 ng/each, 2 weeks interval. Rabbit serum was collected at 10 days after the final immunization. Antibody titer was determined in an ELISA using purified NP protein as a detection antigen.

Peripheral blood cells (PBCs) preparation and SARS-CoV-2 infection

The blood samples from patients with COVID-19 or healthy donors were processed in BSL3 lab at WIV. In all, 1× RBC lysis buffer was made from eBioscience™ 10× RBC Lysis Buffer before the experiment (Multi-species, Invitrogen). Human blood samples were centrifuged at 500 × g for 10 min before being treated with 2 ml 1× RBC lysis buffer for no more than 15 min at room temperature. Cells were spun down at 500 × g for 10 min, followed by treatment using 2 ml 1× RBC lysis buffer for another 10 min at room temperature to remove the residue red blood cells. Cells were ready for use after centrifugation. Cells were spin washed (500 × g for 10 min each time) three times with PBS containing 2% BSA before staining of cell marker antibodies.

For infection, PBCs were seeded into 24-well plates in Roswell Park Memorial Institute 1640 culture medium (RPMI1640, ThermoFisher, 22400500BT) supplemented with 10% fetal bovine serum (FBS, Life Technologies, 10099141) at a density of 1 × 106 cells/ml. PBCs were infected with SARS-CoV-2 at 0.1 MOI. One hour after incubation, cells were spin washed for three times using RPMI1640. PBCs were then seeded with RPMI1640 supplemented with 10% FBS in new 24-well plates at 37 °C supplied with 5% CO2 for 12 h or 24 h before being collected for further analysis.

For IFA on patient PBCs, overnight fixed cells were evenly smeared over a glass coverslip. The presence of viral NP was detected with rabbit pAb against the SARS-CoV-2 NP protein (generated in-house, 1:1000) and a Cy3-conjugated goat anti-rabbit IgG (1:200, Abcam, ab6939). T lymphocytes were detected using a rabbit anti-human CD3 antibody (1:100, Abcam, ab5690). Nuclei were stained with DAPI (Beyotime, C1002). Staining patterns were examined using confocal microscopy on a FV1200 microscope (Olympus).

For immunohistochemistry analysis on patient lung, the biopsy tissues from a deceased patient were fixed with 4% paraformaldehyde for 24 h, paraffin-embedded and cut into 5-μm sections. Multiplex immunofluorescence staining was obtained using PANO 7-plex IHC kit (0004100100, Panovue, Beijing, China). Slides were deparaffinized and rehydrated, followed by 15-min heat-induced antigen retrieval with EDTA pH 9.0. The slides were washed with PBS/0.02% Triton X-100 then blocked with 10% BSA at RT for 30 min, rabbit pAb against the SARS-CoV-2 NP protein (generated in-house, 1:1000) and rabbit anti-human CD3 antibody (1:100, Abcam, ab5690) were then used in incubation at 37 °C 1 h, followed by horseradish peroxidase-conjugated secondary antibody incubation and tyramide signal amplification. The slides were microwave heat-treated after each TSA operation. Nuclei were stained with 4’-6’-diamidino-2-phenylindole (DAPI, Beyotime, C1002) at the final stage of staining. To obtain multispectral images, the stained slides were scanned using the Mantra System (PerkinElmer). The scans were combined to build a single stack image. Unstained images and single-stained sections were used to extract the spectrum of autofluorescence of tissues or each fluorescein, respectively. The extracted images were further used to establish a spectral library required for multispectral immixing by InForm image analysis software (PerkinElmer). Using this spectral library, we obtained reconstructed images of sections with the autofluorescence removed.

PBCs co-cultured with Caco2 cells

PBCs from five patients were washed three times with PBS before co-cultured with Caco2 cells for 4 days and tested for SARS-CoV-2 viral RNA in the supernatant or antigen in Caco2 cells. In the meantime, PBCs were analyzed for the presence of viral antigen by flow cytometry.

Human colon organoids culture and SARS-CoV-2 infection

Human colon organoids were generated and cultured as described in the previous study.24 Briefly, colon organoids in matrigel were digested and washed twice with medium before infection. SARS-CoV-2 was added to infect colon organoids at an MOI of 0.01. 24 h later, colon organoids were then spun down and washed twice with medium. Viral RNA in colon organoids was determined by qPCR.

Activation of Jurkat and primary T cells

To activate Jurkat cells, 2.5E + 06 of cells were seeded to a well of a six-well plate containing 2.5 ml of RPMI1640 medium containing 10% FBS. In total, 40 ng/ml of PMA (Invivogen, tlrl-pma) was added to cells and incubated at 37 °C for 2 h. Cells were centrifuged at 300 × g at room temperature for 10 min before discarding the supernatant and cultured with fresh RPMI1640 medium containing 10% FBS. Primary human CD3 T lymphocytes were isolated from blood of healthy donors using CD3 Microbeads of Human (Miltenyi, 130-050-101). To activate primary T cells, frozen T cells were thawed and cultured with X-vivo (Lonza, 04-418Q) containing 1 μg/ml of IL-2 (Peprotech, 200-02). Cells were cultured with a volume of 7.5 μl of T Cell TransAct (Miltenyi Biotec) in the medium for 3 days at 37 °C. Cells were then spun down and cultured with fresh IL-2/X-vivo medium before viral infection.

T-cells infection

Jurkat T cells or primary human CD3 T lymphocytes were infected with SARS-CoV-2 at a MOI of 0.01, 0.1, or 1 depending on the purpose of the experiment. Supernatant or cells were harvested at 0, 24, 48, or 72 hpi after three times PBS washing for Jurkat T cells, or 0, 4, 8, and 12 hpi for primary T cells. Cellular or supernatant viral RNA or protein expression was determined by qPCR, RNA-seq, WB, or flow cytometry. GAPDH was used in qPCR as internal control and beta-tubulin was used in WB (1:5000, 66240-1-Ig from Proteintech) as an internal control.

Flow cytometry analysis of human peripheral blood samples

For surface staining, PBCs were incubated with fluorochrome-labeled antibodies specific for humans before fixation: AF-700-anti-CD45 (2D1), percp-anti-CD19 (HIB19), APC/CY7-anti-CD3 (UCHT1), BV510-anti-CD4 (OKT4) and percp/Cy5.5-anti-CD8a (HTT8a). Antibody-stained PBCs were fixed overnight with 4% PFA at 4 °C and taken out of BSL3 lab for downstream analysis. Cells were stained further with in-house-made SARS-CoV-1 NP pAb (1:500) at 4 °C for 30 min after permeabilization. Then cells were stained with FITC-anti-Rabbit IgG (H + L) at room temperature for 30 min. AF-700-anti-CD45 (2D1), APC/CY7-anti-CD3 (UCHT1), BV510-anti-CD4, and percp/Cy5.5-anti-CD8a antibodies were purchased from Biolegend and all were used at 1:100. FITC-anti-Rabbit IgG (H + L) was from Proteintech (SA00003-2).

RNA extraction and qPCR

Whenever commercial kits were used, the manufacturer’s instructions were followed without modification. RNA was extracted from 140 μl of samples with the QIAamp® Viral RNA Mini Kit (QIAGEN). RNA was eluted in 50 μl of elution buffer and used as the template. The qPCR detection of SARS-CoV-2 was performed using HiScript® II One-Step qPCR SYBR® Green Kit plus One-Step qPCR Probe kit targeting at either M for sgRNA (designed in house) or RBD of spike gene (commercial) following the instructions of the manufacturer (Q222-CN, Vazyme Biotech Co., Ltd). QPCR was run in a Step-One Plus real-time PCR machine (ABI) machine using default settings.

SARS-CoV-2 genome depth and coverage analysis

RNA was extracted from SARS-CoV-2 24 h-infected activated Jurkat T cells with the RNAprep Pure Cell/Bacteria Kit (TIANGEN, DP430). RNA was eluted in 50 μl of elution buffer and used as the template for RNA-seq. Clean reads were mapping to SARS-CoV-2 genome (WIV04) using software HISAT2 v2.1.0. After sorted and indexed with samtools v1.10-24, the coverage was calculated using genomeCoverageBed function from bedtools v2.29.2.

Transcriptome analysis

The SARS-CoV-2 24 h- and 48 h-infected Jurkat T cells (3 replicates each), blood samples from three healthy donors, and 3 severe COVID-19 patients were subjected for RNA-seq analysis. After mapping clean reads to GRCh38.p13 with HISAT2 v2.1.0 and format conversion with samtools v1.10-24, we used stringtie v2.1.0 to assemble and quantitate transcripts. Reads counts table of transcriptome generated by prepDE.py, a tool in stringtie, was used for gene differential expression analysis in R v4.1.0 with package DESeq2 v1.32.0. The gene with log2 fold change >2 and P value <0.05 was selected to perform enrichment analysis using online tools Metascape.

Public single-cell NGS data analysis

Public single-cell NGS data were downloaded, COVID-19 patients’ data were downloaded from GSE15805514 and healthy donors’ data were from GSE134355 (human cell landscape). According to the original information of each article, we extracted data of primary T cells from lung, thymus, and peripheral blood of healthy donors and virus-positive T cells of COVID-19 patients. Following the standard Seurat v4.0.4 workflow, we normalized the data and scaled it with UMI information. The expression of candidate receptors or co-factors was visualized with Seurat function FeaturePlot.

Western blot (WB) analysis

Infected or transduced cells were harvested at the indicated time point and lysed with RIPA Lysis Buffer (Beyotime, P0013C) for WB. Proteins in cell lysates were then separated on 10–12% SDS-polyacrylamide gel electrophoresis (PAGE) and further transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, SLHVR33RB). Blots were incubated with rabbit polyclonal anti-ACE2 (Servicebio, GB11267, 1:1000 dilution), rabbit polyclonal anti-2019-nCoV NP (1:1000 dilution), mouse monoclonal anti-beta-tubulin (Proteintech, 66240-1-Ig, 1:5000 dilution), and then appropriate rabbit or mouse peroxidase-conjugated secondary antibodies (Proteintech, 1:5000 dilution, SA00001-2, or SA00001-1). Immobilon western chemiluminescent HRP substrate (Millipore, WBKLS0500) was used for protein detection.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay

The TUNEL Assay kit purchased from Beyotime Biotechnology (C1088) was used to detect apoptosis in SARS-CoV-2-infected cells according to the manufacturer’s instructions. Briefly, cells fixed in 4% paraformaldehyde were permeabilized with 0.25% Triton X-100 for 20 min at 4 °C. Then the TdT reaction mixture containing TdT enzyme and fluorescent labeling solution was added to the cells to label the fragmented DNA. Cells were further stained with Rp3-CoV NP pAb (1:8000) or Rabbit anti-SARS-CoV-2 NP pAb (1:500) and CY3-anti-Rabbit IgG (H + L) (Proteintech, SA00009-2) after fixation. Labeled cells were analyzed with a flow cytometer (BD LSRFortessa).

ACE2 competition inhibition and antibody blocking experiments

Human recombinant full-length ACE2-Fc protein (GenScript, Z03484), Anti-ACE2 Ab (R&D, AF933) and RD#4-anti-Spike Ab (house-made monoclonal antibodies) were used. ACE2-Fc protein was diluted to 20 μg/μl in culture medium and then incubated with SARS-CoV-2 virus solution (MOI = 0.01) at a volume of 1:1 at 37 °C for 30 min. The RD#4-anti-Spike Ab was diluted to 320 ng/μl in culture medium and then incubated with SARS-CoV-2 virus solution (MOI = 0.01) at a volume of 1:1 at 37 °C for 30 min. The virus-ACE2 or virus–antibody mixtures were then added to Jurkat cells or Caco2 cells. Cells were collected for further analysis at 24 h post infection. For anti-ACE2 antibody blocking experiments, Jurkat cells or Caco2 cells were pretreated with 3.33 ng/μl anti-ACE2 antibody (R&D Systems, goat, AF933) at 37 °C for 30 min before infection.

Generation of KO, KD, overexpression cell lines

KO, KD, and overexpression plasmids were constructed on different vectors (pLenti-V2 for knockout, pLKO.1 vector for knockdown, and pQCXIH vector for overexpression). Knockout of ACE2 was accomplished by transduction of Caco2 and Jurkat cells with lentiviruses expressing specific sgRNAs targeting ACE2 (F: CACCG GCCTCCATCGATATTAGCAA; R: AAAC TTGCTAATATCGATGGAGGCC).

Knockdown of ACE2, AXL, LFA-1 was accomplished by transduction of Caco2 or Jurkat cells with lentiviruses expressing specific siRNAs (ACE2: 5′-GCCGAAGACCTGTTCTATCAA-3′; AXL: 5′- CCTGTGGTCATCTTACCTT-3′; LFA-1: 5′-GCCATCAATTATGTCGCGACA-3′ or scramble siRNA).

Then the transduced cells were cultured with puromycin (5 μg/ml for Caco2 or 1.5 μg/ml for Jurkat) for 7 days.

For overexpression, the full length of AXL or domain I of LFA-1 alpha subunit were amplified from Hep G2 cells or Jurkat cells respectively. Lentivirus transduced cells were cultured with hygromycin (35 μg/ml for Caco2 and Jurkat cells) for 7 days. For the infection, virus was added to the cells until the end of the experiment with 0.01 MOI. Infected cells were harvested at 24 hpi after twice washing with PBS. Intracellular viral protein expression was determined by western blotting assay with antibody against virus NP protein and viral RNA in the cytoplasm was determined by qPCR.

TMPRSS2 blocking assay

Camostat mesylate (MCE, HY-13512-10 mM) was diluted to a final concentration of 20 μM or 2 μM. In total, 100 μl (for a 48-well plate) or 200 μl (for a 24-well plate) of Camostat solutions were added to cells. One hour later, activated Jurkat and Caco2 cells were infected with SARS-CoV-2 at 0.01 MOI. The cell lysate was harvested at 24 hpi and viral RNA in the cytoplasm was determined by qPCR. Viral NP was analyzed by western blot.

Candidate receptor proteins competition inhibition experiments

Recombinant Human AXL Protein (MedChemExpress, HY-P7622) was diluted to different concentrations with culture medium and then incubated with SARS-CoV-2 virus (MOI = 0.01) at a volume of 1:1 at 37 °C for 30 min. Mixtures were then added to infect activated Jurkat cells and BEAS-2B cells. Samples were harvested at 24 hpi and cellular viral RNA was determined by qPCR.

LFA-1 inhibition experiment

Lifitegrast (MedChemExpress, HY-19344) was diluted to different concentrations and pretreated activated Jurkat cells at 37 °C before infection. Thirty minutes later, cells were infected with SARS-CoV-2 (MOI = 0.01) and samples were harvested at 24 hpi. Viral RNA in the cytoplasm was determined by qPCR.

Electron microscopy

Activated Jurkat and MT4 cells were infected with the SARS-CoV-2 (MOI = 1) for 72 h. Cells were collected and fixed with 2.5% (w/v) glutaraldehyde and 1% osmium tetroxide, dehydrated through a graded series of ethanol concentrations (from 30 to 100%), and embedded with epoxy resin. Ultrathin sections (80 nm) of embedded cells were prepared, deposited onto Formvar-coated copper grids (200 mesh), stained with uranyl acetate and lead citrate, and analyzed using a 200-kV Tecnai G2 electron microscope.

Statistical analysis

Data analyses were performed using GraphPad Prism 7.0 software. Data were shown as mean ± SD. Data were analyzed with Shapiro–Wilk normality test and confirmed to the Gaussian distribution. Statistical analysis was performed using Student’s t test with two-tailed, 95% confidence. P values less than 0.05 were considered statistically significant.

Data availability

Data presented in this study are available on request from the corresponding authors. The data are not publicly available due to limitations in the material transfer agreement.

References

  1. Hoffmann, M. et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell 181, 271–280 e278 (2020).CAS Article Google Scholar 
  2. Li, W. et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 426, 450–454 (2003).CAS Article Google Scholar 
  3. Monteil, V. et al. Inhibition of SARS-CoV-2 infections in engineered human tissues using clinical-grade soluble human ACE2. Cell 181, 905–913 e907 (2020).CAS Article Google Scholar 
  4. Wang, Q. et al. Structural and functional basis of SARS-CoV-2 entry by using human ACE2. Cell 181, 894–904 e899 (2020).CAS Article Google Scholar 
  5. Zhou, P. et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579, 270–273 (2020).
  6. Guan, W. J. et al. Clinical characteristics of coronavirus disease 2019 in China. N. Engl. J. Med. 382, 1708–1720 (2020).CAS Article Google Scholar 
  7. Huang, C. et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 395, 497–506 (2020).CAS Article Google Scholar 
  8. Wang, D. et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in Wuhan, China. JAMA 323, 1061–1069 (2020).CAS Article Google Scholar 
  9. Xu, Z. et al. Pathological findings of COVID-19 associated with acute respiratory distress syndrome. Lancet Respir. Med. 8, 420–422 (2020).CAS Article Google Scholar 
  10. Kumar, B. V., Connors, T. J. & Farber, D. L. Human T cell development, localization, and function throughout life. Immunity 48, 202–213 (2018).CAS Article Google Scholar 
  11. Chu, H. et al. Middle east respiratory syndrome coronavirus efficiently infects human primary T lymphocytes and activates the extrinsic and intrinsic apoptosis pathways. J. Infect. Dis. 213, 904–914 (2016).CAS Article Google Scholar 
  12. Gu, J. et al. Multiple organ infection and the pathogenesis of SARS. J. Exp. Med. 202, 415–424 (2005).CAS Article Google Scholar 
  13. Bian, X. W., COVID-19 Pathology Team. Autopsy of COVID-19 victims in China. Natl Sci. Rev. 7, 1414–1418 (2020).CAS Article Google Scholar 
  14. Ren, X. et al. COVID-19 immune features revealed by a large-scale single-cell transcriptome atlas. Cell 184, 1895–1913 e1819 (2021).CAS Article Google Scholar 
  15. Delorey, T. M. et al. COVID-19 tissue atlases reveal SARS-CoV-2 pathology and cellular targets. Nature 595, 107–113 (2021).CAS Article Google Scholar 
  16. Codo, A. C. et al. Elevated glucose levels favor SARS-CoV-2 infection and monocyte response through a HIF-1alpha/glycolysis-dependent axis. Cell Metab. 32, 498–499 (2020).CAS Article Google Scholar 
  17. Zheng, J. et al. Severe acute respiratory syndrome coronavirus 2-induced immune activation and death of monocyte-derived human macrophages and dendritic cells. J. Infect. Dis. 223, 785–795 (2021).CAS Article Google Scholar 
  18. Cantuti-Castelvetri, L. et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science 370, 856–860 (2020).CAS Article Google Scholar 
  19. Wang, S. et al. AXL is a candidate receptor for SARS-CoV-2 that promotes infection of pulmonary and bronchial epithelial cells. Cell Res. 31, 126–140 (2021).CAS Article Google Scholar 
  20. Gu, Y. et al. Receptome profiling identifies KREMEN1 and ASGR1 as alternative functional receptors of SARS-CoV-2. Cell Res. 32, 24–37 (2022).CAS Article Google Scholar 
  21. Hanel, K. & Willbold, D. SARS-CoV accessory protein 7a directly interacts with human LFA-1. Biol. Chem. 388, 1325–1332 (2007).Article Google Scholar 
  22. Mao, D., Lu, S., Li, N., Zhang, Y. & Long, M. Conformational stability analyses of alpha subunit I domain of LFA-1 and Mac-1. PLoS ONE 6, e24188 (2011).CAS Article Google Scholar 
  23. Darcy, C. J. et al. Neutrophils with myeloid derived suppressor function deplete arginine and constrain T cell function in septic shock patients. Crit. Care. 18, R163 (2014).Article Google Scholar 
  24. Crespo, M. et al. Colonic organoids derived from human induced pluripotent stem cells for modeling colorectal cancer and drug testing. Nat. Med. 23, 878–884 (2017).CAS Article Google Scholar 

Why COVID-19 Is Here to Stay, and Why You Shouldn’t Worry About It

Authors: August 17, 2021 by Philippe Lemoine

As many countries are going through another wave of infections, including some where the vast majority of the population has been vaccinated, many are starting to despair that we’ll never see the end of the pandemic. In this post, I will argue that, on the contrary, not only is the pandemic already on its way out, but the virus will be relatively harmless after it has become endemic. This is going to happen not because the SARS-CoV-2 will become intrinsically less dangerous, although it might, but rather because what made the virus so dangerous was that nobody had immunity against it, so once it has become endemic it will infect fewer people and even those who end up infected will be much less at risk. Moreover, I will explain that, despite widespread anxiety about the emergence of new variants and the danger of immune evasion, the fact that SARS-CoV-2 is mutating will not prevent this outcome because of the way immunity works. Finally, I will argue that, although some people are calling to pursue the eradication of SARS-CoV-2 (as we have done with smallpox), we almost certainly couldn’t eradicate it even if we wanted to and that even if we could it wouldn’t be worth it.

SARS-CoV-2 is going to become mostly harmless

You may have heard that, as they evolve, viruses necessarily become less lethal because it makes no evolutionary sense for them to kill the hosts on which they depend for their survival and reproduction, but this is a myth and it’s not what I’m saying. The claim I’m making is based on a much sounder and more straightforward argument. But to understand why it’s true, you first have to understand that, as the virologist Dylan H. Morris explained in a great essay, what made SARS-CoV-2 so dangerous is not so much its intrinsic characteristics but the fact that it was novel, which means that nobody in the population had immunity against it.1 Indeed, while the debate about whether SARS-CoV-2 was “worse than the flu” or “just like the flu” dominated the early phase of the pandemic and to some extent is still ongoing, this question is not even well-posed because there is no such thing as the dangerousness of a virus simpliciter. The dangerousness of a virus is always relative to a particular context. This should be obvious if you consider the impact that the availability of effective treatments can have on how much damage a virus does. For instance, HIV was initially devastating because it invariably killed the people it had infected within a few years after symptoms onset, but thanks to the development of effective treatments infected people can now live a relatively normal life, at least in the developed world where people can afford such treatments. HIV has not become any less intrinsically dangerous, but it’s undoubtedly far less dangerous in societies where effective treatments are easily available.

In the case of SARS-CoV-2 though, the key contextual factor is what proportion of the population has immunity against it. Immediately after the emergence of the virus, the population was immunologically naive, which means that nobody had immunity against it beyond that conferred by the innate immune system against any pathogen.2 The amount of damage and disruption caused by a virus can differ wildly depending on whether the population in which it’s introduced is immunologically naive to it. This is because, when nobody in the population has immunity, 1) the virus spreads more easily and infects more people because everyone is susceptible to infection and 2) when people get infected they have a much higher chance of developing a severe form of the disease because their immune system does not yet have any weapons specifically tailored to fight this virus. So the same virus, with exactly the same intrinsic properties, can do vastly more damage in a population that is immunologically naive than in a population where everyone has immunity against it, either because they have previously been infected or because they have been vaccinated. That’s one of the reasons why entire indigenous communities in America were almost completely wiped out by pathogens brought by Europeans, even though people in Europe had been living with the same pathogens for centuries or even millennia and, while they were not by any means harmless to them, they didn’t threaten their existence.3

As more people get infected by SARS-CoV-2 or vaccinated against it, the virus will become endemic and continue to circulate following a seasonal pattern (because immunity whether acquired naturally or through vaccination is not 100% effective against infection and wanes over time), but the number of people who end up at the hospital or dead because of it will gradually decrease until we reach a sort of equilibrium.4 In some places, especially in developed countries where the vast majority of the population has already been vaccinated, this process is already well under way and you can see it on a simple chart:

This is probably also true in other regions of the world, where infections usually played a bigger role than vaccination, and eventually it will be true everywhere, including in places such as Australia and New Zealand that have mostly been able to keep the virus out so far but won’t be able to do it forever as the virus becomes endemic in the rest of the world. Obviously, it’s preferable to build up immunity through vaccination rather than infections, but eventually everyone will get to the same point. The virus will become endemic and virtually everyone will have some immunity against it, at which point it will be relatively harmless and no longer cause the kind of damage we have seen during the pandemic. The whole process will take a few years, but again it’s already well under way in some places and this is where everyone is headed, dreams of eradication notwithstanding.

In order to understand how this transition takes place and why the virus will be mostly harmless once it has become endemic and the population is no longer immunologically naive to it, I think it’s useful to work through a simple numerical example, which doesn’t purport to be a quantitatively accurate description of what is going to happen but can illustrate the process qualitatively and help people to grasp the underlying logic. Let’s consider a population of 10 million with 3 million people between 0 and 18 years old, 4 million people between 19 and 59 people and 3 million people 60 and over. Suppose that in that population a virus kills 0.05% of the people between 0 and 18 years old it infects, 0.2% of the people between 19 and 59 and 1% of the people 60 and over. Let’s also assume that, during the first year after it’s introduced in the population (which is initially immunologically naive to it), 25% of the population is infected and this doesn’t vary by age. In that case, we expect that during that year it will kill 25% * 3,000,000 * 0.05% = 375 people between 0 and 18 years old, 25% * 4,000,000 * 0.2% = 2,000 people between 19 and 59 years old and 25% * 3,000,000 * 1% = 7,500 people 60 and over died, for a total death toll of 9,875. That is a pretty sizable mortality, comparable to what many countries have seen during the first year of the COVID-19 pandemic, which given the assumptions I made should not come as a surprise to anyone.

Now let’s consider the same virus but in another population of 10 million or in the same population at a subsequent date where, because of vaccination and infections, the prevalence of immunity is only 25% among people between 0 and 18 years old, but 100% in the rest of the population.5 Let’s further assume that immunity is 80% effective against death and that effectiveness doesn’t vary with age, but that it’s not as effective against infection. Still, it offers some protection against infection, so the virus doesn’t spread as much as in a population where there is no immunity whatsoever. Let’s be more specific and assume that, over the course of a year, 15% of people between 0 and 18 years old, 10% of people between 19 and 59 years old and 5% of people 60 and over get infected.6 Finally, let’s assume that 75% of the children who get infected had no prior immunity, while 100% of the adults who get infected had some immunity since we have assumed that except for children everyone had immunity. In that case, we expect that 15% * 3,000,000 * (75% * 0.05% + 25% * (1 – 80%) * 0.05%) = 180 people between 0 and 18 years old, 10% * 4,000,000 * (1 – 80%) * 0.2% = 160 people between 19 and 59 years old and 5% * 3,000,000 * (1 – 80%) * 1% = 300 people 60 and over died, for a total death toll of 640. That’s only ~6.5% of the death toll in the immunologically naive population, yet by assumption the virus is exactly the same as before, but the population is no longer immunologically naive and this changes everything. For various reasons I won’t get into here, reality is far more complicated than this simplistic model, but it’s good enough to grasp the basic logic that governs the transition toward endemicity and get a pretty accurate idea of what is going to happen.7

Sooner or later, as a result of both infections and vaccination, virtually everyone will develop some immunity against SARS-CoV-2. This immunity will not always prevent infection, but even if someone who has been vaccinated or previously infected gets reinfected, they will typically develop only a mild form of the disease, because while still not perfect the protection against severe illness that immunity confers is better and doesn’t wane as quickly as protection against infection. Even the protection against severe illness will likely wane after a while, but this won’t really be a problem because, since immunity is much less effective against infection and new people are going to get born who are completely susceptible because they have never been infected yet and won’t be vaccinated, the virus will continue to circulate so most people will be reinfected every few years. Most people see that as a bug, but in a way, it may actually be a feature. Indeed, those reinfections will typically be mild because immunity protects well against severe illness, but they will update immunity and therefore ensure that, the next time someone is infected, this reinfection is also mild. As long as the virus is not eradicated, which as we have seen is not going to happen, we don’t want it to circulate too much, but we also don’t want it to circulate too little. Otherwise, too much time may elapse between two infections in the same person, in which case even the protection against severe illness conferred by immunity may have waned by the time they get reinfected.

Eventually most people will have a primary infection when they’re children, which is perfectly harmless and, together with subsequent infections, will protect them against severe illness later, when infection would be more dangerous if they didn’t have any immunity. Since once people have immunity, infections are generally mild, most people likely won’t even bother getting vaccinated because the probability of becoming seriously ill due to SARS-CoV-2 will be very small since 1) the risk of getting infected in the first place will be low because immunity still offers some protection against infection and the virus will circulate much less after it has become endemic and 2) even if they are infected they will typically be well protected against severe illness. Elderly people will be the exception because their immune system is compromised, so for them it will make sense to get a vaccine booster on a regular basis and I expect that it’s what most of them will do, as they already do against the flu. Once it has become endemic, which again will take a few years or even decades for the transition to be fully over, SARS-CoV-2 will become just another respiratory virus and will never cause the damages it has just wrought on us again. At last, it will have become “just like the flu”, except that it probably won’t be as bad as the flu if only because immunity will be more effective and longer-lasting.8 This may have already happened in the past with a coronavirus after the 1889-1891 “Russian flu” pandemic, which some now believe to have actually been caused by the emergence of HCoV-OC43, another human coronavirus that is now endemic and causes the common cold. It’s likely that SARS-CoV-2 will follow a similar path and end up being similarly harmless.

How I learned not to worry about variants and why you shouldn’t either

I have argued that, although SARS-CoV-2 is not going anywhere and that it wouldn’t be eradicated, things are looking up and that as the virus becomes endemic it would become mostly harmless. However, I know that presented with the optimistic picture I painted of what lays ahead of us, many people will react in disbelief because they think that emerging variants of the virus will get in the way of this quasi-idyllic scenario. Instead of seeing the wave of infections associated with the Delta variant as the last jolts of a pandemic on the way out as the transition toward endemicity takes place, they see it as a sign that, because new variants will keep emerging, we are going to be trapped in a never-ending cycle of waves of infections, each of them leaving scores of dead behind. Given that since the end of 2020 and the emergence of the Alpha variant in England, a wave of variantophobia has taken over the world, I can’t blame you if you worry that something like that might be true, but if that’s the case then I think you will feel much better after reading this section because the case against this variantophobia is very strong and we have every reason to believe that variants won’t prevent the scenario I described above from unfolding. First, before I say anything else, just taking another look at the chart about what just happened in England above should already assuage your worries somewhat, but there is more so please just bear with me for a little longer and I promise that you won’t regret it.

Variants are neither a new phenomenon nor something peculiar to SARS-CoV-2. Viruses constantly mutate and, as a result, variants of SARS-CoV-2 started to emerge long before the public became aware of that phenomenon a few months ago. While I do not doubt that mutations can result in different properties, as I have already explained previously, the picture is more complicated than what epidemiologists claim, especially when it comes to their claims about the advantage of transmissibility that, according to them, some variants enjoy. But the real concern people have about variants in the long-run is that they might evade pre-existing immunity, in which case we’d pretty much be back to square one. Indeed, the optimistic prediction I made about what is going to happen as the virus becomes endemic depends on the fact that, once everyone has acquired immunity against the virus, it will no longer kill a large number of people because immunity will ensure that it circulates less so fewer people will be infected and that even when someone is infected the infection will usually be mild. Obviously, if new variants emerge that can evade this immunity, this is not going to work and the pandemic will not end. But this is not going to happen and people who say otherwise are just talking nonsense.

In order to understand why, you must know a few things about how immunity works. Most people think of immunity as a black-or-white kind of thing: you either have it and you’re completely protected against both infection and severe illness or you don’t have it and you’re not protected against either. However, that is not how it works, the reality is more complicated. Immunity has several layers and comes in degrees. I have already noted that immunity against SARS-CoV-2 offered better protection against severe illness than against infection, but it’s even more complicated than that. For one thing, even if you have never been infected by SARS-CoV-2 and have not been vaccinated, it’s not true that you have no immunity against it. You have some immunity against it because your innate immune system is capable of fighting off even pathogens that you have never encountered. If this were not true, everyone who is exposed to SARS-CoV-2 would have died, but almost everyone survives and the overwhelming majority of people only have mild symptoms or no symptoms at all. It’s just that sometimes this innate immunity is not enough to clear the infection on its own before things get ugly, so it needs the adaptive immune system, which is responsible for mounting a more specific immune response to pathogens.

Unlike the innate immune system, which offers generic protection against pathogens, the adaptive immune system offers tailor-made protection against specific pathogens that it previously encountered. It relies mainly on two types of cells, B-cells and T-cells, that each play a different role, but in both cases they work by recognizing parts of proteins called epitopes expressed by the pathogen, which in the case of SARS-CoV-2 is a virus. B-cells have receptors that directly bind epitopes on the surface of the virus, then proliferate and create antibodies that can also bind those epitopes, which prevents the virus from infecting cells and helps other types of cells in the immune system to remove them. In the case of T-cells, on the other hand, recognition is a bit more indirect. Viral proteins are first broken up into short chains of amino acids called peptides inside cells that are called antigen-presenting cells (APCs).9 Those peptides are then bound to molecules known as the major histocompatibility complex (MHC) and the resulting MHC-peptides complexes are transported to the surface of the APCs where they are presented for recognition by T-cells.10 T-cells have receptors that bind different types of MHC-peptide complexes and, if they recognize one of them, they get activated and start going to work against the virus. This contributes to the immune response in various ways, but in particular sets in motion the process that will result in the destruction of the cells that have been infected by the virus.11 Here is a chart adapted from this paper that summarizes B-cell and T-cell epitope recognition:A key fact about both T-cells and B-cells is that, when they are activated, they don’t just set in motion a process that will help clear the infection currently ongoing, but also a process that will allow them to do that more quickly the next time they encounter the virus.

You’re probably wondering why I’m telling you about all that, but don’t worry, you’re about to find out. In the case of SARS-CoV-2, antibodies seem to be crucial to protect against infection, which makes sense because if there are still many antibodies that can neutralize the virus around when someone is exposed to the virus again, it won’t even have the opportunity to infect cells and replicate. However, several studies have found that the number of antibodies against SARS-CoV-2 wanes relatively quickly after vaccination or a natural infection, so often immunity can’t prevent infection. But as we have just seen, the immune response is not limited to antibodies, let alone to the antibodies against SARS-CoV-2 that are still around by the time someone is exposed to the virus again. Upon a second exposure with the virus, T-cells whose receptors bind peptides from SARS-CoV-2 will go to work again, but this time they’ll be able to do it more quickly. This will ensure that, even if infection couldn’t be prevented, it will be cleared before things take a turn for the worst. Thus, T-cells play a key role in preventing severe illness and, unlike antibodies, neither B-cells nor T-cells specific to SARS-CoV-2 seem to wane quickly. In fact, according to various studies (including one which found that T-cells specific to SARS-CoV-1 were still present in the blood of people who had been infected 17 years ago), they likely stick around for years. So even though protection against infection seems relatively short, immunity likely confers protection against severe illness for a long time. But won’t new variants find a way to evade this pre-existing immunity and make even the protection against severe illness it confers ineffective? No, they almost certainly won’t, and T-cells are the reason why.

Indeed, T-cells mount a particularly robust immune response because they target a much greater number of epitopes than antibodies, so even the virus mutates to prevent antibodies resulting from a previous infection to bind it, this is unlikely to work against T-cells because the entire viral proteome of the virus, i. e. the complete set of proteins expressed by the virus, would have to be different. But SARS-CoV-2 mutates pretty slowly, so although new variants regularly emerge and will continue to do so in the future, most peptides from the virus will remain the same and therefore T-cells will still be able to recognize them. Indeed, the peptides that are bound to MHC molecules and presented on the surface of antigen-presenting cells are very short chains of between 8 and 25 amino acids (depending on the class of MHC to which they are bound), so they are unlikely to change even as the virus mutates. Since it mutates slowly, it’s kind of as if the virus were trying to win the lottery by just buying a handful of tickets, each of them with a very low probability of winning the jackpot. If it bought 500 of them, the probability that one of them is a winning ticket may be reasonably high, but since it only buys 8 to 25 of them in each case it’s very low. Moreover, even if one amino acid changes, this is usually not enough to prevent T-cell receptors from binding, so in this case having a winning ticket does not even guarantee that the virus will actually pocket any money. Of course, it will sometimes happen, but T-cells target hundreds of epitopes from SARS-CoV-2, so it won’t really make a difference to the overall immune response they mount against the virus. T-cells just take the recommendation that you shouldn’t put all your eggs in the same basket very seriously.

This looks fine in theory, but reality has a way of frustrating our theoretical expectations, so does it also work in practice? Yes, it does, it works exactly as theory predicts. A recent study examined the impact of SARS-CoV-2 variants on T-cell reactivity and found that, depending on the type of receptor, between 93% and 97% of the hundreds of previously identified T-cell epitopes were not affected by mutations in the variants of concern. Now, all epitopes do not contribute equally to the immune response mounted by T-cells, so in theory it could be that while only a handful of them were affected by mutations in variants of concern, they happened to be epitopes that were disproportionately involved in the T-cell response. But the authors checked and found that fully conserved epitopes accounted for on average 91.5% of the response, so this isn’t the case. Again, keep in mind that even for the handful of epitopes that were affected by mutations, it doesn’t mean that receptors from a previous infection are no longer capable of recognizing them. In any case, the study also found there was no statistically difference in reactivity of T-cells from people who had acquired immunity against the virus, whether it was through vaccination or a natural infection. It doesn’t mean that, had the sample been larger, a statistically significant difference wouldn’t have been found, but it means that at worse the loss of reactivity was small and possibly non-existent, which again is exactly what we’d expect based on the theoretical considerations. It may be that, although T-cells target hundreds of epitopes and SARS-CoV-2 is mutating slowly, after a long enough period of time it will have mutated enough that T-cells won’t be able to mount a strong enough immune response to protect against severe illness. But remember that SARS-CoV-2 is going to continue to circulate and that people will likely get reinfected every few years, so their immunity will be updated when they are, ensuring that any subsequent infections will also be mild.

But there is another reason almost nobody is talking about why it’s unlikely that we’ll see substantial immune evasion with T-cells. As I explained above, T-cells don’t recognize epitopes directly on the surface of the virus, but rather bind complexes formed by MHC molecules and peptides on the surface of antigen-presenting cells. Now, different MHC molecules can bind different peptides, which are then presented for recognition to T-cell receptors. As it happens, the region of the human genome that is responsible for the production of MHC molecules is the most polymorphic in the entire human genome, which means that even in the same population different individuals usually have different MHC molecules that can bind different epitopes from the virus before presenting them to T-cell receptors on the surface of antigen-presenting cells. This fact has been confirmed in the case of SARS-CoV-2 by another study that identified potential T-cell epitopes from the virus and used computational methods to predict their binding affinity with the MHC molecules produced by the different variants of the genes that code for them in human populations. The authors found there was significant variation in the epitopes derived from SARS-CoV-2 involved in T-cell response both across individual within the same population and between populations, although this variation wasn’t predicted to affect the overall level of response across individuals or populations.12 This is very important because it means that, even if the virus acquired mutations that allowed it to evade T-cell immunity in one individual or population, it typically wouldn’t help it evade T-cell immunity in another individual or population, which makes T-cell immune evasion even more unlikely.

The bottom line is that, if you’re the virus, T-cells are your worst nightmare. Getting ahead of antibodies is pretty easy and some variants of concern already do it to some extent, but T-cells are a completely different story and will be a much tougher nut to crack for the virus. As we have seen, we have very good theoretical and empirical reasons to expect that, in the war between the virus and T-cell immunity, not only is the latter going to win but it won’t even break a sweat doing it. It’s important to understand that, in that respect, SARS-CoV-2 is no different than other viruses and other viruses also have a hard time dealing with T-cell immunity. Indeed, as the authors of the study that examined the impact of SARS-CoV-2 variants on T-cell reactivity note, immune evasion at the level of T-cell response has never been reported for acute respiratory infections. People worry about variants because they hear that antibody response is not as effective against them, so they imagine that eventually another variant will emerge against which immunity will be completely ineffective, but that’s because they don’t know that antibodies are just one part of the immune response against SARS-CoV-2. Immunity has another layer depending on T-cells and, not only has this layer remained unaffected by mutations of the virus so far, but as we have just seen we have very good reasons to think it will continue to be true in the future.

As I noted above, it’s likely that SARS-CoV-2 will follow a trajectory similar to that of the other human coronaviruses (which are already endemic), so it’s particularly interesting to know that what I’m predicting for SARS-CoV-2 is exactly what is already happening with those human coronaviruses. A recent study examined the recent evolution of HCoV-229E, one of the four human coronaviruses that are already endemic, and found that its spike, the protein that allows the virus to enter cells and infect them, had undergone several mutations between 1984 and 2020. They used sera collected on recovering patients at various points during that period to test how well the antibodies they contain were able to bind reconstructed spikes of the virus from 1984, 1992, 2001, 2008 and 2016. What they found is that antibodies in sera collected at one date were able to find effectively the spikes that were found on HCoV-229E before that date, but not or not very effectively the spikes that were found on the virus after that date, which shows that HCoV-229E had mutated to evade antibody binding, which is already what we’re seeing in SARS-CoV-2. But HCoV-229E remained mostly harmless during that period, which is presumably because while people’s antibody response against it became less efficient due to mutations in the spike, T-cell immunity remained largely unaffected. This is exactly what we’re seeing with SARS-CoV-2 so far and we have every reason to believe that it will continue to be true in the future. The only difference is that, in the case of HCoV-229E, nobody bothers naming the variants and people aren’t freaking out because they think immunity will stop working against them. Again, SARS-CoV-2 is just another respiratory virus, what made it so devastating is that it was novel.

SARS-CoV-2 is not going anywhere

Some people insist that we can’t “live with the virus” and that we must therefore pursue a policy of eradication. They often draw a parallel with smallpox and say that we should do the same thing with SARS-CoV-2 that we did with that virus, which after plaguing mankind for thousands of years was finally eradicated in 1980. This parallel is extremely misleading though, because smallpox differs from SARS-CoV-2 in very important ways, which made eradication possible though difficult in the case of the former but make it very unlikely in the case of the latter. Before I get into that, it’s worth noting that to date only two infectious diseases have ever been successfully eradicated (smallpox in humans and rinderpest in cattle), which speaks to how difficult this sort of enterprise is. This is not for lack of trying, as several other infectious diseases have been targeted for eradication, but those efforts have not succeeded yet. Polio seems on the verge of eradication and probably will be eradicated soon, but isn’t yet. Even in the case of smallpox, eradication took decades. You might take this to suggest that, while SARS-CoV-2 will not be eradicated overnight, we might pull it off eventually if we really commit to it. But I don’t think it’s going to happen because again SARS-CoV-2 is very different from the viruses that cause smallpox or polio.

First, while I think there is no doubt that vaccines against SARS-CoV-2 protect against infections and not just severe disease (as we have seen above), I think it’s equally clear that the protection it offers against infection is far from perfect and that people can get infected even if they have been vaccinated. There is also growing evidence that, while it does not disappear almost immediately as some people had initially suggested based on weak evidence, the protection against infection conferred by vaccination is waning relatively quickly. As this study showed, the same thing is true for the immunity against endemic human coronaviruses induced by natural infection, so this is not particularly surprising. According to the COVID-19 Infection Survey, based on a random sample of the population in the United Kingdom, more than 90% of people had antibodies against SARS-CoV-2 in June, but it didn’t prevent a gigantic third or fourth wave (depending on how you’re counting) from ripping through the country in July. The same thing just happened in Iceland, where more than 90% of the population over 16 has received at least one dose of vaccine. As we have seen, this is not really a problem because thanks to vaccination and naturally acquired immunity mortality remained low, but it suggests that even mass vaccination within a short period of time cannot stop the virus from circulating. The vaccine against smallpox, on the other hand, probably confers lifelong protection against infection and the same thing seems to be true about naturally acquired immunity. Basically, in order to get rid of smallpox, we “just” needed to vaccinate everyone in their childhood and that was it. The same thing is true with polio.

So this means that, in order to eradicate SARS-CoV-2, we’d have to vaccinate the entire population every year for several years in a row and even that would probably not be enough.13 That’s a much larger effort than what we had to do to get rid of smallpox, yet even that comparatively simple endeavor took decades. Who can seriously believe that we’ll be able to sustain that effort for the years or even decades that it would take to eradicate the virus, when we aren’t even able to do it in the middle of a pandemic that just killed millions of people? This is a pipe dream, it will never happen. Indeed, convincing or coercing people to get vaccinated is going to become even harder, because as I have explained the virus will be mostly harmless once it has become endemic. If you think it’s hard to convince people to get vaccinated or politically difficult to coerce them to do so while people are dropping dead by the thousands, which it most certainly is, wait until the mortality caused by SARS-CoV-2 is divided by a factor of 20 or something. It’s pointless and wasteful to pursue a policy that has no realistic chance of succeeding, but that’s exactly what people who are calling to eradicate SARS-CoV-2 are doing. Not that it will make any difference, to be clear, because the same reasons that make this project a fantasy will ensure that calls to carry it out will remain unanswered.

Again the comparison with smallpox or even polio is extremely misleading here. Smallpox is one of the most lethal pathogens in history and has probably killed hundreds of millions of people in the last 100 years of its existence alone. It’s painfully obvious that the incentives are completely different in the case of SARS-CoV-2. Even with polio, whose infection fatality rate is similar to SARS-CoV-2, the incentives are very different because it mostly kills or maims children. Does anyone really expect that people are going to be as motivated to eradicate a virus that mostly kills elderly people as they are to get rid of a virus that kills or paralyzes children? Moreover, as I already noted, in the case of polio, you just have to administer a few shots to people when they’re very young children and you’re done with it. The comparison of SARS-CoV-2 with other pathogens can be illuminating in some cases, but comparing it to smallpox or even polio to suggest that we could eradicate it and that it’s a realistic possibility is extremely misleading. Even if we granted for the sake of the argument that it could be done if we committed enough resources to the effort, it’s totally unrealistic to expect that we ever will, because the incentives aren’t right.14

There are other differences between SARS-CoV-2 and smallpox or even polio that make it far more difficult to eradicate the former. In particular, smallpox and polio only infect humans, but SARS-CoV-2 can also infect animals and frequently does. While the evidence of animal-to-human transmission is so far very limited, I think it’s mostly because the studies that have found evidence that animals could be infected by SARS-CoV-2 were not designed to answer that question. If the virus becomes endemic in some animal populations that are frequently in contact with humans, then even if we somehow managed to temporarily eradicate it from human populations, animals would just reintroduce it and we’d be back to square one. At least one animal reservoir has already been found in the white-tailed deer population in the US, so this isn’t a purely theoretical worry. What this means is that, in order to permanently eradicate SARS-CoV-2 from human populations, we’d probably have to vaccinate wild animals. This can be done and has been done in some countries such as France, where a program to vaccinate some wild animals against rabies was undertaken, but it just makes eradication even more difficult and costly, which in turn makes it even more unlikely that we’ll even try, let alone succeed.

Conclusion

The pandemic is on its way out, but SARS-CoV-2 is here to stay. Fortunately, as everyone develops immunity to it (whether through vaccination or natural infection), it will soon no longer be a major problem anymore. The virus will continue to circulate, but much less than during the pandemic and, even when people are infected, the infection will typically be mild. In the future, almost everyone will get infected for the first time during their childhood, which is harmless and will protect them against severe illness when they are reinfected.15 The virus will continue to mutate and some of those mutations will favor immune evasion, but while this will allow it to infect people who have already been infected or vaccinated more easily, immunity should continue to protect against severe forms of the disease, thanks in particular to the role played by T-cells. This is likely what happened with other human coronaviruses, which are already endemic and typically cause a cold in the people they infect. To the extent that immune evasion occurs, it will be very gradual and the fact that most people will be infected every few years will update their immunity, ensuring that subsequent reinfections will also be mild. The most vulnerable people, whose immune system doesn’t work very well and could use some help to be ready in case of infection, can get a vaccine booster from time to time. The virus will still kill people, as the flu does, but it will never cause the same amount of disruption again. The hardest part of what lays ahead may be to convince people who have been traumatized by the pandemic that it’s over and that restrictions are no longer necessary.

P. S. I realize that, while it doesn’t exactly say that, this post makes it sound as though the only reason why protection against infection appears to have been waning is that new variants with mutations in the spike that allow them to prevent antibodies from binding have emerged, so to be clear that’s not what I’m saying. I was focusing on immune evasion, because that’s what people seem most worried about, but another reason why protection against infection is probably waning is that antibody levels progressively fall after infection. Moreover, as someone pointed out to me, so does the number of T-cells specialized against SARS-CoV-2 and I’m sure the same thing is true with B-cells, so as time goes by it also takes longer for the adaptive immune system to mount a response upon exposure to the virus. I also didn’t mean to suggest that mutations in the spike make antibodies completely inefficient. The point I wanted to make is just that, even if a variant is able to evade humoral immunity to a large extent, T-cell immunity should still work just fine against it and eventually the immune system should be able to mount a very effective response to infection, even if the fact that T-cell levels also wane means that it will take longer as the time since the last infection increases.

Print Friendly, PDF & Email
  • 1As some studies suggest, there was probably some cross-immunity due to prior exposure to seasonal human coronaviruses, so this claim is not exactly true, but clearly this immunity was very limited.
  • 2Biologists make a distinction between the innate immune system and the adaptive immune system. The former offers generic protection against pathogens that invade the body and can effectively deal with most of them, while the latter offers protection against specific pathogens that have been previously encountered. As I noted above, there was probably some adaptive immunity against SARS-CoV-2 in the population due to the similarity of parts of the proteins expressed by the virus with those of endemic human coronaviruses, but again it was very limited.
  • 3Another reason is that natural selection had probably favored alleles that protect against those pathogens in Europeans precisely because they had lived with them for so long, whereas this was not the case in America where indigenous populations had separated from other human populations before the emergence of those diseases, which probably occurred during and after the neolithic when animals were first domesticated.
  • 4The notion of endemic equilibrium has a precise mathematical definition in epidemiological models, but while those models may be useful to describe some aspects of this process in a stylized manner, I think they bear little connection to reality and use the term in a more informal sense.
  • 5This is the kind of situation you would expect in a population where the virus has become endemic, almost everyone is infected for the first time during their childhood, immunity wanes over time but people get reinfected or vaccinated every few years.
  • 6This is the kind of situation you would expect if old people got vaccinated regularly because they know they are vulnerable. You would expect the virus to circulate more among children since, by assumption, more of them are susceptible to infection.
  • 7If you want to see a more realistic attempt at modeling the transition to endemicity, which tries to predict how long it will take depending on factors such as how fast the protection against infection conferred by immunity wanes and the basic reproduction number of the virus, I encourage you to read Lavine et al. (2021). I wouldn’t take very seriously their quantitative estimates, because the model still ignores many complications and the specific results are sensitive to various semi-arbitrary assumptions they make, but there is every reason to think their qualitative conclusions, which are consistent with the prediction I make below about what is going to happen once SARS-CoV-2 has become endemic, are correct because they just rest on the basic logic I have just explained.
  • 8Indeed, influenza mutates faster than SARS-CoV-2 due to the absence of a similar proofreading mechanism during replication and because it has a segmented genome that makes recombination between various strains easier, which makes it harder for immunity to clear infection and explains why vaccines against the flu quickly become obsolete.
  • 9The terminology can be a bit confusing, so it may be useful to clarify it. Epitopes are the parts of viral proteins that are recognized by the adaptive immune system, whether they are still part of the protein when this recognition takes place or have been broken up and are no longer part of it. In the case of B-cells, they are recognized directly on the protein that is still intact on the surface of the virus, but in the case of T-cells this recognition takes place after the viral proteins have been broken up into peptides. So peptides can be epitopes when they are presented on the surface of APCs for recognition by T-cells, but epitopes need not be peptides and peptides need not be epitopes.
  • 10There are different classes of MHC molecules that are found on different kinds of APCs and are recognized by different types of T-cells, but this is not important for what I’m trying to explain.
  • 11B-cells are APCs and therefore present MHC-peptide complexes to T-cells, which in turn stimulate the proliferation of B-cells specific to the relevant peptides and the production of antibodies that can bind them directly on the surface of the virus, so T-cells and B-cells are not entirely distinct parts of the immune system but interact in complex ways to produce the immune response.
  • 12This result still held when they looked at potential T-cell peptides derived from individual proteins expressed by the virus rather than the entire viral proteome, so even if peptides derived from specific proteins are more important to the T-cell response than others, this response will still rely on different epitopes in different individuals and different populations. In particular, this is true for epitopes derived from the spike protein, which is the one used by the currently available vaccines to induce immunity.
  • 13Perhaps this will change as new, more effective vaccines are developed, but I wouldn’t hold my breath, especially since as I have argued SARS-CoV-2 is going to become far less dangerous, so pharmaceutical companies will have less incentives to invest money into research and development for better vaccines against it.
  • 14You may think that, although eradicating SARS-CoV-2 would be extremely costly and difficult, it would still be cost-effective given the expected death toll of COVID-19 in the long-run and you may even be right despite the fact that it’s going to become far less dangerous once it’s endemic. But this wouldn’t change the fact that it’s almost certainly not going to happen because, as we have seen during the pandemic, decision-makers are hardly utility maximizers. Thus, when I claim that eradication of SARS-CoV-2 is not desirable, I’m not committing myself to the view that, even if people were perfectly rational, such a policy wouldn’t pass a cost-benefit test (although I think it probably wouldn’t), but only to the weaker claim that it wouldn’t in the actual world because the lack of incentives to pursue this policy lowers the probability of success and increases the cost.
  • 15At the moment, many people want to vaccinate their kids, but I doubt it will still be the case in a few years when the panic induced by the pandemic has subsided and people have realized that SARS-CoV-2 is harmless to children.

Simple blood test can tell whether patients will suffer from ‘long COVID’

Authors: by Study Finds AUGUST 15, 2021

CAMBRIDGE, England — A simple blood test for long COVID is on the horizon. Biological “fingerprints” can identify individuals with the debilitating syndrome, according to new research. This opens the door to the first accurate diagnosis of the mysterious condition. Sufferers complain it is hard to convince doctors of their disease.

Long COVID is an umbrella term for symptoms of the virus lasting more than 12 weeks. They range from fatigue, headaches, and breathlessness to fever and tummy pain. At least one fourth of patients have developed some form of long COVID, per research out of the University of California, Davis.

“We need a reliable and objective way of saying whether someone has had COVID-19,” says study co-leader Dr. Mark Wills of the University of Cambridge. “Antibodies are one sign we look for. But not everyone makes a very strong response and this can wane over time and become undetectable.”

The new technique is based on chemicals called cytokines that control blood cells. When released, the tiny proteins trigger the immune system’s T-cells to fight foreign invaders.

“We’ve identified a cytokine that is also produced in response to infection by T-cells and is likely to be detectable for several months — and potentially years — following infection,” adds Wills. “We believe this will help us develop a much more reliable diagnostic for those individuals who did not get a diagnosis at the time of infection.”

The discovery could revolutionize treatment by complementing existing antibody tests and identifying vulnerable individuals. It builds on a pilot study of 85 patients from the Long COVID Clinic at Addenbrooke’s Hospital in Cambridge. Blood samples were collected at the time of diagnosis and follow-up intervals over several months. Analyses identified a molecule known as a cytokine produced by T-cells in response to infection.

For More Information: https://www.studyfinds.org/long-covid-blood-test/

Adaptive immunity to SARS-CoV-2 and COVID-19

Authors: Alessandro Sette1,2 and Shane Crotty1,2,* 1Center for Infectious Disease and Vaccine Research, La Jolla Institute for Immunology (LJI), La Jolla, CA 92037, USA
2Department of Medicine, Division of Infectious Diseases and Global Public Health, University of California, San Diego (UCSD), La Jolla, CA
92037, USA

SUMMARY
The adaptive immune system is important for control of most viral infections. The three fundamental components of the adaptive immune system are B cells (the source of antibodies), CD4+ T cells, and CD8+ T cells. The armamentarium of B cells, CD4+ T cells, and CD8+ T cells has differing roles in different viral infections and in vaccines, and thus it is critical to directly study adaptive immunity to SARS-CoV-2 to understand COVID-19. Knowledge is now available on relationships between antigen-specific immune responses and SARS-CoV-2 infection. Although more studies are needed, a picture has begun to emerge that reveals that CD4+ T cells, CD8+ T cells, and neutralizing antibodies all contribute to control of SARS-CoV-2 in both
non-hospitalized and hospitalized cases of COVID-19. The specific functions and kinetics of these adaptive immune responses are discussed, as well as their interplay with innate immunity and implications for COVID19 vaccines and immune memory against re-infection.


INTRODUCTION


Coronavirus disease 2019 (COVID-19), caused by the novel human pathogen severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (Hu et al., 2020), is a serious disease that has resulted in widespread global morbidity and mortality.


Our understanding of SARS-CoV-2 and COVID-19 has rapidly evolved during 2020. As of December 2020, the United States has experienced >300,000 deaths, winter cases are rising exceptionally fast, and the first interim phase 3 vaccine trial results have been reported. The scientific advances in understanding SARS-CoV-2 and COVID-19 have been extraordinarily rapid and broad, by any metric, which is an amazing testament to the commitment, creativity, collaboration, and expertise of the international scientific community, both in academia and industry, under extremely challenging conditions. This article will review our current understanding of the immunology of COVID-19, with a primary focus on adaptive immunity.


The immune system is broadly divided into the innate immune system and the adaptive immune system. Although the adaptive and innate immune systems are linked in important and powerful ways, they each consist of different cell types with different jobs.


The adaptive immune system consists of three major cell types: B cells, CD4+ T cells, and CD8+ T cells (Figure 1). B cells produce antibodies. CD4+ T cells possess a range of helper and effector functionalities. CD8+ T cells kill infected cells. Given that adaptive immune responses are important for the control and clearance of almost all viral infections that cause disease in humans, and adaptive immune responses and immune memory are central to the success of all vaccines, it is critical to understand adaptive responses to SARS-CoV-2.

ONE INTEGRATED MODEL OF IMMUNE RESPONSES TO SARS-CoV-2

This review first presents a working model of immune responses to SARS-CoV-2, to provide an overarching context, and then the review explores individual compartments and immunological facets of adaptive immunity to SARS-CoV-2 in greater detail. Importantly, this is an evolving model and should not be accepted as definitive; instead, it provides a reference point for interpreting much of the available data in the literature and to identify knowledge gaps that may provide directions for future studies.

For More Information: https://www.cell.com/cell/pdfExtended/S0092-8674(21)00007-6

Pre-existing immunity to SARS-CoV-2: the knowns and unknowns

Authors: Alessandro Sette 1 2Shane Crotty 3 4

Abstract

T cell reactivity against SARS-CoV-2 was observed in unexposed people; however, the source and clinical relevance of the reactivity remains unknown. It is speculated that this reflects T cell memory to circulating ‘common cold’ coronaviruses. It will be important to define specificities of these T cells and assess their association with COVID-19 disease severity and vaccine responses.

As data start to accumulate on the detection and characterization of SARS-CoV-2 T cell responses in humans, a surprising finding has been reported: lymphocytes from 20–50% of unexposed donors display significant reactivity to SARS-CoV-2 antigen peptide pools1,2,3,4.

In a study by Grifoni et al.1, reactivity was detected in 50% of donor blood samples obtained in the USA between 2015 and 2018, before SARS-CoV-2 appeared in the human population. T cell reactivity was highest against proteins other than the coronavirus spike protein, but T cell reactivity was also detected against spike. The SARS-CoV-2 T cell reactivity was mostly associated with CD4+ T cells, with a smaller contribution by CD8+ T cells1. Similarly, in a study of blood donors in the Netherlands, Weiskopf et al.2 detected CD4+ T cell reactivity against SARS-CoV-2 spike peptides in 1 of 10 unexposed subjects and against SARS-CoV-2 non-spike peptides in 2 of 10 unexposed subjects. CD8+ T cell reactivity was observed in 1 of 10 unexposed donors. In a third study, from Germany, Braun et al.3 reported positive T cell responses against spike peptides in 34% of SARS-CoV-2 seronegative healthy donors. Finally, a study of individuals in Singapore, by Le Bert et al.4, reported T cell responses to nucleocapsid protein nsp7 or nsp13 in 50% of subjects with no history of SARS, COVID-19, or contact with patients with SARS or COVID-19. A study by Meckiff using samples from the UK also detected reactivity in unexposed subjects5. Taken together, five studies report evidence of pre-existing T cells that recognize SARS-CoV-2 in a significant fraction of people from diverse geographical locations.

These early reports demonstrate that substantial T cell reactivity exists in many unexposed people; nevertheless, data have not yet demonstrated the source of the T cells or whether they are memory T cells. It has been speculated that the SARS-CoV-2-specific T cells in unexposed individuals might originate from memory T cells derived from exposure to ‘common cold’ coronaviruses (CCCs), such as HCoV-OC43, HCoV-HKU1, HCoV-NL63 and HCoV-229E, which widely circulate in the human population and are responsible for mild self-limiting respiratory symptoms. More than 90% of the human population is seropositive for at least three of the CCCs6. Thiel and colleagues3 reported that the T cell reactivity was highest against a pool of SARS-CoV-2 spike peptides that had homology to CCCs.

What are the implications of these observations? The potential for pre-existing crossreactivity against COVID-19 in a fraction of the human population has led to extensive speculation. Pre-existing T cell immunity to SARS-CoV-2 could be relevant because it could influence COVID-19 disease severity. It is plausible that people with a high level of pre-existing memory CD4+ T cells that recognize SARS-CoV-2 could mount a faster and stronger immune response upon exposure to SARS-CoV-2 and thereby limit disease severity. Memory T follicular helper (TFH) CD4+ T cells could potentially facilitate an increased and more rapid neutralizing antibody response against SARS-CoV-2. Memory CD4+ and CD8+ T cells might also facilitate direct antiviral immunity in the lungs and nasopharynx early after exposure, in keeping with our understanding of antiviral CD4+ T cells in lungs against the related SARS-CoV7 and our general understanding of the value of memory CD8+ T cells in protection from viral infections. Large studies in which pre-existing immunity is measured and correlated with prospective infection and disease severity could address the possible role of pre-existing T cell memory against SARS-CoV-2.

For More Information: https://www.nature.com/articles/s41577-020-0389-z

A long-term perspective on immunity to COVID

Determining the duration of protective immunity to infection by SARS-CoV-2 is crucial for understanding and predicting the course of the COVID-19 pandemic. Clinical studies now indicate that immunity will be long-lasting.

Authors: Andreas Radbruch & Hyun-Dong Chang

Generating immunity against the SARS-CoV-2 coronavirus is of the utmost importance for bringing the COVID-19 pandemic under control, protecting vulnerable individuals from severe disease and limiting viral spread. Our immune systems protect against SARS-CoV-2 either through a sophisticated reaction to infection or in response to vaccination. A key question is, how long does this immunity last? Writing in NatureTurner et al.1 and Wang et al.2 characterize human immune responses to SARS-CoV-2 infection over the course of a year.

There is ongoing discussion about which aspects of the immune response to SARS-CoV-2 provide hallmarks of immunity (in other words, correlates of immunological protection). However, there is probably a consensus that the two main pillars of an antiviral response are immune cells called cytotoxic T cells, which can selectively eliminate infected cells, and neutralizing antibodies, a type of antibody that prevents a virus from infecting cells, and that is secreted by immune cells called plasma cells. A third pillar of an effective immune response would be the generation of T helper cells, which are specific for the virus and coordinate the immune reaction. Crucially, these latter cells are required for generating immunological memory — in particular, for orchestrating the emergence of long-lived plasma cells3, which continue to secrete antiviral antibodies even when the virus has gone.

Immunological memory is not a long-lasting version of the immediate immune reaction to a particular virus; rather, it is a distinct aspect of the immune system. In the memory phase of an immune response, B and T cells that are specific for a virus are maintained in a state of dormancy, but are poised to spring into action if they encounter the virus again or a vaccine that represents it. These memory B and T cells arise from cells activated in the initial immune reaction. The cells undergo changes to their chromosomal DNA, termed epigenetic modifications, that enable them to react rapidly to subsequent signs of infection and drive responses geared to eliminating the disease-causing agent4. B cells have a dual role in immunity: they produce antibodies that can recognize viral proteins, and they can present parts of these proteins to specific T cells or develop into plasma cells that secrete antibodies in large quantities. About 25 years ago5, it became evident that plasma cells can become memory cells themselves, and can secrete antibodies for long-lasting protection. Memory plasma cells can be maintained for decades, if not a lifetime, in the bone marrow6.

The presence in the bone marrow of long-lived, antibody-secreting memory plasma cells is probably the best available predictor of long-lasting immunity. For SARS-CoV-2, most studies so far have analyzed the acute phase of the immune response, which spans a few months after infection, and have monitored T cells, B cells and secreted antibodies7. It has remained unclear whether the response generates long-lived memory plasma cells that secrete antibodies against SARS-CoV-2.

For More Information: https://www.nature.com/articles/d41586-021-01557-z

Use of adenovirus type-5 vectored vaccines: a cautionary tale

Authors: The Lancet

We are writing to express concern about the use of a recombinant adenovirus type-5 (Ad5) vector for a COVID-19 phase 1 vaccine study,1 and subsequent advanced trials. Over a decade ago, we completed the Step and Phambili phase 2b studies that evaluated an Ad5 vectored HIV-1 vaccine administered in three immunizations for efficacy against HIV-1 acquisition.23 Both international studies found an increased risk of HIV-1 acquisition among vaccinated men.24 The Step trial found that men who were Ad5 seropositive and uncircumcised on entry into the trial were at elevated risk of HIV-1 acquisition during the first 18 months of follow-up.5 The hazard ratios were particularly high among men who were uncircumcised and Ad5 seropositive, and who reported unprotected insertive anal sex with a partner who was HIV-1 seropositive or had unknown serostatus at baseline, suggesting the potential for increased risk of penile acquisition of HIV-1. Importantly for considering the potential use of Ad5 vectors for COVID-19 infection, a similar increased risk of HIV infection was also observed in heterosexual men who enrolled in the Phambili study.4 This effect appeared to persist over time. Both studies involved an Ad5 construct that did not have the HIV-1 envelope. In another HIV study, done only in men who were Ad5 seronegative and circumcised, a DNA prime followed by an Ad5 vector were used, in which both constructs contained the HIV-1 envelope.6 No increased risk of HIV infection was noted. A consensus conference about Ad5 vectors held in 2013 and sponsored by the National Institutes of Health indicated the most probable explanation for these differences related to the potential counterbalancing effects of envelope immune responses in mitigating the effects of the Ad5 vector on HIV-1 acquisition.7 The conclusion of this consensus conference warned that non-HIV vaccine trials that used similar vectors in areas of high HIV prevalence could lead to an increased risk of HIV-1 acquisition in the vaccinated population. The increased risk of HIV-1 acquisition appeared to be limited to men; a similar increase in risk was not seen in women in the Phambili trial.4Several follow-up studies suggested the potential mechanism for this increased susceptibility to HIV infection among men. The vaccine was highly immunogenic in the induction of HIV-specific CD4 and CD8 T cells; however, there was no difference in the frequency of T-cell responses after vaccination in men who did and did not later become infected with HIV in the Step Study.8 These findings suggest that immune responses induced by the HIV-specific vaccine were not the mechanism of increased acquisition. Participants with high frequencies of preimmunisation Ad5-specific T cells were associated with a decreased magnitude of HIV-specific CD4 responses and recipients of the vaccine had a decreased breadth of HIV-specific CD8 responses,9 suggesting that pre-existing Ad5 immunity might dampen desired vaccine-induced responses. 

For More Information: https://www.thelancet.com/journals/lancet/home

COVID-19 survivors may possess wide-ranging resistance to the disease

Authors: Rajee Suri rajee.suri@emory.edu

Recovered COVID-19 patients retain broad and effective longer-term immunity to the disease, suggests a recent Emory University study, which is the most comprehensive of its kind so far. The findings have implications for expanding understanding about human immune memory as well as future vaccine development for coronaviruses.

The longitudinal study, published recently on Cell Reports Medicine, looked at 254 patients with mostly mild to moderate symptoms of SARS-CoV-2 infection over a period for more than eight months (250 days) and found that their immune response to the virus remained durable and strong.

Emory Vaccine Center director Rafi Ahmed, PhD, and a lead author on the paper, says the findings are reassuring, especially given early reports during the pandemic that protective neutralizing antibodies did not last in COVID-19 patients.

“The study serves as a framework to define and predict long-lived immunity to SARS-CoV-2 after natural infection. We also saw indications in this phase that natural immunity could continue to persist,” Ahmed says. The research team will continue to evaluate this cohort over the next few years.

Researchers found that not only did the immune response increase with disease severity, but also with each decade of age regardless of disease severity, suggesting that there are additional unknown factors influencing age-related differences in COVID-19 responses. 

In following the patients for months, researchers got a more nuanced view of how the immune system responds to COVID-19 infection. The picture that emerges indicates that the body’s defense shield not only produces an array of neutralizing antibodies but activates certain T and B cells to establish immune memory, offering more sustained defenses against reinfection.

“We saw that antibody responses, especially IgG antibodies, were not only durable in the vast majority of patients but decayed at a slower rate than previously estimated, which suggests that patients are generating longer-lived plasma cells that can neutralize the SARS-CoV-2 spike protein.”

For More Information: https://news.emory.edu/stories/2021/07/covid_survivors_resistance/index.html