At least 58% of U.S. population has natural antibodies from previous Covid infection, CDC says

Authors: Spencer Kimball PUBLISHED TUE, APR 26 2022 CNBC

KEY POINTS

  • Three out of every 5 people in the U.S. now have antibodies from a previous Covid-19 infection, according to a new CDC analysis.
  • The proportion is even higher among children, demonstrating how widespread the virus was during the winter omicron surge.
  • CDC officials told reporters on a call Tuesday that the study did not measure whether people with prior infections had high enough antibody levels to protect against reinfection and severe illness.
  • However, CDC Director Dr. Rochelle Walensky said health officials believe there is a lot of protection against the virus in communities from vaccination, boosting and infection taken together.

Three out of every 5 people in the U.S. now have antibodies from a previous Covid-19 infection with the proportion even higher among children, demonstrating how widespread the virus was during the winter omicron surge, according to data from the Centers for Disease Control and Prevention.

The proportion of people with natural Covid antibodies increased substantially from about 34% of the population in December to about 58% in February during the unprecedent wave of infection driven by the highly contagious omicron variant. The CDC’s analysis didn’t factor in people who had antibodies from vaccination.

The CDC published the data in its Morbidity and Mortality Weekly Report on Tuesday.

The increase in antibody prevalence was most pronounced among children, indicating a high rate of infection among kids during the winter omicron wave. About 75% of children and teenagers now have antibodies from past Covid infections, up from about 45% in December.

The high rate of infection among children is likely due to lower vaccination rates than adults. Only 28% of children 5- to 11-years-old and 59% of teens 12- to 17-years-old were fully vaccinated as of April. Children under 5-years-old are not yet eligible for vaccination.

About 33% of people ages 65 and older, the group with the highest vaccination rate, had antibodies from infection. Roughly 64% of adults ages 18 to 49 and 50% of people 50 to 64 had the antibodies.

The CDC analyzed about 74,000 blood samples every month from September through January from a national commercial lab network. The sample size decreased to about 46,000 in February. The CDC tested the samples for a specific type of antibody that is produced in response to Covid infection, not from vaccination.

CDC officials told reporters on a call Tuesday that the study did not measure whether people with prior infections had high enough antibody levels to protect against reinfection and severe illness. However, CDC Director Dr. Rochelle Walensky said health officials believe there is a lot of protection in communities across the country from vaccination, boosting and infection taken together, while cautioning that vaccination is the safest strategy to protect yourself against the virus.

“Those who have detectable antibody from prior infection, we still continue to encourage them to get vaccinated,” Walensky told reporters during the call. “We don’t know when that infection was. We don’t know whether that protection has waned. We don’t know as much about that level of protection than we do about the protection we get from both vaccines and boosters.”

Scientists in Qatar affiliated with Cornell University found that natural infection provides about 73% protection against hospitalization if a person is reinfected with BA.2. However, three doses of Pfizer’s vaccine provided much higher protection against hospitalization at 98%. The study, published in March, has not undergone peer-review.

About 66% of the U.S. population is fully vaccinated and 77% have received at least one dose, according to data from the CDC.

Infections and hospitalizations have dropped more than 90% from the peak of the omicron wave in January when infections in the U.S. soared to an average of more than 800,000 a day. New cases are rising again due to the BA.2 subvariant. Another subvariant, BA.2.12.1, is now gaining ground in the U.S., representing about 29% of new infections, according to CDC data. Walensky said the public health agency believes BA.2.12.1 spreads about 25% faster than BA.2. However, she said the CDC does not expect to see more severe disease from BA.2.12.1though studies are ongoing.

More than 98% of the U.S. population lives in areas where they do not need to wear masks indoors under CDC guidance due to low Covid community levels, which takes into account both infections and hospitalizations. A U.S. district judge last week struck down the CDC’s mask mandate for public transportation, though the Justice Department has filed an appeal. Walensky said the CDC continues to recommend that people wear masks on public transportation.

Counties With Highest Vaccination Rates See More COVID-19 Cases Than Least Vaccinated

Authors: Petr Svab April 4, 2022 Updated: April 5, 2022 THE EPOCH TIMES

U.S. counties with the highest rates of vaccination against COVID-19 are currently experiencing more cases than those with the lowest vaccination rates, according to data collected by the Centers for Disease Control and Prevention (CDC).

The 500 counties where 62 to 95 percent of the population has been vaccinated detected more than 75 cases per 100,000 residents on average in the past week. Meanwhile, the 500 counties where 11 to 40 percent of the population has been vaccinated averaged about 58 cases per 100,000 residents.

The data is skewed by the fact that the CDC suppresses figures for counties with very low numbers of detected cases (one to nine) for privacy purposes. The Epoch Times calculated the average case rates by assuming the counties with the suppressed numbers had five cases each on average.

The least vaccinated counties tended to be much smaller, averaging less than 20,000 in population. The most vaccinated counties had an average population of over 330,000. More populous counties, however, weren’t more likely to have higher case rates.

Even when comparing counties of similar population, the ones with the most vaccinations tended to have higher case rates than those that reported the least vaccinations.

Among counties with populations of 1 million or more, the 10 most vaccinated had a case rate more than 27 percent higher than the 10 least vaccinated. In counties with populations of 500,000 to 1 million, the 10 most vaccinated had a case rate almost 19 percent higher than the 10 least vaccinated.

In counties with populations of 200,000 to 500,000, the 10 most vaccinated had case rates around 55 percent higher than the 10 least vaccinated.

The difference was more than 200 percent for counties with populations of 100,000 to 200,000.

For counties with smaller populations, the comparison becomes increasingly difficult because so much of the data is suppressed.

Another problem is that the prevalence of testing for COVID-19 infections isn’t uniform. A county may have a low case number on paper because its residents are tested less often.

The massive spike in infections during the winter appears to have abated in recent weeks. Detected infections are down to less than 30,000 per day from a high of over 800,000 per day in mid-January, according to CDC data. The seven-day average of currently hospitalized dropped to about 11,000 on April 1, from nearly 150,000 in January.

The most recent wave of COVID-19 has been attributed to the Omicron virus variant, which is more transmissible but less virulent. The variant also seems more capable of overcoming any protection offered by the vaccines, though, according to the CDC, the vaccines still reduce the risk of severe disease.

Bone Marrow Suppression Secondary to the COVID-19 Booster Vaccine: A Case Report

TAuthors: oral Shastri 1Navkiran Randhawa 2Ragia Aly 3Masood Ghouse 3 PMID: 35210894PMCID: PMC8863340DOI: 10.2147/JBM.S350290 J Blood Med.  2022; 13: 69–74.Published online 2022 Feb 18. doi: 10.2147/JBM.S350290

Abstract

As of September 2021, SARS-CoV-2 booster shots became widely available in the US to ensure continued protection against the virus. A temporal relationship has been previously reported between the first or second dose of the COVID-19 vaccine and the development of thrombocytopenia. However, adverse events related to the third COVID-19 vaccine are still being reported and studied. We report a 74-year-old male who developed bone marrow suppression and pancytopenia recorded seven days after receiving the Pfizer SARS-CoV-2 vaccine. During his hospital stay, the patient’s hemoglobin, white blood cell, and platelet levels continued to trend downwards. However, all three levels showed improvement one week after discharge without robust intervention. Global vaccination is of utmost importance, as is understanding and documenting post-vaccination reactions including bone marrow suppression. Prompt evaluation and patient education are imperative to improve patient outcomes and combat hesitancy against vaccine administration.

Introduction

Since its emergence in December of 2019, the rapid spread of severe acute respiratory syndrome coronavirus (SARS-CoV-2) has quickly affected millions of lives across every continent.1 This highly transmittable and pathogenic viral infection has led to massive mitigation efforts and allocation of resources to prevent the spread of transmission and high mortality related to complications.2 The establishment of higher levels of community (herd) immunity and protection against SARS-CoV-2 via the widespread deployment of effective vaccines has become a global effort.3 In December of 2020, the FDA issued an Emergency use Authorization for the Pfizer-BioNTech and Moderna COVID-19 Vaccine as a two-dose series.4 In September 2021, booster vaccines became widely administered in the US due to waning immunity of the COVID-19 vaccines against variants of SARS-CoV-2 along with ensuring continued protection against the virus.5

Serious adverse events such as anaphylaxis, Guillain-Barre Syndrome, myocarditis, pericarditis, thrombocytopenia, and death have been previously reported following the first and/or second dose of vaccine.6 To our knowledge, no cases have been reported regarding bone marrow suppression related to the third COVID-19 vaccine. Adverse events reported between August 12-September 19, 2021 from the COVID-19 booster vaccine supported similar reactions to those after dose two.7 According to the Centers for Disease Control and Prevention (CDC), these initial findings indicate no unexpected patterns of adverse reactions after an additional dose of COVID-19 vaccination.7 However, adverse events related to the COVID-19 booster are still being reported and studied.6 This report presents a case of bone marrow suppression occurring after the third COVID-19 vaccine without a similar reaction after the first or second dose.Go to:

Case Report

A 74-year-old male with a history of polychondritis and hypothyroidism presented to the hospital after falling out of his chair and inability to ambulate. The patient was found to be mildly confused upon arrival to the emergency room, limiting our ability to obtain a full verbal history. Chart review revealed the patient had received his third Pfizer Covid vaccine shot seven days before admission followed by fatigue, decreased appetite, fever, and chills. The patient had received the second Pfizer Covid-19 shot nine months before the booster. No reactions to the previous two shots were noted.

Upon initial evaluation, vital signs were within normal limits and a physical exam revealed significant tenderness in the upper arm and no gross bleeding (Figure 1). Computed tomography (CT) imaging (Figure 2) was significant for enhancement of the left axillary lymph node. The patient’s initial complete blood count (CBC) was remarkable for a hemoglobin count of 9.9 g/dl and platelet count of 84 x 109/L; both values lower than his prior hemoglobin count of 13.7 g/dl and platelet count of 180 x 109/L from December of 2020. His mean corpuscular volume (MCV) was elevated at 101.3 femtolitres from his prior MCV value of 95.8 femtolitres in December of 2020. His white blood cell (WBC) count was recorded at 7.6 x 109/L.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0001.jpg

Figure 1

The patient’s upper arm showed erythema with no gross bleeding near the injection site

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0002.jpg

Figure 2

The patient’s CT imaging of the thoracic region showed enhancement of the left axillary lymph node.

The hemoglobin, WBC, and platelet count further down trended from his baseline (Figures 3​5).5). Anemia labs including ferritin levels (554 ng/mL), vitamin B12 (253 pg/mL), total bilirubin (0.5 mg/dL), and reticulocyte count (0.8%) were nonsignificant during the patient’s hospital stay. The patient’s left shoulder presented with extensive bruising, erythema, papular rash, warmth, and tenderness on palpation during the hospitalization. An improvement in WBC and platelet levels was noted on day 4 of hospitalization.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0003.jpg

Figure 3

The patient’s hemoglobin count throughout his hospital course and 6 days after discharge.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0004.jpg

Figure 4

The patient’s WBC count throughout his hospital course and 6 days after discharge.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0005.jpg

Figure 5

The patient’s platelet count throughout his hospital course and 6 days after discharge.

Before discharge, the patient was fully alert and oriented and reported improvement in his symptoms. Examination of his lateral left arm showed decreased erythema and bruising with slight petechiae. The patient was discharged due to stabilization of labs and encouraged to take oral vitamin B12 supplements. During his outpatient follow-up six days after hospitalization, his hemoglobin increased to 10.5 g/dl, WBC count increased to 4.9 x 109/L, and platelets increased to 101 x 109/L.

Discussion

This paper presents a patient with pancytopenia recorded seven days after receiving the Pfizer booster vaccine. Interestingly, this patient did not report any reactions after the first or second dose of the Pfizer vaccine against SARS-CoV-2. Pancytopenia refers to a decrease in all peripheral bloodlines and is present when all three cell lines are below the normal reference range.8 The patient’s physical exam showed no signs of active bleeding along with his labs indicating no evidence of hemolysis. The patient’s hemoglobin, platelet, and white blood cell count presented below baseline followed by a decrease and slight improvement during his hospital stay. Six days after hospitalization, all three cell lines showed improvement. The temporal association with the booster vaccine and negative infectious disease workup raised suspicion for vaccine-induced bone marrow suppression. In addition, the patient’s reticulocyte count and lactate dehydrogenase value were consistent with hypoproliferation within the bone marrow.

Currently, there is a gap in knowledge of adverse events specific to the third vaccine against SARS-CoV-2 due to the recent initiation of administration and ongoing reporting of events.6 To our knowledge, bone marrow suppression after any dose of vaccine against SARS-CoV-2 has not been previously reported. However, a prior case of pancytopenia after the third vaccination with a recombinant hepatitis B vaccine has previously been reported.9 The patient’s bone marrow biopsy within this case displayed a paucity of late myeloid elements and CD8+ T cells.9 It was believed the patient’s CD8+T cells were causing excessive production of IFN-γ; a stimulant of negative regulators of hematopoiesis such as tumor necrosis factor and lymphotoxin.10 IFN-γ has also previously been reported to create immunological effects comprising an upregulation of histocompatibility gene transcription and alteration in class I and II antigen expression at the cell surface.11 It was predicted these changes resulted in an autoimmune reaction causing suppression of maturation of hematopoietic progenitor cells and pancytopenia.9 Via a similar mechanism, we believe that our patient’s pancytopenia was immune-mediated, potentially triggered by the vaccination.

Vaccines against SARS-CoV-2 (first or second dose) and the induction of Idiopathic Thrombocytopenic Purpura (ITP) have also been recently acknowledged in multiple cases.12 Our patient presented with low platelet levels and associated petechiae and purpura at the site of the vaccination. However, the patient’s presentation of low hemoglobin and white blood cells along with normal reticulocyte levels was more indicative of pancytopenia secondary to bone marrow suppression. In patients presenting with pancytopenia, the history and the physical exam should help assess the severity of the pancytopenia and comorbid illnesses that may complicate the disorder.13 In addition, suspicious medications and exposure to toxic agents should be ruled out.13 Initial screening laboratory evaluation should include the patient’s complete blood count, peripheral blood smear examination, reticulocyte count, complete metabolic panel, prothrombin time/partial thromboplastin time, and blood type and screen. Common interventions to alleviate bone marrow suppression and pancytopenia include treating the underlying cause and utilizing supplements to boost red blood cell production if indicated.

Vaccines against SARS-CoV-2 undergo continuous safety monitoring; adverse events are very rare.14 However, vaccine hesitancy remains a barrier towards full population inoculation against SARS-CoV-2 and is influenced by misinformation regarding vaccine safety.15 One study using an anonymous online questionnaire found a person’s trust in the effectiveness of the vaccine was a major facilitative factor affecting willingness to vaccinate.16 The same study also found that 66.7% of unvaccinated participants thought the vaccine’s safety was not enough, making it the main reason for reluctance or hesitance to be vaccinated.16 Therefore, education of adverse events and available interventions post-vaccination is imperative to prevent the spread of misinformation and combat hesitancy towards vaccination.15

As of September 19, 2021, about 2.2 million people in the United States received a third vaccine against SARS-CoV-2.17 Among those who received the vaccine, 22,000 people reported the effects of the vaccine with no unexpected patterns of adverse reactions.17 Our patient demonstrates abnormal pancytopenia first recorded seven days after receiving the booster vaccine, possibly indicating a rare adverse event from the vaccination given the temporal relationship. While additional studies and observations are indicated to verify bone marrow suppression as an adverse reaction, this case report provides an opportunity for patient education and treatment planning before symptoms arise.

Conclusion

Our case report highlights pancytopenia secondary to bone marrow suppression following Pfizer vaccination against SARS-CoV-2. It is important to consider the possibility of bone marrow suppression following the third vaccine against SARS-CoV-2. Although additional studies are indicated to determine the risk factors and pathogenesis of vaccine-induced bone marrow suppression, prompt evaluation and initiation of interventions can improve patient outcomes.

References

1. Fernandes A, Chaudhari S, Jamil N, Gopalakrishnan G. COVID-19 vaccine. Endocr Pract. 2021;27(2):170–172. doi:10.1016/j.eprac.2021.01.013 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

2. Johansson MA, Quandelacy TM, Kada S, et al. SARS-CoV-2 transmission from people without COVID-19 symptoms. JAMA Network Open. 2021;4(1):e2035057–e2035057. doi:10.1001/jamanetworkopen.2020.35057 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

3. Graham BS. Rapid COVID-19 vaccine development. Science. 2020;368(6494):945–946. doi:10.1126/science.abb8923 [PubMed] [CrossRef] [Google Scholar]

4. Gee J, Marquez P, Su J, et al. First month of COVID-19 vaccine safety monitoring—United States, December 14, 2020–January 13. Morb Mortal Wkly Rep. 2021;70(8):283. doi:10.15585/mmwr.mm7008e3 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

5. Mahase E. Covid-19 booster vaccines: what we know and who’s doing what. BMJ. 2021. doi: 10.1136/bmj.n2082 [PubMed] [CrossRef] [Google Scholar]

6. Centers for Disease Control and Prevention. Selected adverse events reported after COVID-19 vaccination. Centers for Disease Control and Prevention. Available from: https://www.cdc.gov/coronavirus/2019-ncov/vaccines/safety/adverse-events.html. Accessed November 8, 2021. [Google Scholar]

7. Hause AM. Safety monitoring of an additional dose. Centers for Disease Control and Prevention; 2021. Available from: https://www.cdc.gov/mmwr/volumes/70/wr/mm7039e4.htm. Accessed February 11, 2022. [Google Scholar]

8. Valent P. Low blood counts: immune mediated, idiopathic, or myelodysplasia. Hematology. 2012;2012(1):485–491. doi:10.1182/asheducation.V2012.1.485.3798522 [PubMed] [CrossRef] [Google Scholar]

9. Viallard JF, Boiron JM, Parrens M, et al. Severe pancytopenia triggered by recombinant hepatitis B vaccine. Br J Haematol. 2000;110(1):230–233. doi:10.1046/j.1365-2141.2000.02171.x [PubMed] [CrossRef] [Google Scholar]

10. Collart MA, Belin D, Vassalli JD, De Kossodo S, Vassalli P. Gamma interferon enhances macrophage transcription of the tumor necrosis factor/cachectin, interleukin 1, and urokinase genes, which are controlled by short-lived repressors. J Exp Med. 1986;164(6):2113–2118. doi:10.1084/jem.164.6.2113 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

11. Wallach D, Fellous M, Revel M. Preferential effect of gamma interferon on the synthesis of HLA antigens and their mRNAs in human cells. Nature. 1982;299(5886):833–836. doi:10.1038/299833a0 [PubMed] [CrossRef] [Google Scholar]

12. Shah SRA, Dolkar S, Mathew J, et al. COVID-19 vaccination associated severe immune thrombocytopenia. Exp Hematol Oncol. 2021;10:42. doi:10.1186/s40164-021-00235-0 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

13. Elizabeth P, Weinzierl MD, Daniel A, Arber MD. The differential diagnosis and bone marrow evaluation of new-onset pancytopenia. Am J Clin Pathol. 2013;139(1):9–29. doi:10.1309/AJCP50AEEYGREWUZ [PubMed] [CrossRef] [Google Scholar]

14. Centers for Disease Control and Prevention. COVID-19 vaccination; 2020. Available from: https://www.cdc.gov/coronavirus/2019-ncov/vaccines/safety/safety-of-vaccines.html. Accessed February 11, 2022.

15. Dror AA, Eisenbach N, Taiber S, et al. Vaccine hesitancy: the next challenge in the fight against COVID-19. Eur J Epidemiol. 2020;35:775–779. doi:10.1007/s10654-020-00671-y [PMC free article] [PubMed] [CrossRef] [Google Scholar]

16. Gan L, Chen Y, Hu P, et al. Willingness to receive SARS-CoV-2 vaccination and associated factors among Chinese adults: a cross sectional survey. Int J Environ Res Public Health. 2021;18(4):1993. doi:10.3390/ijerph18041993 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

17. STAT. Early data suggest side effects after Covid booster similar to second dose; 2021. Available from: https://www.statnews.com/2021/09/28/side-effect-rates-from-a-third-covid-19-vaccine-dose-similar-to-those-after-second-shot-early-data-indicate/.

Never Had Covid? You May Hold KeyTo Beating the Virus

Authors: Madison Muller 02:30 PM IST, 30 Mar 2022 06:48 PM IST, 30 Mar 2022 Read more at:  https://www.bloombergquint.com/onweb/never-had-covid-you-may-hold-key-to-beating-the-virus
Copyright © Bloomberg

More than half of Americans may have never had Covid, according to U.S. government data, leaving scientists wondering whether those who’ve avoided the novel coronavirus might actually be immune to the virus altogether. This could offer new clues into how to attack Covid. At this stage in the pandemic, people may be immune due to vaccines, a past infection, or a combination of both. There’s also evidence that, in rare instances, some people may be Covid-immune without infection or vaccination at all.

The coronavirus’s frequent mutations and the fact that immunity wanes over time make it difficult to discern how many people are immune at any given moment.  Studies have shown, for example, that while omicron infections offer some immunity against delta, omicron is able to circumvent antibodies from both past infection with other variants and vaccination. Current surveillance techniques have also likely vastly underestimated the number of cases, as more people are taking Covid tests at home and not reporting the results. 

“It’s nearly impossible to gauge protection,” said Andy Pekosz, a virologist at Johns Hopkins Bloomberg School of Public Health.

As cases yet again rise in many regions more than two years into the pandemic, studying those who have not yet caught Covid has become just as critical as studying those who have. Experts say that people with so-called “super” immunity who appear resistant to the virus without vaccination may hold answers to important questions about why certain people get so sick while others don’t. Examining these cases could also help inform the development of vaccines and therapeutics less vulnerable to viral mutations.

“It is essentially defining what a best-case scenario looks like, which can also help to identify what is going wrong in those that don’t control the virus,” said Leo Swadling, an immunologist at the University College of London. 

It may be hard to believe that at this stage of the pandemic so many people have still never gotten sick. Perhaps people were asymptomatic and never knew they were infected, or, despite exposure to the virus, they just never tested positive. But even half of the population getting Covid is actually an extraordinary number of infections. The 1918 Spanish flu is estimated to have only infected 25% of the U.S. population at the time, despite causing a huge number of deaths.

Early in the pandemic, Swadling set out to find out more about the lucky few who weren’t getting sick.

“We were particularly interested in people who are exposed to the virus, but control it very quickly, clearing the virus before it can replicate to detectable levels and before it induces an antibody response,” Swadling said. “It may help us better understand what immunity is best at protection from reinfection.”

Swadling, along with colleagues in London, published a study in the journal Nature last November evaluating a group of U.K. health care workers during the first wave of the pandemic. They found evidence that some of the health care workers exposed to the virus were able to rid their bodies of it even before producing Covid-specific antibodies.

It turned out that for those people, exposure to other human coronaviruses, such as those that cause cold-like symptoms, had helped their bodies to fight off the novel coronavirus. This is because T-cells, a critical part of the body’s immune response, were able to recognize and target genetic elements of prior seasonal coronaviruses that also happened to be present in SARS-CoV-2.  That meant their bodies were able to attack the novel virus without the production of new antibodies specific to it.

Notably, the T-cells that those health care workers produced targeted a different part of the virus than the T-cells did in people who have a detectable Covid infection. Swadling said the while the T-cells produced by both vaccines and a detectable Covid-19 infection attack the frequently mutating spike protein of a virus, these health care workers’ T-cells instead targeted the virus’ internal machinery. Researchers call these T-cells that appear effective against different coronaviruses  “cross-reactive.”

“We identified new parts of the virus that we can put into a vaccine to try to improve it ,” Swadling said. These improvements, he said, could make vaccines better at preventing infection, more effective against new variants and more protective for immunocompromised individuals.

Immunity to a virus occurs when the body is able to recognize a pathogen and effectively fend off infection or disease. Antibodies, such as those acquired from a vaccine or previous infection, attack a virus as soon as it enters the body. T-cells act as another line of defense, working to stop the spread of infection and development of disease once the virus has made it into the body. The mRNA vaccines such as those made by Pfizer and Moderna work by training the body to safely produce antibodies without infection, but they also spur the production of T-cells and B-cells. That’s why the vaccines effectively prevent hospitalization even when they don’t prevent infection altogether — even when antibodies have waned, T-cells are still there to help fight off an infection more quickly.

The study’s authors proposed that T-cells they found— the ones that target the virus’ internal machinery— may offer better protection against emerging variants because of their ability to attack a key part of the virus less vulnerable to mutations than its spike protein. They theorize that targeting those areas of the virus could make the shots more effective.

As labs work to develop a single shot that would offer broader protection against any Covid variant, at least one company, Gritstone Bio Inc., is looking to put Swadling’s theories to the test. Others have reached similar conclusions as Swadling and his colleagues. One study found that in households where some people remained Covid-free despite exposure, those people also appeared protected by T-cells from past exposure to coronaviruses. Another study from January found that some children who did not develop Covid antibodies also had cross-reactive T-cells, which may be part of the reason why children generally have milder symptoms.

Knowing how many people have this heightened immune response is extremely difficult to assess. Some people may have managed to avoid the virus through continued caution or simply luck. But perhaps more important than knowing how many people fall into this category is the information about immunity that can be gathered from studying what sets them apart.

 “T-cells are very long-lived so we may not need repeated vaccination,” Swadling said. 

Studying the super-immune, he said, may help us against omicron — and any future variants of concern.

Read more at: https://www.bloombergquint.com/onweb/never-had-covid-you-may-hold-key-to-beating-the-virus
Copyright © BloombergQuint

Consequences of COVID-19 for the Pancreas

Authors: Urszula Abramczyk,1,*Maciej Nowaczyński,2Adam Słomczyński,2Piotr Wojnicz,2Piotr Zatyka,2 and Aleksandra Kuzan1 Int J Mol Sci. 2022 Jan; 23(2): 864.Published online 2022 Jan 13. doi: 10.3390/ijms23020864

Abstract

Although coronavirus disease 2019 (COVID-19)-related major health consequences involve the lungs, a growing body of evidence indicates that COVID-19 is not inert to the pancreas either. This review presents a summary of the molecular mechanisms involved in the development of pancreatic dysfunction during the course of COVID-19, the comparison of the effects of non-severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) on pancreatic function, and a summary of how drugs used in COVID-19 treatment may affect this organ. It appears that diabetes is not only a condition that predisposes a patient to suffer from more severe COVID-19, but it may also develop as a consequence of infection with this virus. Some SARS-CoV-2 inpatients experience acute pancreatitis due to direct infection of the tissue with the virus or due to systemic multiple organ dysfunction syndrome (MODS) accompanied by elevated levels of amylase and lipase. There are also reports that reveal a relationship between the development and treatment of pancreatic cancer and SARS-CoV-2 infection. It has been postulated that evaluation of pancreatic function should be increased in post-COVID-19 patients, both adults and children.

1. Effects of Severe Acute Respiratory Syndrome-Related Coronavirus (SARS-CoV) and Middle East Respiratory Syndrome-Related Coronavirus (MERS-CoV) on the Pancreas

Coronaviruses are enveloped, single- and positive-stranded RNA viruses that infect birds and mammals. In humans, coronaviruses cause respiratory tract infection, usually the common cold, but they can also cause severe respiratory illness including severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS), caused by severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), respectively [1]. Coronaviruses tend to cause epidemics and even pandemics. The first coronavirus pandemic was the SARS outbreak in 2002–2003 [2]. With the experience gained during the SARS pandemic, it was possible to more quickly identify subsequent outbreaks of the MERS epidemic in 2012 [3]. The pathomechanism of both viruses is very similar—they even both use transmembrane protease serine 2 (TMPRSS2), except SARS-CoV uses angiotensin-converting enzyme 2 (ACE2) as its receptor, whereas MERS uses dipeptidyl peptidase-4 (DPP4) [4,5]. Moreover, there is a difference in terms of the severity and frequency of symptoms, which was observed in MERS patients as more frequent hospitalization in the intensive care unit (ICU) compared to SARS patients [2] (Table 1). Diabetes was one of the significant and independent predictors for developing severe SARS-CoV and MERS-CoV [6,7,8]. In MERS, no viral antigen was detected in any tissue other than pneumocytes [7], despite multiple organ dysfunction syndrome in critically ill patients. In SARS-CoV, the presence of the virus was detected not only in respiratory epithelial cells, but also in small intestinal and colonic epithelial cells, in which it also revealed replication features [9]. It is known that the ACE2 receptor is also present in tissues such as the heart, kidney, and pancreas [8,9]. According to some authors, the presence of the receptor is sufficient for tissue entry and pathogenic activity, although other researchers do not support this thesis [9,10]. Yang et al. were some of the first researchers who hypothesized that SARS coronavirus enters islets using ACE2 as its receptor and damages islets causing acute diabetes [8]. Yang’s study revealed that SARS-CoV had a much higher affinity for pancreatic islet cells than for pancreatic exocrine cells, which was consistent with the hyperglycemia observed in some patients and rarely reported acute pancreatitis (AP) [8]. Furthermore, insulin-dependent diabetes mellitus (IDDM) and high fasting blood glucose values were observed in some inpatients [8]. A 3-year follow-up revealed that both abnormalities were transient, which may be indicative of only temporary damage to the pancreatic islets [8]. However, another reason (different from that given by Young et al.) for high fasting blood glucose value in patients may result from increased stress hormones release. Cortisol, catecholamines, growth hormone, and glucagon, which are released during infection, fever, and trauma, can lead to hyperglycemia to the same degree as SARS-CoV can [11]. No information was found in the literature about a direct impact of the MERS virus on the pancreas or on glycemia during or after infection. This may be due to an insufficiently detailed analysis of the available data during previous studies that oscillated primarily, for laboratory tests, between complete blood count (CBC), lactate dehydrogenase (LDH), urea, and creatinine analysis. A summary of SARS-CoV, MERS, and SARS-CoV-2 is shown in Table 1.Table 1. The summary of characteristics of SARS and MERS coronaviruses. Dipeptidyl peptidase-4 (DPP4), transmembrane protease serine 2 (TMPRSS2), hospitalization in the intensive care unit (ICU), and cathepsin L (CTSL).

Table

In 2019, a new coronavirus named SARS-CoV-2 was identified, causing COVID-19. This virus has many characteristics that are analogous to SARS-CoV, for example, ACE2 is also used as its receptor [12]. Patients with diabetes are among those with the most severe forms of COVID-19 and related mortality; insights from recent experience can guide future management [17], particularly for the consequences on the pancreas. As the COVID-19 pandemic has been ongoing for nearly two years, this study aims to collect data concerning the impact of SARS-CoV-2 on the pancreas and analyze them to estimate the future health consequences of COVID-19 in populations.

2. Pancreatic Damage during Diabetes Mellitus and COVID-19

Pancreas tissue damage may cause to the lack of control over normal blood glucose levels in the body. Type 1 diabetes (T1D) is caused by insulin deficiency due to βcell dysfunction of immunologic or idiopathic cause. In contrast, β pancreatic cells in type 2 diabetes (T2D) become depleted over time due to compensatory insulin secretion caused by insulin resistance. There is also type 3 diabetes (T3D), which is described as diabetes associated with the development of Alzheimer’s disease [18]. It should not be confused with type 3c (pancreatogenic) diabetes, which relates to the exocrine and digestive functions of the pancreas. The issue concerning the impairing effect of hyperglycemia (glucotoxicity) on the secretory function of the islets of Langerhans has also been increasingly raised. In addition to endocrine dysfunction, some diabetic patients may also develop moderate exocrine pancreatic insufficiency (EPI), in which pancreatic enzyme secretion is impaired. EPI can be observed in almost all patients with type 3c (pancreatogenic) diabetes (secondary to pancreatic pathology), whereas the prevalence of this dysfunction in patients with T1D or T2D is 40% and 27%, respectively [19].With the ongoing SARS-CoV-2 pandemic, patients with reduced normal pancreatic function are at high risk for COVID-19 requiring hospitalization. In particular, elevated blood glucose levels in patient with and without diabetes makes them at high risk of mortality [20]. Hyperglycemia impairs the immune response (e.g., by reducing the activity of macrophages and polymorphonuclear leukocytes), which in addition influences the excessive cytokine response, and thus has a strong proinflammatory effect.The receptors for ACE2, which are also present in the pancreas, are a target of SARS-CoV-2 in the body, which may result in acute failure of both the islets of Langerhans and exocrine cells [15]. Infection-induced, transient β cell dysfunction may cause an uncontrolled hyperglycemic state, especially in patients whose pancreas is already affected by diabetes mellitus. Persistent hyperglycemia usually predisposes to severe COVID-19 and to viral infection complicated by secondary infections. The aforementioned risk can be found in T1D, T2D, and gestational diabetes mellitus (GDM). In T2D patients, the much more frequent coexistence of other risk factors such as atherosclerosis, hypertension, and obesity should be taken into consideration, which usually implies a worse prognosis for the course of COVID-19 [21,22]. In GDM, SARS-CoV-2 infection not only increases the risk of more severe course of the disease in a patient, but may also result in diabetic fetopathy or, in more advanced pregnancies, increase the risk of future pathologies involving glucose metabolism (such as T2D) in a child [23].

3. Pancreatic Damage in Patients without Pre-Existing Diabetes Infected with SARS-CoV-2

It has been postulated that, either by direct invasion of pancreatic cells by the virus or by indirect mechanisms described below, SARS-CoV-2 has a destructive effect on the pancreas and can lead to insulin deficiency and development of T1D [24].If the hypothesis that SARS-CoV-2 infection causes hyperglycemia is true, increased statistics of new T1D cases should be observed. Indeed, there are publications that describe such a phenomenon. For instance, Unsworth et al. and Kamrath et al. describe an increase in new-onset T1D in children during the COVID-19 pandemic [16,25]. Although pancreatic β cell damage induced transient hyperglycemia in SARS-CoV, it is still unclear whether β cell damage is transient or permanent in SARS-CoV-2 [22]. This information appears to be of great importance because COVID-19 in children is frequently considered “harmless”. Therefore, it is reasonable to sensitize parents to the fact that the consequences of COVID-19 may be potentially dangerous for their children.Below you will find the proposed molecular mechanisms that may participate in pancreatic damage that causes carbohydrate metabolism disorders.

4. Etiology Associated with ACE2, TMPRSS2, and Na+/H+ Exchanger

As previously mentioned, SARS-CoV infection of host cells is facilitated by ACE2, but also by the transmembrane protease serine 2 (TMPRSS2) and other host cell proteases such as cathepsin L (CTSL) [13].ACE2 is an enzyme that is expressed to varying degrees in most cells of the human body [14,26,27]. This enzyme catalyzes the conversion of angiotensin II to angiotensin 1–7, taking part in the maintenance of body homeostasis by influencing the regulation of blood pressure and water–electrolyte balance through the renin–angiotensin–aldosterone (RAA) system [28]. Moreover, ACE2/angiotensin (1–7) stimulates insulin secretion, reduces insulin resistance, and increases pancreatic βcell survival [27,28].In addition to the key role it plays in maintaining body homeostasis, ACE2 is now also the best-studied target for SARS-CoV-2 S glycoprotein, enabling infection of host cells [27,29]. ACE2 in the pancreas is expressed mainly within the pericytes of pancreatic microvessels and to a lesser extent on the surface of the islets of Langerhans, including pancreatic β cells [30]. SARS-CoV-2 shows 10–20 times more activity against ACE2 than SARS-CoV, which significantly increases the infectivity of SARS-CoV-2 [31,32]. Furthermore, studies indicate that SARS-CoV may also downregulate ACE2 expression in cells. This causes an imbalance between ACE and ACE2, consequently leading to blood pressure disorders and systemic inflammation [27,33,34]. Due to the 79% genetic similarity between SARS-CoV and SARS-CoV-2 [35], it is speculated that ACE2 expression may also be downregulated during SARS-CoV-2 infection, causing i.a. MODS observed in COVID-19 [27].During cell infection by SARS-CoV-2, in addition to the role played by ACE2, it is also appropriate to consider the significant pathogenic role of TMPRSS2 that is necessary for the preparation of S glycoprotein by its cleavage, thereby enabling fusion of the virus with the host cell [36,37]. The S1 and S2 domains can be distinguished in the SARS-CoV-2 S glycoprotein. The S1 domain is involved in binding to the ACE2 receptor and then TMPRSS2 intersects with the S protein, including at the boundary of the S1 and S2 domains and within the S2 domain, which enables the virus–cell fusion [38,39]. According to studies, TMPRSS2 expression is significantly increased in obese patients, which may contribute to the poorer prognosis that is observed during COVID-19 in this patient group [40]. Moreover, obese patients are frequently already burdened with problems such as insulin resistance at baseline, while the presence of ACE2 and TMPRSS2 within the pancreas as a binding site for SARS-CoV-2 may exacerbate insulin resistance causing problems in terms of diabetes management in COVID-19 patients.There are also other mechanisms by which COVID-19 may affect the development of hyperglycemia. It is reported that the virus may also affect the glucose regulation through the Na+/H+ exchanger and lactate pathways. The mechanism is that angiotensin II, which accumulates during infection, contributes to insulin resistance and—by activating the Na+/H+ exchanger in the pancreas—it leads to hypoxia and extracellular acidification, which, through the accumulation of calcium and sodium ions in the cells and the production of reactive oxygen species, damages pancreatic tissue [41]. Simultaneously, the concentration of lactate increases, which in COVID-19 infection is intensively released, among other things, from adipose tissue, and then monocarboxylate transporters transport lactate and H+ ion inward in the cell, which increases Na+/H+ exchanger activation, further disrupting pancreatic homeostasis [41].

5. The Etiology Associated with a Systemic Proinflammatory Environment, Immune System Aggression, and Production of Novel Autoantigens

A broad spectrum of proinflammatory cytokines, such as IL-2, IL-6, IL-7, IL-8, interferon-γ, and Tumor Necrosis Factor α (TNF-α), is released during, in particular severe, COVID-19 infection [42,43,44]. Based on current studies, it is reasonable to suspect that these cytokines are released in response to the binding of the virus to ACE2 receptors that are also located in the pancreas [9,42]. The cause of pancreatic damage during COVID-19 is the cytokine storm that plays a key role in this case, because in both acute pancreatitis (AP) and severe COVID-19, elevated levels of the aforementioned interleukins are associated with the severity of these both disease entities. Particular attention should be paid to IL-6, because it is suspected to play a key role in the pathogenesis of AP as well as acute respiratory distress syndrome (ARDS) that is the most common and most severe clinical manifestation of COVID-19. In COVID-19-induced ARDS, IL-6 levels are correlated with disease-related mortality [45,46,47]. At the same time, high IL-6 levels correlate with an increased risk of developing severe pancreatitis [48,49].The production of neutralizing antibodies is also an important response of the body in the course of COVID-19 [50,51,52]. It has been observed that early seroconversion and very high antibody titers occur in patients with severe SARS-CoV-2 infection [53,54]. The available literature details a mechanism called antibody-dependent enhancement (ADE), which is associated with a pathological response of the immune system [53]. ADE exploits the existence of FcRS receptors located on various cells of the immune system, for example, macrophages and B lymphocytes [53]. This relationship may lead to a likely bypass of the classical viral infection pathway by ACE2, and virus–antibody complexes may stimulate macrophages to overproduce cytokines including significant IL-6 [53,55].Molecular mimicry may be also one of potential causes of pancreatic cell damage [56]. There are similarities in the protein structure of the virus and β-pancreatic cells, which may induce cross-reactivity and lead to autoimmunity [56]. Furthermore, viral infection may also lead to increased cytokine secretion by surrounding dendritic cells and activation of naive T cells in genetically predisposed individuals [56].

6. Pancreatitis in COVID-19

Although the impact of the discussed coronavirus-induced disease on exocrine function is not fully understood, available literature is not able to unambiguously determine whether the tissue damage leading to AP occurs as a result of direct SARS-CoV-2 infection [57] or as a result of systemic MODS with increased levels of amylase and lipase [42]. Liu et al.’s study involving 121 COVID-19 patients with a mean age of 57 years and a variable course of infection proved above-normal levels of amylase and lipase in 1–2% of patients with moderate COVID-19 infection and in 17% of patients with severe COVID-19 infection. This may support the hypothesis that SARS-CoV-2-induced disease has a destructive effect not only on the endocrine portion of this gland, but also on the exocrine one [15].However, elevated levels of pancreatic enzymes in question do not have to mean the destruction of pancreatic cells—after all, such a situation may occur during kidney failure or diarrhea in the course of COVID-19. Furthermore, there remains the question of the effect of drugs administered during SARS-CoV-2 infection on changes in pancreatic function [42], discussed further in this article.According to the International Association of Pancreatology (IAP) and the American Pancreatic Association (APA), the diagnosis of AP is based on meeting two out of three of the following criteria: clinical (epigastric pain), laboratory (serum amylase or lipase > 3 × upper limit of normal), and/or imaging criteria (computed tomography, magnetic resonance imaging, ultrasound) [58]. Pancreatic lipase is considered as a potential marker of SARS-CoV-2 severity with concomitant AP. In Hemant Goyal et al.’s study, as many as 11.7% out of 756 COVID-19 patients had hyperlipidemia and they were three times more likely to have severe COVID-19 [59]. Those with higher lipase levels—17% out of 83 patients—required hospitalization [60]. However, it is difficult to distinguish whether these patients required hospitalization for severe systemic COVID-19 infection or for pancreatitis in the course of COVID-19 infection.AP in the course of COVID-19 was analyzed in different age groups; however, some studies only involve children [61]. Compared to pancreatic islet cells, cells of the exocrine pancreatic ducts are more abundant in ACE2 and TMPRSS2 that are necessary for the virus to penetrate the cell [62]. Infection of these cells may be one of the causes of AP [63]. Infections, both bacterial and viral, are one of the causes of AP. The definitive mechanism of how viral infections affect pancreatic cells is not known; however, a study by Maria K Smatti et al. found that there is infection of pancreatic islet cells and replication of the virus within them, ultimately resulting in autoimmune reactions that eventually affect both diabetes and AP in a negative way [64]. For non-SARS-CoV-2 patients, the etiology of AP is known and confirmed in most cases, although 69% of those undergoing infection do not have definite etiology of AP while meeting the AP-Atlanta criteria for diagnosis [65].Hegyi et al. show the mechanism of MODS formation during COVID-19 infection and AP [66]. This is lipotoxicity, involving an interstitial increase in pancreatic lipase levels, which leads to the breakdown of triacylglycerols contained in adipose tissue cells and the release of unsaturated fatty acids. These in turn exert a toxic effect on mitochondria causing the release of cytokines, which results in a cytokine storm.There is also a hypothesis, which claims that AP can develop because of blood circulatory centralization resulting from uncontrolled cytokine storm created by SARS-CoV-2 infection [67]. There exist reports that say that pancreatic ischemia may be the cause of different degrees of acute pancreatitis [68,69]. This statement can be supported by the reports that state that pancreatic blood reperfusion inhibits the development of AP and accelerate pancreas recovery [70].Another mechanism of developing AP during COVID-19 may be a coagulation cascade activation caused by active inflammatory process due to SARS-CoV-2 infection [71]. The ongoing inflammatory process causes not only hemostasis imbalance for blood clotting, but it also leads to intensification of coagulation by removing epithelial cell protein C receptor (EPCR) from epithelial by the means of inflammatory mediators and thrombin [71]. This means that both processes intensify each other. Simultaneously, it was proved that COVID-19 predisposes patients to venous thromboembolism resulting from excessive inflammation, platelet activation, and endothelial dysfunction [72]. It is also important to notice that AP is inherently connected with a coagulation cascade activation, increased fibrinolysis and, hence, higher level of D-dimers [73]. Acute pancreatitis severity may depend on hemostasis imbalance; local coagulation results in mild AP whereas, in more severe AP cases, the imbalance may lead to development of disseminated intravascular coagulation (DIC) [74]. These observations have been supported by the results of experimental studies showing that the inhibition of coagulation reduces the development of AP [75,76,77] and exhibits therapeutic effect in this disease [78,79]. Additionally it is worth noticing that infection-related hyperglycemia has powerful inflammation-promoting effects on the organism (especially when organism is under stress), thus increasing the number of inflammatory mediators [74]. Unfortunately, it is impossible to decide which process is dominant in causing AP in COVID-19 patients: local inflammation caused by SARS-CoV-2 or systemic hemostasis imbalance.Clinical reports on low molecular weight heparin (LMWH) treatment in AP seem to emphasize a more significant role of hemostasis imbalance in causing AP [74,80,81]. Heparin is extremely significant in the treatment of COVID19 patients due to its properties, mainly its similarity to heparan sulphate, which appears in a respiratory tract, its interactions with SARS-CoV-2 S protein, leading to viral adhesion inhibiting to the cell membrane [82], and its anti-inflammatory effects. Thanks to these properties, heparin may not only show its therapeutic effect as the anticoagulant, but also its protective role in acute pancreatitis or respiratory inflammations [83,84,85].

7. Drugs Used against SARS-CoV-2 Infection (Glucocorticoids, Lopinavir, Ritonavir, Remedesivir, Interferon-β1 (IFN-β1), and Azithromycin) Induce Pancreatic β Cell Damage

Statistical analyses revealed a significantly higher incidence of AP with the concomitant systemic use of glucocorticosteroids (GCS) [86]. In one study analyzing the development of drug-induced AP, dexamethasone, was classified as type IB—there was one case report in which administration of this drug-induced AP occurred; however, other causes of pancreatitis such as alcohol consumption could not be excluded [87]. Other GCS such as hydrocortisone, prednisone, and prednisolone were used in patients with mild to moderate AP; however, they cannot be classified into any group because they are frequently used together with other drugs that cause AP [86,87]. However, it has been determined that GCS independently increase the risk of AP, and patients with residual AP risk factors during GCS treatment should be more monitored for the development of AP [23]. Javier A. Cienfuegos et al. additionally observed that one of mechanisms of AP formation in COVID-19 patients may be GCS administered at the time of admission to the ICU with severe respiratory failure [88]. Because GCS were used in severe COVID-19 cases, it is difficult to say what true reason for AP was—either a severe course of COVID-19 or GCS application or both.GCS are used in the treatment of many diseases due to their immunosuppressive and anti-inflammatory nature. They induce diabetes in previously healthy patients as well as significantly exacerbate diabetes in diabetic patients [89,90]. Diabetes develops in these patients likely due to pancreatic β cell dysfunction, decreased insulin secretion, and increased insulin resistance in other tissues, which may depend on the timing and the dose of GCS used [89,91]. Long-acting or intermediate-acting insulin alone or combined with short-acting insulin should be used during the treatment [90]. At the same time, no advantage was found over the use of oral hypoglycemics [92]. Certainly, patients after long-term GCS therapy will need further observation for diabetes.Lopinavir/ritonavir was classified in the previously mentioned study as a type IV drug—medications reported with little information [87]. Both drugs are included in the group of antiretrovirals that act as protease inhibitors, and they are primarily used for HIV infection. Although Lopinavir is an active drug, it is not used alone. There have been reports about the occurrence of AP during the use of protease inhibitors in question, which is also described in the Summary of Product Characteristics (SmPC) of products approved by Committee for Medicinal Products for Human Use (CHMP). It has been proved that the use of lopinavir/ritonavir causes hyperglycemia [93,94].Remdesivir is an adenosine analogue with antiviral activity. There are single reports about the occurrence of pancreatitis as a result of the use of the aforementioned medication [95,96]. At the same time, it should be noted that other nucleoside-derivative drugs may cause pancreatitis [97].The current state of knowledge does not clearly indicate the therapeutic benefit of interferon-β in the treatment of COVID-19 patients [98,99]. To date, only single cases suggesting induction of pancreatitis by interferon-β have been reported. Based on this, Badalov et al. classified interferon into type III [87].There are few reports about the development of AP due to the use of azithromycin [100]. In the previously mentioned study by Badalov et al., two macrolide antibiotics were classified as type II and III. Unfortunately, there are no direct data concerning azithromycin. Interestingly, there were cases of patients with concomitant symptoms of AP and viral pneumonia caused by SARS-CoV-2 who were treated with azithromycin, which resulted in complete resolution of symptoms for both conditions [96,101]. Based on available data, the risk of azithromycin-induced AP is low.There is no clear evidence that azithromycin affects blood glucose levels in humans. However, it is known for its prokinetic effects, which may be helpful in patients who suffer from diabetic gastroparesis [102]). The incidence of hypo- and hyperglycemic episodes was not proved to be significant for azithromycin [103]; however, the risk of dysglycemia is emphasized [94]. In the SmPC, where azithromycin is the main ingredient, it is not possible to establish a causal relationship between the occurrence of pancreatitis and taking medications (Zithromax) based on the available data. In contrast, glycemic disturbances were not indicated as side effects (Zithromax) [104].Hydroxychloroquine has been extensively promoted for COVID-19 due to its anti-inflammatory and antiviral action; yet, the use of this agent in diabetes deserves particular attention for its documented hypoglycemic action, and its benefit on COVID-19 is controversial, although there is large usage [105].Table 2 shows a comparison of the side effects of medications in question.Table 2. Side effects of medications used in SARS-CoV-2 infection in the area of pancreatic effects and hyperglycemia.

Table

8. COVID-19, Pancreas, and Glycation

In T2D diabetics, oxidative stress leading to pancreatic damage may be stimulated by, among other things, the intense glycation that accompanies hyperglycemia [24]. Glycation is a non-enzymatic process involving reducing sugar and amino groups of proteins, which contributes to the formation of advanced glycation end products (AGEs). These products have significantly altered biochemical properties relative to the substrates, including proteins that have altered conformation, increased rigidity, resistance to proteolysis, etc. [106,107].Part of the pathomechanism involved in facilitating coronavirus infection in diabetics may be due to glycation of ACE2 and SARS-CoV-2 spike protein [108,109].An interesting hypothesis is that COVID-19 has a worse prognosis in patients with intense glycation, and thus high tissue AGE content. Glycated hemoglobin (HbA1c) is a commonly used diagnostic tool that estimates intensity of glycation. The parameter is not only a marker of long-term persistent hyperglycemia, but an active participant in immune processes, as HbA1c levels are associated with NK cell activity [110].Zhang et al.’s retrospective cohort study concerning COVID-19 patients revealed that glycated hemoglobin correlates negatively with saturation (SaO2) and positively with C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), and fibrinogen (Fbg). It was concluded that determination of HbA1c levels may be helpful in assessing inflammation, hypercoagulability, and prognosis of COVID-19 patients [111].According to the meta-analysis by Chen et al. (2020), Hba1c levels were slightly higher in patients with severe COVID-19 compared to patients with mild COVID-19; however, this correlation was not statistically significant. However, it is of great importance to note that only two studies analyzing HbA1c in COVID-19 patients were included in this analysis because only these studies were available in May 2020 [112].Glycation plays its physiological effects not only directly by changing the properties of various proteins, but also indirectly through various receptors. RAGE is the most common receptor for AGEs. Binding of RAGE to its ligands activates a proinflammatory response primarily by mitogen-activated protein kinase (MAPK) and nuclear factor κβ (NFκβ) pathways. This interaction was proved to be significant in the pathogenesis of cancer, diabetes mellitus, and other inflammatory disorders [113]. RAGE was found to be expressed in the pancreas, and S100P-derived RAGE antagonistic peptide (RAP) reduces pancreatic tumor growth and metastasis [113]. The implications of this fact may also apply to the etiology and treatment of COVID-19. It has been postulated that targeting RAGE by various antagonists of this receptor may inhibit damage to various organs including the pancreas [114].

9. COVID-19 vs. Pancreatic Cancer

Immunosuppression as a treatment effect, elevated cytokine levels, altered expression of receptors for SARS-CoV-2, and a prothrombotic state in patients with various types of cancer may exacerbate the effects of COVID-19 [115].Focusing on pancreatic cancer, it can be observed that the pathomechanism of both diseases—COVID-19 and tumorigenesis in the pancreas—overlap in several molecular mechanisms. As mentioned above, SARS-CoV-2 infection of host cells is facilitated by ACE-2, TMPRSS2, and CTSL. Cathepsin L is upregulated in a wide variety of cancers, including pancreatic adenocarcinoma [13]. TMPRSS2 upregulation in pancreatic cancers is moderate, whereas ACE-2 is overexpressed in some cancers, including pancreatic carcinomas [115]. Interestingly, ACE2 upregulation seems to be associated with favorable survival in pancreatic cancer [116], and it is known that SARS-CoV-2 reduces ACE2 expression [22]. Furthermore, the above-mentioned RAGE may also participate in both pancreatic cancer development and SARS-CoV-2 infection. RAGE facilitates neutrophil extracellular trap (NET) formation in pancreatic cancer [117]. In conclusion, pancreatic cancer predisposes to an increased risk of COVID-19 and its more severe course, and coronavirus infection may contribute to pancreatic cancer.It also seems important how the COVID-19 epidemic has affected the treatment of patients with pancreatic cancer of SARS-CoV-2-independent etiology. According to the study by Pergolini et al., care of patients with pancreatic cancer can be disrupted or delayed, particularly in the context of treatment selection, postoperative course, and outpatient care [118].A separate issue is how patients after pancreatoduodenectomy respond to SARS-CoV-2 infection. A case series reported by Bacalbasa reveal that patients who develop SARS-CoV-2 infection postoperatively require re-admission in the ICU and a longer hospital stay; however, these infections are not fatal [119]. Although the analysis was performed on single cases, it is concluded that these results are an argument to perform elective oncological surgeries [119].There are also reports that chemotherapy in pancreatic cancer patients who become ill between treatment series can be successfully completed after a complete cure of the infection [120]. Guidelines for, e.g., prioritization and treatment regimens regarding pancreatic cancer treatment in the era of the pandemic, are developed and described, for example, by Catanese et al. or Jones et al. [121,122].

10. Conclusions

Evidence shows that SARS-CoV-2 infection contributes to damage within the pancreas. The mechanisms that are involved in this include but are not limited to direct cytopathic effect of SARS-CoV-2 replication and systemic and local inflammatory response [123]. At the current state of knowledge, it is certain that the virus attacks the endocrine portion of the pancreas as well as, to a much lesser extent, the exocrine portion. It has been shown that a bidirectional relationship between COVID-19 and diabetes exists; indeed, diabetes is associated with COVID-19 severity and mortality but, at the same time, patients with COVID-19 have shown new onset of diabetes [124]. SARS-CoV-2 virus infection not only directly affects glycemic levels, but also exacerbates already existing hyperglycemia through its negative impact on the functional competence of the islets of Langerhans. It cannot be excluded that the real cause of exocrine dysfunction of this gland is the negative effect of the drugs used for treatment of the infection. As the pandemic progresses, special attention should be given to the evaluation of chronic and acute pancreatic diseases, including pancreatic cancer, so that faster diagnosis enables faster implementation of treatment.

Author Contributions

Conceptualization, A.K.; investigation, U.A., M.N., A.S., P.W., P.Z. and A.K.; resources, U.A., M.N., A.S., P.W., P.Z. and A.K.; writing—original draft preparation, U.A., M.N., A.S., P.W., P.Z. and A.K.; visualization, U.A.; supervision, A.K. All authors have read and agreed to the published version of the manuscript.

References

  1. Zhang, S.F.; Tuo, J.L.; Huang, X.B.; Zhu, X.; Zhang, D.M.; Zhou, K.; Yuan, L.; Luo, H.J.; Zheng, B.J.; Yuen, K.Y.; et al. Epidemiology characteristics of human coronaviruses in patients with respiratory infection symptoms and phylogenetic analysis of HCoV-OC43 during 2010–2015 in Guangzhou. PLoS ONE 201813, e0191789. [Google Scholar] [CrossRef]
  2. De Wit, E.; Van Doremalen, N.; Falzarano, D.; Munster, V.J. SARS and MERS: Recent insights into emerging coronaviruses. Nat. Rev. Microbiol. 201614, 523–534. [Google Scholar] [CrossRef]
  3. Zaki, A.M.; van Boheemen, S.; Bestebroer, T.M.; Osterhaus, A.D.M.E.; Fouchier, R.A.M. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. N. Engl. J. Med. 2012367, 1814–1820. [Google Scholar] [CrossRef] [PubMed]
  4. Song, Z.; Xu, Y.; Bao, L.; Zhang, L.; Yu, P.; Qu, Y.; Zhu, H.; Zhao, W.; Han, Y.; Qin, C. From SARS to MERS, thrusting coronaviruses into the spotlight. Viruses 201911, 59. [Google Scholar] [CrossRef]
  5. Shirato, K.; Kawase, M.; Matsuyama, S. Middle East Respiratory Syndrome Coronavirus Infection Mediated by the Transmembrane Serine Protease TMPRSS2. J. Virol. 201387, 12552. [Google Scholar] [CrossRef]
  6. Azhar, E.I.; Hui, D.S.C.; Memish, Z.A.; Drosten, C.; Zumla, A. The Middle East Respiratory Syndrome (MERS). Infect. Dis. Clin. N. Am. 202033, 891–905. [Google Scholar] [CrossRef]
  7. Arabi, Y.M.; Balkhy, H.H.; Hayden, F.G.; Bouchama, A.; Luke, T.; Baillie, J.K.; Al-Omari, A.; Hajeer, A.H.; Senga, M.; Denison, M.R.; et al. Middle East Respiratory Syndrome. N. Engl. J. Med. 2017376, 584–594. [Google Scholar] [CrossRef]
  8. Yang, J.K.; Lin, S.S.; Ji, X.J.; Guo, L.M. Binding of SARS coronavirus to its receptor damages islets and causes acute diabetes. Acta Diabetol. 201047, 193–199. [Google Scholar] [CrossRef] [PubMed]
  9. Leung, W.K.; To, K.; Chan, P.K.; Chan, H.L.; Wu, A.K.; Lee, N.; Yuen, K.Y.; Sung, J.J. Enteric involvement of severe acute respiratory syndrome-associated coronavirus infection. Gastroenterology 2003125, 1011–1017. [Google Scholar] [CrossRef]
  10. Shi, X.; Gong, E.; Gao, D.; Zhang, B.; Zheng, J.; Gao, Z.; Zhong, Y.; Zou, W.; Wu, B.; Fang, W.; et al. Severe acute respiratory syndrome associated coronavirus is detected in intestinal tissues of fatal cases. Am. J. Gastroenterol. 2005100, 169–176. [Google Scholar] [CrossRef]
  11. Buczkowska, E.O. Alterations of blood glucose homeostasis during septic or injury stress-hyperglycemia. Wiad Lek. 200255, 731–744. [Google Scholar] [PubMed]
  12. Zippi, M.; Hong, W.; Traversa, G.; Maccioni, F.; De Biase, D.; Gallo, C.; Fiorino, S. Involvement of the exocrine pancreas during COVID-19 infection and possible pathogenetic hypothesis: A concise review. Infez. Med. 202028, 507–515. [Google Scholar]
  13. Katopodis, P.; Anikin, V.; Randeva, H.S.; Spandidos, D.A.; Chatha, K.; Kyrou, I.; Karteris, E. Pan-cancer analysis of transmembrane protease serine 2 and cathepsin L that mediate cellular SARS‑CoV‑2 infection leading to COVID-19. Int. J. Oncol. 202057, 533–539. [Google Scholar] [CrossRef] [PubMed]
  14. Zou, X.; Chen, K.; Zou, J.; Han, P.; Hao, J.; Han, Z. Single-cell RNA-seq data analysis on the receptor ACE2 expression reveals the potential risk of different human organs vulnerable to 2019-nCoV infection. Front. Med. 202014, 185–192. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, F.; Long, X.; Zhang, B.; Zhang, W.; Chen, X.; Zhang, Z. ACE2 Expression in Pancreas May Cause Pancreatic Damage after SARS-CoV-2 Infection. Clin. Gastroenterol. Hepatol. 202018, 2128–2130. [Google Scholar] [CrossRef]
  16. Unsworth, R.; Wallace, S.; Oliver, N.S.; Yeung, S.; Kshirsagar, A.; Naidu, H.; Kwong, R.M.W.; Kumar, P.; Logan, K.M. New-Onset Type 1 Diabetes in Children During COVID-19: Multicenter Regional Findings in the U.K. Diabetes Care 202043, e170–e171. [Google Scholar] [CrossRef] [PubMed]
  17. Stoian, A.P.; Banerjee, Y.; Rizvi, A.A.; Rizzo, M. Diabetes and the COVID-19 Pandemic: How Insights from Recent Experience Might Guide Future Management. Metab. Syndr. Relat. Disord. 202018, 173–175. [Google Scholar] [CrossRef]
  18. Nguyen, T.T.; Ta, Q.T.H.; Nguyen, T.K.O.; Nguyen, T.T.D.; Giau, V. Van Type 3 Diabetes and Its Role Implications in Alzheimer’s Disease. Int. J. Mol. Sci. 202021, 3165. [Google Scholar] [CrossRef]
  19. Pezzilli, R.; Andriulli, A.; Bassi, C.; Balzano, G.; Cantore, M.; Fave, G.D.; Falconi, M.; Group, L.F. the E.P.I. collaborative (EPIc) Exocrine pancreatic insufficiency in adults: A shared position statement of the Italian association for the study of the pancreas. World J. Gastroenterol. 201319, 7930–7946. [Google Scholar] [CrossRef]
  20. Abramczyk, U.; Kuzan, A. What Every Diabetologist Should Know about SARS-CoV-2: State of Knowledge at the Beginning of 2021. J. Clin. Med. 202110, 1022. [Google Scholar] [CrossRef]
  21. Apicella, M.; Campopiano, M.C.; Mantuano, M.; Mazoni, L.; Coppelli, A.; Del Prato, S. COVID-19 in people with diabetes: Understanding the reasons for worse outcomes. Lancet Diabetes Endocrinol. 20209, 782–792. [Google Scholar] [CrossRef]
  22. Boddu, S.K.; Aurangabadkar, G.; Kuchay, M.S. New onset diabetes, type 1 diabetes and COVID-19. Diabetes Metab. Syndr. 202014, 2211–2217. [Google Scholar] [CrossRef] [PubMed]
  23. Sadr-Azodi, O.; Mattsson, F.; Bexlius, T.S.; Lindblad, M.; Lagergren, J.; Ljung, R. Association of oral glucocorticoid use with an increased risk of acute pancreatitis: A population-based nested case-control study. JAMA Intern. Med. 2013173, 444–449. [Google Scholar] [CrossRef]
  24. Hayden, M.R. An Immediate and Long-Term Complication of COVID-19 May Be Type 2 Diabetes Mellitus: The Central Role of β-Cell Dysfunction, Apoptosis and Exploration of Possible Mechanisms. Cells 20209, 2475. [Google Scholar] [CrossRef]
  25. Kamrath, C.; Mönkemöller, K.; Biester, T.; Rohrer, T.R.; Warncke, K.; Hammersen, J.; Holl, R.W. Ketoacidosis in Children and Adolescents with Newly Diagnosed Type 1 Diabetes During the COVID-19 Pandemic in Germany. JAMA 2020324, 801–804. [Google Scholar] [CrossRef] [PubMed]
  26. Hamming, I.; Timens, W.; Bulthuis, M.; Lely, A.; Navis, G.; Goor, H. van Tissue distribution of ACE2 protein, the functional receptor for SARS coronavirus. A first step in understanding SARS pathogenesis. J. Pathol. 2004203, 631–637. [Google Scholar] [CrossRef]
  27. Ni, W.; Yang, X.; Yang, D.; Bao, J.; Li, R.; Xiao, Y.; Hou, C.; Wang, H.; Liu, J.; Yang, D.; et al. Role of angiotensin-converting enzyme 2 (ACE2) in COVID-19. Crit. Care 202024, 422. [Google Scholar] [CrossRef] [PubMed]
  28. Santos, R.A.S.; Sampaio, W.O.; Alzamora, A.C.; Motta-Santos, D.; Alenina, N.; Bader, M.; Campagnole-Santos, M.J. The ACE2/Angiotensin-(1–7)/MAS Axis of the Renin-Angiotensin System: Focus on Angiotensin-(1–7). Physiol. Rev. 201898, 505–553. [Google Scholar] [CrossRef]
  29. Li, W.; Moore, M.J.; Vasilieva, N.; Sui, J.; Wong, S.K.; Berne, M.A.; Somasundaran, M.; Sullivan, J.L.; Luzuriaga, K.; Greenough, T.C.; et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 2003426, 450–454. [Google Scholar] [CrossRef] [PubMed]
  30. Fignani, D.; Licata, G.; Brusco, N.; Nigi, L.; Grieco, G.E.; Marselli, L.; Overbergh, L.; Gysemans, C.; Colli, M.L.; Marchetti, P.; et al. SARS-CoV-2 Receptor Angiotensin I-Converting Enzyme Type 2 (ACE2) Is Expressed in Human Pancreatic β-Cells and in the Human Pancreas Microvasculature. Front. Endocrinol. 202011, 596898. [Google Scholar] [CrossRef] [PubMed]
  31. Wrapp, D.; Wang, N.; Corbett, K.S.; Goldsmith, J.A.; Hsieh, C.-L.; Abiona, O.; Graham, B.S.; McLellan, J.S. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science 2020367, 1260–1263. [Google Scholar] [CrossRef]
  32. Glowacka, I.; Bertram, S.; Herzog, P.; Pfefferle, S.; Steffen, I.; Muench, M.O.; Simmons, G.; Hofmann, H.; Kuri, T.; Weber, F.; et al. Differential Downregulation of ACE2 by the Spike Proteins of Severe Acute Respiratory Syndrome Coronavirus and Human Coronavirus NL63. J. Virol. 201084, 1198–1205. [Google Scholar] [CrossRef] [PubMed]
  33. Haga, S.; Yamamoto, N.; Nakai-Murakami, C.; Osawa, Y.; Tokunaga, K.; Sata, T.; Yamamoto, N.; Sasazuki, T.; Ishizaka, Y. Modulation of TNF-α-converting enzyme by the spike protein of SARS-CoV and ACE2 induces TNF-α production and facilitates viral entry. Proc. Natl. Acad. Sci. USA 2008105, 7809–7814. [Google Scholar] [CrossRef] [PubMed]
  34. Oudit, G.Y.; Kassiri, Z.; Jiang, C.; Liu, P.P.; Poutanen, S.M.; Penninger, J.M.; Butany, J. SARS-coronavirus modulation of myocardial ACE2 expression and inflammation in patients with SARS. Eur. J. Clin. Investig. 200939, 618–625. [Google Scholar] [CrossRef] [PubMed]
  35. Muniangi-Muhitu, H.; Akalestou, E.; Salem, V.; Misra, S.; Oliver, N.S.; Rutter, G.A. COVID-19 and Diabetes: A Complex Bidirectional Relationship. Front. Endocrinol. 202011, 758. [Google Scholar] [CrossRef]
  36. Baughn, L.B.; Sharma, N.; Elhaik, E.; Sekulic, A.; Bryce, A.H.; Fonseca, R. Targeting TMPRSS2 in SARS-CoV-2 Infection. Mayo Clin. Proc. 202095, 1989–1999. [Google Scholar] [CrossRef] [PubMed]
  37. Matsuyama, S.; Nao, N.; Shirato, K.; Kawase, M.; Saito, S.; Takayama, I.; Nagata, N.; Sekizuka, T.; Katoh, H.; Kato, F.; et al. Enhanced isolation of SARS-CoV-2 by TMPRSS2-expressing cells. Proc. Natl. Acad. Sci. USA 2020117, 7001–7003. [Google Scholar] [CrossRef]
  38. Thunders, M.; Delahunt, B. Gene of the month: TMPRSS2 (transmembrane serine protease 2). J. Clin. Pathol. 202073, 773–776. [Google Scholar] [CrossRef]
  39. Shen, L.W.; Mao, H.J.; Wu, Y.L.; Tanaka, Y.; Zhang, W. TMPRSS2: A potential target for treatment of influenza virus and coronavirus infections. Biochimie 2017142, 1–10. [Google Scholar] [CrossRef]
  40. Taneera, J.; El-Huneidi, W.; Hamad, M.; Mohammed, A.K.; Elaraby, E.; Hachim, M.Y. Expression Profile of SARS-CoV-2 Host Receptors in Human Pancreatic Islets Revealed Upregulation of ACE2 in Diabetic Donors. Biology 20209, 215. [Google Scholar] [CrossRef]
  41. Cure, E.; Cure, M.C. COVID-19 may affect the endocrine pancreas by activating Na+/H+ exchanger 2 and increasing lactate levels. J. Endocrinol. Investig. 202043, 1167–1168. [Google Scholar] [CrossRef]
  42. Zippi, M.; Fiorino, S.; Occhigrossi, G.; Hong, W. Hypertransaminasemia in the course of infection with SARS-CoV-2: Incidence and pathogenetic hypothesis. World J. Clin. Cases 20208, 1385–1390. [Google Scholar] [CrossRef]
  43. Tisoncik, J.R.; Korth, M.J.; Simmons, C.P.; Farrar, J.; Martin, T.T.; Katze, M.G. Into the eye of the cytokine storm. Microbiol. Mol. Biol. Rev. 201276, 16–32. [Google Scholar] [CrossRef]
  44. Mehta, P.; McAuley, D.F.; Brown, M.; Sanchez, E.; Tattersall, R.S.; Manson, J.J. COVID-19: Consider cytokine storm syndromes and immunosuppression. Lancet 2020395, 1033–1034. [Google Scholar] [CrossRef]
  45. Zhou, F.; Yu, T.; Du, R.; Fan, G.; Liu, Y.; Liu, Z.; Xiang, J.; Wang, Y.; Song, B.; Gu, X.; et al. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: A retrospective cohort study. Lancet 2020395, 1054–1062. [Google Scholar] [CrossRef]
  46. Hojyo, S.; Uchida, M.; Tanaka, K.; Hasebe, R.; Tanaka, Y.; Murakami, M.; Hirano, T. How COVID-19 induces cytokine storm with high mortality. Inflamm. Regen. 202040, 37. [Google Scholar] [CrossRef]
  47. Liu, B.; Li, M.; Zhou, Z.; Guan, X.; Xiang, Y. Can we use interleukin-6 (IL-6) blockade for coronavirus disease 2019 (COVID-19)-induced cytokine release syndrome (CRS)? J. Autoimmun. 2020111, 102452. [Google Scholar] [CrossRef] [PubMed]
  48. Rao, S.A.; Kunte, A.R. Interleukin-6: An Early Predictive Marker for Severity of Acute Pancreatitis. Indian J. Crit. Care Med. 201721, 424–428. [Google Scholar] [CrossRef] [PubMed]
  49. Sathyanarayan, G.; Garg, P.K.; Prasad, H.; Tandon, R.K. Elevated level of interleukin-6 predicts organ failure and severe disease in patients with acute pancreatitis. J. Gastroenterol. Hepatol. 200722, 550–554. [Google Scholar] [CrossRef]
  50. Cao, Y.; Liu, X.; Xiong, L.; Cai, K. Imaging and clinical features of patients with 2019 novel coronavirus SARS-CoV-2: A systematic review and meta-analysis. J. Med. Virol. 202092, 1449–1459. [Google Scholar] [CrossRef]
  51. Assis, R.R.; de Jain, A.; Nakajima, R.; Jasinskas, A.; Felgner, J.; Obiero, J.M.; Norris, P.J.; Stone, M.; Simmons, G.; Bagri, A.; et al. Analysis of SARS-CoV-2 antibodies in COVID-19 convalescent blood using a coronavirus antigen microarray. Nat. Commun. 202112, 6. [Google Scholar] [CrossRef]
  52. Zhao, J.; Yuan, Q.; Wang, H.; Liu, W.; Liao, X.; Su, Y.; Wang, X.; Yuan, J.; Li, T.; Li, J.; et al. Antibody responses to SARS-CoV-2 in patients of novel coronavirus disease 2019. Clin. Infect. Dis. 202071, 2027–2034. [Google Scholar] [CrossRef]
  53. Iwasaki, A.; Yang, Y. The potential danger of suboptimal antibody responses in COVID-19. Nat. Rev. Immunol. 202020, 339–341. [Google Scholar] [CrossRef]
  54. Lee, N.; Chan, P.K.S.; Ip, M.; Wong, E.; Ho, J.; Ho, C.; Cockram, C.S.; Hui, D.S. Anti-SARS-CoV IgG response in relation to disease severity of severe acute respiratory syndrome. J. Clin. Virol. 200635, 179–184. [Google Scholar] [CrossRef]
  55. Yasui, F.; Kai, C.; Kitabatake, M.; Inoue, S.; Yoneda, M.; Yokochi, S.; Kase, R.; Sekiguchi, S.; Morita, K.; Hishima, T.; et al. Prior Immunization with Severe Acute Respiratory Syndrome (SARS)-Associated Coronavirus (SARS-CoV) Nucleocapsid Protein Causes Severe Pneumonia in Mice Infected with SARS-CoV. J. Immunol. 2008181, 6337–6348. [Google Scholar] [CrossRef]
  56. Caruso, P.; Longo, M.; Esposito, K.; Maiorino, M.I. Type 1 diabetes triggered by COVID19 pandemic: A potential outbreak? Diabetes Res. Clin. Pract. 2020164, 108219. [Google Scholar] [CrossRef]
  57. de-Madaria, E.; Capurso, G. COVID-19 and acute pancreatitis: Examining the causality. Nat. Rev. Gastroenterol. Hepatol. 202118, 3–4. [Google Scholar] [CrossRef] [PubMed]
  58. Group, W.; Apa, I.A.P.; Pancreatitis, A. IAP/APA evidence-based guidelines for the management of acute pancreatitis. Pancreatology 201313, e1–e15. [Google Scholar] [CrossRef]
  59. Goyal, H.; Sachdeva, S.; Perisetti, A.; Mann, R.; Inamdar, S.; Tharian, B. Hyperlipasemia and Potential Pancreatic Injury Patterns in COVID-19: A Marker of Severity or Innocent Bystander? Gastroenterology 2021160, 946–948. [Google Scholar] [CrossRef] [PubMed]
  60. Barlass, U.; Wiliams, B.; Dhana, K.; Adnan, D.; Khan, S.R.; Mahdavinia, M.; Bishehsari, F. Marked elevation of lipase in COVID-19 Disease: A cohort study. Clin. Transl. Gastroenterol. 202011, e00215. [Google Scholar] [CrossRef] [PubMed]
  61. Suchman, K.; Raphael, K.L.; Liu, Y.; Wee, D.; Trindade, A.J. Acute pancreatitis in children hospitalized with COVID-19. Pancreatology 202121, 31–33. [Google Scholar] [CrossRef]
  62. Müller, J.A.; Groß, R.; Conzelmann, C.; Krüger, J.; Merle, U.; Steinhart, J.; Weil, T.; Koepke, L.; Bozzo, C.P.; Read, C.; et al. SARS-CoV-2 infects and replicates in cells of the human endocrine and exocrine pancreas. Nat. Metab. 20213, 149–165. [Google Scholar] [CrossRef] [PubMed]
  63. Correia de Sá, T.; Soares, C.; Rocha, M. Acute pancreatitis and COVID-19: A literature review. World J. Gastrointest. Surg. 202113, 574–584. [Google Scholar] [CrossRef] [PubMed]
  64. Smatti, M.K.; Cyprian, F.S.; Nasrallah, G.K.; Al Thani, A.A.; Almishal, R.O.; Yassine, H.M. Viruses and Autoimmunity: A Review on the Potential Interaction and Molecular Mechanisms. Viruses 201911, 762. [Google Scholar] [CrossRef] [PubMed]
  65. Inamdar, S.; Benias, P.C.; Liu, Y.; Sejpal, D.V.; Satapathy, S.K.; Trindade, A.J.; Northwell COVID-19 Research Consortium. Prevalence, Risk Factors, and Outcomes of Hospitalized Patients with Coronavirus Disease 2019 Presenting as Acute Pancreatitis. Gastroenterology 2020159, 2226–2228.e2. [Google Scholar] [CrossRef] [PubMed]
  66. Hegyi, P.; Szakács, Z.; Sahin-Tóth, M. Lipotoxicity and Cytokine Storm in Severe Acute Pancreatitis and COVID-19. Gastroenterology 2020159, 824–827. [Google Scholar] [CrossRef] [PubMed]
  67. Hu, B.; Huang, S.; Lianghong, Y. Lianghong The cytokine storm and COVID-19. J. Med. Virol. 202193, 250–256. [Google Scholar] [CrossRef] [PubMed]
  68. Gullo, L.; Cavicchi, L.; Tomassetti, P.; Spagnolo, C.; Freyrie, A.; D’addato, M. Effects of Ischemia on the Human Pancreas. Gastroenterology 1996111, 1033–1038. [Google Scholar] [CrossRef]
  69. Lonardo, A.; Grisendi, A.; Bonilauri, S.; Rambaldi, M.; Selmi, I.; Tondelli, E. Ischaemic necrotizing pancreatitis after cardiac surgery. A case report and review of the literature. Ital. J. Gastroenterol. Hepatol. 199931, 872–875. [Google Scholar] [PubMed]
  70. Warzecha, Z.; Dembiński, A.; Ceranowicz, P.; Konturek, P.C.; Stachura, J.; Konturek, S.J.; Niemiec, J. Protective effect of calcitonin gene-related peptide against caerulein-induced pancreatitis in rats. J. Physiol. Pharmacol. 199748, 775–787. [Google Scholar]
  71. Esmon, C.T. Crosstalk between inflammation and thrombosis. Maturitas 200861, 122–131. [Google Scholar] [CrossRef]
  72. Wang, D.; Hu, B.; Hu, C.; Zhu, F.; Liu, X.; Zhang, J.; Wang, B.; Xiang, H.; Cheng, Z.; Xiong, Y.; et al. Clinical Characteristics of 138 Hospitalized Patients with 2019 NovelCoronavirus–Infected Pneumonia in Wuhan, China. JAMA 2020323, 1061–1069. [Google Scholar] [CrossRef] [PubMed]
  73. Lasson, Å.; Ohlsson, K. Consumptive coagulopathy, fibrinolysis and protease-antiprotease interactions during acute human pancreatitis. Thromb. Res. 198641, 167–183. [Google Scholar] [CrossRef]
  74. Du, J.D.; Zheng, X.; Huang, Z.Q.; Cai, S.W.; Tan, J.W.; Li, Z.L.; Yao, Y.M.; Jiao, H.B.; Yin, H.N.; Zhu, Z.M. Effects of intensive insulin therapy combined with low molecular weight heparin anticoagulant therapy on severe pancreatitis. Exp. Ther. Med. 20148, 141–146. [Google Scholar] [CrossRef] [PubMed]
  75. Maduzia, D.; Ceranowicz, P.; Cieszkowski, J.; Gałazka, K.; Kusnierz-Cabala, B.; Warzecha, Z. Pretreatment with Warfarin Attenuates the Development of Ischemia/Reperfusion-Induced Acute Pancreatitis in Rats. Molecules 202025, 2493. [Google Scholar] [CrossRef]
  76. Warzecha, Z.; Sendur, P.; Ceranowicz, P.; Dembinski, M.; Cieszkowski, J.; Kusnierz-Cabala, B.; Tomaszewska, R.; Dembinski, A. Pretreatment with low doses of acenocoumarol inhibits the development of acute ischemia/reperfusion-induced pancreatitis. J. Physiol. Pharmacol. 201566, 731–740. [Google Scholar] [PubMed]
  77. Warzecha, Z.; Sendur, P.; Ceranowicz, P.; Dembiński, M.; Cieszkowski, J.; Kuśnierz-Cabala, B.; Olszanecki, R.; Tomaszewska, R.; Ambroży, T.; Dembiński, A. Protective Effect of Pretreatment with Acenocoumarol in Cerulein-Induced Acute Pancreatitis. Int. J. Mol. Sci. 20167, 1709. [Google Scholar] [CrossRef] [PubMed]
  78. Maduzia, D.; Ceranowicz, P.; Cieszkowski, J.; Chmura, A.; Galazka, K.; Kusnierz-Cabala, B.; Warzecha, Z. Administration of warfarin accelerates the recovery in ischemia/reperfusion-induced acute pancreatitis. J. Physiol. Pharmacol. 202071, 417–427. [Google Scholar] [CrossRef]
  79. Ceranowicz, P.; Dembinski, A.; Warzecha, Z.; Dembinski, M.; Cieszkowski, J.; Rembiasz, K.; Konturek, S.J.; Kusnierz-Cabala, B.; Tomaszewska, R.; Pawlik, W.W. Protective and therapeutic effect of heparin in acute pancreatitis. J. Physiol. Pharmacol. 200859, 103–125. [Google Scholar]
  80. Xin-Sheng, L.; Fu, Q.; Jie-Qin, L.; Qin-Qiao, F.; Ri-Guang, Z.; Yu-Hang, A.; Kai-Cheng, Z.; Yi-Xiong, L. Low Molecular Weight Heparin in the Treatment of Severe Acute Pancreatitis: A Multiple Centre Prospective Clinical Study. Asian J. Surg. 200932, 89–94. [Google Scholar] [CrossRef]
  81. Tozlu, M.; Kayar, Y.; Ince, A.T.; Baysal, B.; Şenturk, H. Low molecular weight heparin treatment of acute moderate and severe pancreatitis: A randomized, controlled, open-label study. Turk. J. Gastroenterol. 201930, 81–87. [Google Scholar] [CrossRef]
  82. Agarwal, R.N.; Aggarwal, H.; Verma, A.; Tripathi, M.K. A case report of a patient on therapeutic warfarin who died of COVID19 infection with a sudden rise in d-dimer. Biomedicines 20219, 1382. [Google Scholar] [CrossRef]
  83. Di Micco, P.; Imbalzano, E.; Russo, V.; Attena, E.; Mandaliti, V.; Orlando, L.; Lombardi, M.; Micco, G.; Di Camporese, G.; Annunziata, S.; et al. Heparin and SARS-CoV-2: Multiple Pathophysiological Links. Viruses 202113, 2486. [Google Scholar] [CrossRef] [PubMed]
  84. Bukowczan, J.; Warzecha, Z.; Ceranowicz, P.; Kusnierz-Cabala, B.; Tomaszewska, R.; Dembinski, A. Therapeutic effect of ghrelin in the course of ischemia/reperfusion-induced acute pancreatitis. Curr. Pharm. Des. 201521, 2284–2290. [Google Scholar] [CrossRef]
  85. Warzecha, Z.; Dembiñski, A.; Ceranowicz, P.; Konturek, S.J.; Tomaszewska, R.; Stachura, J.; Konturek, P.C. IGF-1 stimulates production of interleukin-10 and inhibits development of caerulein-induced pancreatitis. J. Physiol. Pharmacol. 200354, 575–590. [Google Scholar] [PubMed]
  86. Nango, D.; Hirose, Y.; Goto, M.; Echizen, H. Analysis of the Association of Administration of various glucocorticoids with development of acute pancreatitis using US Food and Drug Administration adverse event reporting system (FAERS). J. Pharm. Healthc. Sci. 20195, 5. [Google Scholar] [CrossRef]
  87. Badalov, N.; Baradarian, R.; Iswara, K.; Li, J.; Steinberg, W.; Tenner, S. Drug-Induced Acute Pancreatitis: An Evidence-Based Review. Clin. Gastroenterol. Hepatol. 20075, 648–661. [Google Scholar] [CrossRef]
  88. Cienfuegos, J.A.; Almeida, A.; Aliseda, D. Pancreatic injury and acute pancreatitis in COVID-19 patients. Rev. Esp. Enferm. Dig. 2021113, 389. [Google Scholar] [CrossRef] [PubMed]
  89. Hwang, J.L.; Weiss, R.E. Steroid-induced diabetes: A clinical and molecular approach to understanding and treatment. Diabetes Metab. Res. Rev. 201430, 96–102. [Google Scholar] [CrossRef]
  90. Radhakutty, A.; Burt, M.G. Management of endocrine disease: Critical review of the evidence underlying management of glucocorticoid-induced hyperglycaemia. Eur. J. Endocrinol. 2018179, R207–R218. [Google Scholar] [CrossRef]
  91. Van Raalte, D.H.; Nofrate, V.; Bunck, M.C.; Van Iersel, T.; Schaap, J.E.; Nässander, U.K.; Heine, R.J.; Mari, A.; Dokter, W.H.A.; Diamant, M. Acute and 2-week exposure to prednisolone impair different aspects of β-cell function in healthy men. Eur. J. Endocrinol. 2010162, 729–735. [Google Scholar] [CrossRef] [PubMed]
  92. Klarskov, C.K.; Holm Schultz, H.; Wilbek Fabricius, T.; Persson, F.; Pedersen-Bjergaard, U.; Lommer Kristensen, P. Oral treatment of glucocorticoid-induced diabetes mellitus: A systematic review. Int. J. Clin. Pract. 202074, e13529. [Google Scholar] [CrossRef]
  93. Kaletra 200 mg/50 mg Film-Coated Tablets—Summary of Product Characteristics (SmPC)—(emc). Available online: https://www.medicines.org.uk/emc/product/221/smpc (accessed on 10 January 2022).
  94. Rimesh Pal, S.K.B. COVID-19 and diabetes mellitus: An unholy interaction of two pandemics. Diabetes Metab. Syndr. Clin. Res. Rev. 202014, 513–517. [Google Scholar] [CrossRef]
  95. Khadka, S.; Williams, K.; Solanki, S. Remdesivir-Associated Pancreatitis. Am. J. Ther. 2021. [Google Scholar] [CrossRef]
  96. Ehsan, P.; Haseeb, M.; Khan, Z.; Rehan, A.; Singh, R. Coronavirus Disease 2019 Pneumonia and Acute Pancreatitis in a Young Girl. Cureus 202113, e15374. [Google Scholar] [CrossRef]
  97. Jorgensen, S.C.J.; Kebriaei, R.; Dresser, L.D. Remdesivir: Review of Pharmacology, Pre-Clinical Data, and Emerging Clinical Experience for COVID-19. Pharmacotherapy 202040, 659–671. [Google Scholar] [CrossRef]
  98. Pan, H.; Peto, R.; Henao-Restrepo, A.; Preziosi, M.; Sathiyamoorthy, V.; Abdool Karim, Q.; Alejandria, M.; Hernández García, C.; Kieny, M.; Malekzadeh, R.; et al. Repurposed Antiviral Drugs for COVID19—Interim WHO Solidarity. N. Engl. J. Med. 2021384, 497–511. [Google Scholar] [CrossRef] [PubMed]
  99. Rahmani, H.; Davoudi-Monfared, E.; Nourian, A.; Khalili, H.; Hajizadeh, N.; Jalalabadi, N.Z.; Fazeli, M.R.; Ghazaeian, M.; Yekaninejad, M.S. Interferon β-1b in treatment of severe COVID-19: A randomized clinical trial. Int. Immunopharmacol. 202088, 106903. [Google Scholar] [CrossRef] [PubMed]
  100. Gonzalo-Voltas, A.; Fernández-Pérez-Torres, C.U.; Baena-Díez, J.M. Acute pancreatitis in a patient with COVID-19 infection. Med. Clin. 2020155, 183–184. [Google Scholar] [CrossRef] [PubMed]
  101. Díaz Lobato, S.; Carratalá Perales, J.M.; Alonso Íñigo, J.M. Can we use noninvasive respiratory therapies in COVID-19 pandemic? Med. Clin. 2020155, 183. [Google Scholar] [CrossRef] [PubMed]
  102. Sutera, L.; Dominguez, L.J.; Belvedere, M.; Putignano, E.; Vernuccio, L.; Ferlisi, A.; Fazio, G.; Costanza, G.; Barbagallo, M. Azithromycin in an older woman with diabetic gastroparesis. Am. J. Ther. 200815, 85–88. [Google Scholar] [CrossRef]
  103. Aspinall, S.L.; Good, C.B.; Jiang, R.; McCarren, M.; Dong, D.; Cunningham, F.E. Severe dysglycemia with the fluoroquinolones: A class effect? Clin. Infect. Dis. 200949, 402–408. [Google Scholar] [CrossRef] [PubMed]
  104. Zithromax Powder for Oral Suspension—Summary of Product Characteristics (SmPC)—(emc). Available online: https://www.medicines.org.uk/emc/product/3006/smpc#gref (accessed on 10 January 2022).
  105. Stoian, A.P.; Catrinoiu, D.; Rizzo, M.; Ceriello, A. Hydroxychloroquine, COVID-19 and diabetes. Why it is a different story. Diabetes Metab. Res. Rev. 202137, e3379. [Google Scholar] [CrossRef] [PubMed]
  106. Kuzan, A. Toxicity of advanced glycation end products (Review). Biomed. Rep. 202114, 46. [Google Scholar] [CrossRef] [PubMed]
  107. Kuzan, A.; Chwiłkowska, A.; Maksymowicz, K.; Bronowicka-Szydełko, A.; Stach, K.; Pezowicz, C.; Gamian, A. Advanced glycation end products as a source of artifacts in immunoenzymatic methods. Glycoconj. J. 201835, 95–103. [Google Scholar] [CrossRef]
  108. Liao, Y.-H.; Zheng, J.-Q.; Zheng, C.-M.; Lu, K.-C.; Chao, Y.-C. Novel Molecular Evidence Related to COVID-19 in Patients with Diabetes Mellitus. J. Clin. Med. 20209, 3962. [Google Scholar] [CrossRef]
  109. Sartore, G.; Ragazzi, E.; Faccin, L.; Lapolla, A. A role of glycation and methylation for SARS-CoV-2 infection in diabetes? Med. Hypotheses 2020144, 110247. [Google Scholar] [CrossRef]
  110. Kim, J.H.; Park, K.; Lee, S.B.; Kang, S.; Park, J.S.; Ahn, C.W.; Nam, J.S. Relationship between natural killer cell activity and glucose control in patients with type 2 diabetes and prediabetes. J. Diabetes Investig. 201910, 1223–1228. [Google Scholar] [CrossRef]
  111. Zhang, W.; Li, C.; Xu, Y.; He, B.; Hu, M.; Cao, G.; Li, L.; Wu, S.; Wang, X.; Zhang, C.; et al. Hyperglycemia and Correlated High Levels of Inflammation Have a Positive Relationship with the Severity of Coronavirus Disease 2019. Mediat. Inflamm. 20212021, 8812304. [Google Scholar] [CrossRef]
  112. Chen, J.; Wu, C.; Wang, X.; Yu, J.; Sun, Z. The Impact of COVID-19 on Blood Glucose: A Systematic Review and Meta-Analysis. Front. Endocrinol. 202011, 574541. [Google Scholar] [CrossRef]
  113. Arumugam, T.; Ramachandran, V.; Gomez, S.B.; Schmidt, A.M.; Logsdon, C.D. S100P-Derived RAGE Antagonistic Peptide Reduces Tumor Growth and Metastasis. Clin. Cancer Res. 201218, 4356–4364. [Google Scholar] [CrossRef]
  114. Chiappalupi, S.; Salvadori, L.; Vukasinovic, A.; Donato, R.; Sorci, G.; Riuzzi, F. Targeting RAGE to prevent SARS-CoV-2-mediated multiple organ failure: Hypotheses and perspectives. Life Sci. 2021272, 119251. [Google Scholar] [CrossRef]
  115. van Dam, P.A.; Huizing, M.; Mestach, G.; Dierckxsens, S.; Tjalma, W.; Trinh, X.B.; Papadimitriou, K.; Altintas, S.; Vermorken, J.; Vulsteke, C.; et al. SARS-CoV-2 and cancer: Are they really partners in crime? Cancer Treat. Rev. 202089, 102068. [Google Scholar] [CrossRef] [PubMed]
  116. Zhang, Z.; Li, L.; Li, M.; Wang, X. The SARS-CoV-2 host cell receptor ACE2 correlates positively with immunotherapy response and is a potential protective factor for cancer progression. Comput. Struct. Biotechnol. J. 202018, 2438–2444. [Google Scholar] [CrossRef] [PubMed]
  117. Boone, B.A.; Orlichenko, L.; Schapiro, N.E.; Loughran, P.; Gianfrate, G.C.; Ellis, J.T.; Singhi, A.D.; Kang, R.; Tang, D.; Lotze, M.T.; et al. The Receptor for Advanced Glycation End Products (RAGE) Enhances Autophagy and Neutrophil Extracellular Traps in Pancreatic Cancer. Cancer Gene Therapy 201522, 326–334. [Google Scholar] [CrossRef]
  118. Pergolini, I.; Demir, I.E.; Stöss, C.; Emmanuel, K.; Rosenberg, R.; Friess, H.; Novotny, A. Effects of COVID-19 Pandemic on the Treatment of Pancreatic Cancer: A Perspective from Central Europe. Dig. Surg. 202138, 158–165. [Google Scholar] [CrossRef] [PubMed]
  119. Bacalbasa, N.; Diaconu, C.; Savu, C.; Savu, C.; Stiru, O.; Balescu, I. The impact of COVID-19 infection on the postoperative outcomes in pancreatic cancer patients. In Vivo 202135, 1307–1311. [Google Scholar] [CrossRef]
  120. Nagai, K.; Kitamura, K.; Hirai, Y.; Nutahara, D.; Nakamura, H.; Taira, J.; Matsue, Y.; Abe, M.; Kikuchi, M.; Itoi, T. Successful and Safe Reinstitution of Chemotherapy for Pancreatic Cancer after COVID-19. Intern. Med. 202160, 231–234. [Google Scholar] [CrossRef] [PubMed]
  121. Catanese, S.; Pentheroudakis, G.; Douillard, J.Y.; Lordick, F. ESMO Management and treatment adapted recommendations in the COVID-19 era: Pancreatic Cancer. ESMO Open 20205, e000804. [Google Scholar] [CrossRef]
  122. Jones, C.M.; Radhakrishna, G.; Aitken, K.; Bridgewater, J.; Corrie, P.; Eatock, M.; Goody, R.; Ghaneh, P.; Good, J.; Grose, D.; et al. Considerations for the treatment of pancreatic cancer during the COVID-19 pandemic: The UK consensus position. Br. J. Cancer 2020123, 709–713. [Google Scholar] [CrossRef]
  123. Ugwueze, C.V.; Ezeokpo, B.C.; Nnolim, B.I.; Agim, E.A.; Anikpo, N.C.; Onyekachi, K.E. COVID-19 and Diabetes Mellitus: The Link and Clinical Implications. Dubai Diabetes Endocrinol. J. 202026, 69–77. [Google Scholar] [CrossRef]
  124. Al Mahmeed, W.; Al-Rasadi, K.; Banerjee, Y.; Ceriello, A.; Cosentino, F.; Galia, M.; Goh, S.-Y.; Kempler, P.; Lessan, N.; Papanas, N.; et al. Promoting a Syndemic Approach for Cardiometabolic Disease Management During COVID-19: The CAPISCO International Expert Panel. Front. Cardiovasc. Med. 20218, 787761. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/

Severe aplastic anemia after COVID-19 mRNA vaccination: Causality or coincidence?

Authors: Shotaro Tabata 1Hiroki Hosoi 2Shogo Murata 1Satomi Takeda 1Toshiki Mushino 1Takashi Sonoki 1PMID: 34920343

PMCID: PMC8668346I: 10.1016/j.jaut.2021.102782 J Autoimmun. 2022 Jan; 126: 102782.Published online 2021 Dec 14. doi: 10.1016/j.jaut.2021.102782

Abstract

The development of various autoimmune diseases has been reported after COVID-19 infections or vaccinations. However, no method for assessing the relationships between vaccines and the development of autoimmune diseases has been established. Aplastic anemia (AA) is an immune-mediated bone marrow failure syndrome. We report a case of severe AA that arose after the administration of a COVID-19 vaccine (the Pfizer-BioNTech mRNA vaccine), which was treated with allogeneic hematopoietic stem cell transplantation (HSCT). In this patient, antibodies against the SARS-CoV-2 spike protein were detected both before and after the HSCT. After the patient’s hematopoietic stem cells were replaced through HSCT, his AA improved despite the presence of anti-SARS-CoV-2 antibodies. In this case, antibodies derived from the COVID-19 vaccine may not have been directly involved in the development of AA. This case suggests that the measurement of vaccine antibody titers before and after allogeneic HSCT may provide clues to the pathogenesis of vaccine-related autoimmune diseases. Although causality was not proven in this case, further evaluations are warranted to assess the associations between vaccines and AA.

1. Introduction

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused a global pandemic of coronavirus disease 2019 (COVID-19). The introduction of SARS-CoV-2 vaccines has drastically reduced the transmission rate of the disease. Studies have confirmed the safety and efficacy of the available SARS-CoV-2 vaccines. However, rare cases of adverse immunological reactions to SARS-CoV-2 vaccines have been reported, including cases involving immune-mediated disease [[1][2][3]]. Although evaluating the associations between SARS-CoV-2 vaccines and the development of autoimmune diseases is important, no method for assessing such relationships has been established. Aplastic anemia (AA), a bone marrow failure syndrome, appears to be immune-mediated [4,5]. In addition to T lymphocytes and cytokines, autoantibodies are involved in the development of AA as immunological factors [4]. Here, we report a case of AA that developed after the administration of a SARS-CoV-2 vaccine and discuss the association between AA and vaccination.

2. Case description

A previously healthy 56-year-old male, who was not taking any medication, was referred to a clinic because of bleeding in the oral cavity after dental therapy. Laboratory tests showed that his white blood cell count (1.6 × 109/l) and platelet count (11 × 109/l) were decreased. Four days before his visit to the clinic, he had received a second dose of the Pfizer-BioNTech mRNA vaccine (three weeks after his first dose). He was admitted to our hospital due to progressive pancytopenia (Supplementary Table 1). He had no history of COVID-19 infection. The Elecsys® anti-SARS-CoV-2 immunoassay (Roche, Basel, Switzerland), which is used to detect anti-SARS-CoV-2 nucleocapsid protein antibodies, produced a negative result. Tests for immunoglobulin G against cytomegalovirus and Epstein-Barr virus produced positive results, but were not indicative of virus reactivation. Serological tests for hepatitis B, hepatitis C, and human immunodeficiency virus produced negative results. A bone marrow biopsy revealed a hypocellular marrow (Fig. 1 ). The patient was diagnosed with very severe AA [6]. Human leukocyte antigen (HLA) testing showed DRB1 04:05 04:05, which is not associated with a high frequency of AA. The administration of granulocyte-colony stimulating factor had no effect on his neutropenia. In spite of the administration of cyclosporine and eltrombopag, his pancytopenia progressed.

Fig. 1

Fig. 1

Histological findings of the bone marrow biopsy specimen at diagnosis. Panel A: Hematoxylin and eosin (H.E.) staining (x40) of the bone marrow after the administration of a SARS-CoV-2 vaccine showed a markedly hypocellular marrow. Panel B: H.E. staining (x400) showed the replacement of hematopoietic cells by fat and a few nucleated cells.

He underwent an allogeneic hematopoietic stem cell transplantation (HSCT) from an HLA haploidentical related donor (Fig. 2 ). The donor had no history of COVID-19 infection and had not received a SARS-CoV-2 vaccine. The conditioning regimen consisted of 120 mg/m2 fludarabine, 100 mg/kg cyclophosphamide, 2.5 mg/kg anti-thymocyte globulin, and 2 Gy of total body irradiation. Tacrolimus and short-term methotrexate were used as a prophylaxis against graft-versus-host disease (GVHD). Post-transplant cyclophosphamide was not administered because the patient’s HLA-A, C, and DR were homologous, which would not increase the risk of GVHD. The transplanted cells collected from the donor’s bone marrow were transfused into the patient after the removal of red blood cells and plasma. Twenty-one days after the HSCT, neutrophil engraftment was achieved. Chimerism analysis performed on day 29 after the HSCT revealed complete chimerism in the peripheral blood. The patient developed acute GVHD (skin grade 1), which was ameliorated with a topical corticosteroid alone.

Fig. 2

Fig. 2

Evaluation of neutrophil count, The X-axis indicates the number of days after the 2nd dose of the COVID-19 vaccine was administered. The allogeneic BMT was conducted at 34 days after the 2nd dose of the COVID-19 vaccine was administered. The gray boxes indicate the titers of antibodies against the SARS-CoV-2 spike protein (log scale). BMT, bone marrow transplantation; COVID-19, coronavirus disease 2019; CyA, cyclosporine A; TAC, tacrolimus.

The titers of antibodies against SARS-CoV-2 were measured before and after the HSCT to examine the association between the SARS-CoV-2 vaccine the patient received and the development of AA. The measurement of anti-SARS-CoV-2 spike protein antibody titers was performed by SRL, Inc. (Tokyo, Japan) using the Elecsys® anti-SARS-CoV-2 S immunoassay (Roche, Basel, Switzerland). The titers of antibodies against SARS-CoV-2 before the conditioning regimen and 63 days after the HSCT were 540 and 34.9 U/mL (reference range, <0.8 U/mL), respectively (Fig. 2). These results suggest that the AA was ameliorated by the allogeneic HSCT even though anti-SARS-CoV-2 spike protein antibodies continued to be detected after the HSCT.Go to:

3. Discussion

We report a case in which AA developed after the administration of a SARS-CoV-2 vaccine. No association between new-onset AA and SARS-CoV-2 vaccines has been reported. The patient in this case underwent allogeneic HSCT. In this patient, antibodies against the SARS-CoV-2 spike protein were detected both before and after the HSCT. After the allogeneic HSCT, the patient’s AA was ameliorated despite the presence of antibodies against SARS-CoV-2. Our results did not reveal a direct association between antibodies derived from the SARS-CoV-2 vaccine and the development of AA. Further studies are needed to investigate the impairment of hematopoiesis induced by immune reactions after SARS-CoV-2 vaccine administration.

One of the most feared adverse reactions to vaccines is the development of autoimmune disease. To the best of our knowledge, only six cases of newly diagnosed acquired AA have been reported after vaccination [[7][8][9][10][11]] (Table 1 ). However, in general, AA is not recognized as a vaccine-related adverse event [12]. The mRNA vaccines against SARS-CoV-2 have a novel mechanism of action. Therefore, it is important to collect information about their adverse events. Various cases of autoimmune disease have been reported after SARS-CoV-2 vaccine administration, including autoimmune hepatitis, type 1 diabetes mellitus, immune thrombocytopenia, and acquired hemophilia [3,[13][14][15]]. Patients with AA after COVID-19 infection were also reported [16,17]. Further epidemiological evaluations of the incidence of AA after COVID-19 infection and SARS-CoV-2 vaccination are warranted.

Table 1

Reported cases of newly diagnosed aplastic anemia after vaccinations.

Age (years)SexVaccineTime to symptom onsetTreatmentOutcomeReference
16FRecombinant hepatitis B3 weeks after 3rd doseCorticosteroidImprovedViallard et al. [7]
19FRecombinant hepatitis B10 days after 3rd doseCorticosteroidImprovedAshok Shenoy et al. [8]
25MHepatitis B7 days after 2nd doseAllogeneic HSCTN.A.Shah et al. [9]
19MAnthrax1 monthAllogeneic HSCTN.A.Shah et al. [9]
1.5FVaricella zoster3 weeksNoneImprovedAngelini et al. [10]
25MH1N1 influenza2 weeksAllogeneic HSCTImprovedDonnini et al. [11]
56MSARS-Cov-24 days after 2nd doseAllogeneic HSCTImprovedThis case

Open in a separate window

HSCT, hematopoietic stem cell transplantation; N.A., not applicable; SARS-Cov-2, severe acute respiratory syndrome coronavirus 2.

Various cases of vaccine-related autoimmune disease have been reported. Most of these reports have linked vaccination to the development of autoimmune disease based on clinical observations of temporal associations. There is no established method for examining the relationships between vaccines and the development of autoimmune diseases. The pathogenetic mechanisms by which vaccines cause the development of autoimmune disease are still unclear. The major hypotheses relating to such immunological reactions involve epitope mimicry [18,19]. For example, it has been reported that vaccine-derived antibodies may exhibit structural similarities with autoantibodies [18,19]. There is significant evidence that AA is an immune-mediated condition, mainly based on the effectiveness of immunosuppressive therapy against AA. In addition to T cells and cytokines, autoantibodies are one of the factors that contribute to the pathogenesis of AA [4]. However, autoantibodies specific to AA and the role of autoantibodies for the pathogenesis of AA are unclear. The allogeneic HSCT replaces the recipient’s hematopoietic and associated immune systems with those of the donor. The measurement of vaccine antibody titers before and after allogeneic HSCT may provide a clue to the pathogenesis of vaccine-related autoimmune diseases. The clonal expansion of effector T cells was also reported to occur following vaccination [20]. To understand the link between COVID-19 vaccination and the development of AA, the following needs to be examined: the exploration of autoantibodies against stem cells, the role for molecular mimicry between mRNA vaccine encoded antigens and stem cells, and T-cell subset dynamics after vaccination.

In conclusion, the administered SARS-CoV-2 mRNA vaccine may have contributed to the pathogenesis of AA in this case. However, it is not clear whether antibodies derived from the SARS-CoV-2 vaccine directly contributed to the development of AA because the anti-SARS-CoV-2 antibodies remained after the patient’s pancytopenia had been ameliorated by the allogeneic HSCT. Further evaluations in large cohorts are warranted to elucidate the associations between AA and SARS-CoV-2 vaccines.Go to:

Authors’ contributions

Shotaro Tabata: Data curation, Investigation, Writing – original draft; Hiroki Hosoi: Conceptualization, Data curation, Investigation, Writing – original draft and Review & Editing; Shogo Murata: Investigation, Writing – review & editing; Satomi Takeda: Data curation, Writing – review & editing; Toshiki Mushino: Writing – review & editing; Takashi Sonoki: Writing – review & editing, Supervision.Go to:

Declaration of competing interest

There are no funding sources associated with the writing of this manuscript. Written consent for publication was obtained from the patient.Go to:

Acknowledgements

We thank the patients and clinical staff at Wakayama Medical University Hospital for their participation in this study. We also wish to thank Dr. Takashi Ozaki and Mr. Masaya Morimoto from Kinan Hospital for their helpful diagnostic support.Go to:

Footnotes

Appendix ASupplementary data to this article can be found online at https://doi.org/10.1016/j.jaut.2021.102782.Go to:

Appendix A. Supplementary data

The following is the Supplementary data to this article:Multimedia component 1:Click here to view.(12K, xlsx)Multimedia component 1Go to:

References

1. Arepally G.M., Ortel T.L. Vaccine-induced immune thrombotic thrombocytopenia: what we know and do not know. Blood. 2021;138:293–298. https://doi:10.1182/blood.2021012152 [PMC free article] [PubMed] [Google Scholar]

2. Lee E.J., Cines D.B., Gernsheimer T., Kessler C., Michel M., Tarantino M.D., et al. Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination. Am. J. Hematol. 2021;96:534–537. https://doi:10.1002/ajh.26132 [PMC free article] [PubMed] [Google Scholar]

3. Vuille-Lessard E., Montani M., Bosch J., Semmo N. Autoimmune hepatitis triggered by SARS-CoV-2 vaccination. J. Autoimmun. 2021;123 https://doi:10.1016/j.jaut.2021.102710 [PMC free article] [PubMed] [Google Scholar]

4. Dolberg O.J., Levy Y. Idiopathic aplastic anemia: diagnosis and classification. Autoimmun. Rev. 2014;13:569–573. https://doi:10.1016/j.autrev.2014.01.014 [PubMed] [Google Scholar]

5. Young N.S. Aplastic Anemia. N. Engl. J. Med. 2018;379:1643–1656. https://doi:10.1056/NEJMra1413485 [PMC free article] [PubMed] [Google Scholar]

6. Killick S.B., Bown N., Cavenagh J., Dokal I., Foukaneli T., Hill A., et al. Guidelines for the diagnosis and management of adult aplastic anaemia. Br. J. Haematol. 2016;172:187–207. https://doi:10.1111/bjh.13853 [PubMed] [Google Scholar]

7. Viallard J.F., Boiron J.M., Parrens M., Moreau J.F., Ranchin V., Reiffers J., et al. Severe pancytopenia triggered by recombinant hepatitis B vaccine. Br. J. Haematol. 2000;110:230–233. https://doi:10.1046/j.1365-2141.2000.02171.x [PubMed] [Google Scholar]

8. Ashok Shenoy K., Prabha Adhikari M.R., Chakrapani M., Shenoy D., Pillai A. Pancytopenia after recombinant hepatitis B vaccine–an Indian case report. Br. J. Haematol. 2001;114 https://doi:10.1046/j.1365-2141.2001.03006-2.x [PubMed] [Google Scholar]

9. Shah C., Lemke S., Singh V., Gentile T. Case reports of aplastic anemia after vaccine administration. Am. J. Hematol. 2004;77 https://doi:10.1002/ajh.20153 [PubMed] [Google Scholar]

10. Angelini P., Kavadas F., Sharma N., Richardson S.E., Tipples G., Roifman C., et al. Aplastic anemia following varicella vaccine. Pediatr. Infect. Dis. J. 2009;28:746–748. https://doi:10.1097/INF.0b013e31819b6c1f [PubMed] [Google Scholar]

11. Donnini I., Scappini B., Guidi S., Longo G., Bosi A. Acquired severe aplastic anemia after H1N1 influenza virus vaccination successfully treated with allogeneic bone marrow transplantation. Ann. Hematol. 2012;91:475–476. https://doi:10.1007/s00277-011-1278-0 [PubMed] [Google Scholar]

12. Dudley M.Z., Halsey N.A., Omer S.B., Orenstein W.A., O’Leary S.T., Limaye R.J., et al. The state of vaccine safety science: systematic reviews of the evidence. Lancet Infect. Dis. 2020;20:e80–e89. https://doi:10.1016/S1473-3099(20)30130-4 [PubMed] [Google Scholar]

13. Patrizio A., Ferrari S.M., Antonelli A., Fallahi P. A case of Graves’ disease and type 1 diabetes mellitus following SARS-CoV-2 vaccination. J. Autoimmun. 2021;125 https://doi:10.1016/j.jaut.2021.102738 [PMC free article] [PubMed]  [Google Scholar]

14. Tarawneh O., Tarawneh H. Immune thrombocytopenia in a 22-year-old post Covid-19 vaccine. Am. J. Hematol. 2021;96:E133–E134. https://doi:10.1002/ajh.26106 [PMC free article] [PubMed] [Google Scholar]

15. Radwi M., Farsi S. A case report of acquired hemophilia following COVID-19 vaccine. J. Thromb. Haemostasis. 2021;19:1515–1518. https://doi:10.1111/jth.15291 [PMC free article] [PubMed] [Google Scholar]

16. Avenoso D., Marsh J.C.W., Potter V., Pagliuca A., Slade S., Dignan F., et al. SARS-CoV-2 Infection in Aplastic Anaemia. Haematologica. 2021  https://doi:10.3324/haematol.2021.279928 [PMC free article] [PubMed] [Google Scholar]

17. Chakravarthy R., Murphy M.L., Ann Thompson M., McDaniel H.L., Zarnegar-Lumley S., Borinstein S.C. SARS-CoV-2 infection coincident with newly diagnosed severe aplastic anemia: a report of two cases. Pediatr. Blood Cancer. 2021 https://doi:10.1002/pbc.29433 [PMC free article] [PubMed] [Google Scholar]

18. Wraith D.C., Goldman M., Lambert P.H. Vaccination and autoimmune disease: what is the evidence? Lancet. 2003;362:1659–1666. https://doi:10.1016/S0140-6736(03)14802-7 [PubMed] [Google Scholar]

19. Vadala M., Poddighe D., Laurino C., Palmieri B. Vaccination and autoimmune diseases: is prevention of adverse health effects on the horizon? EPMA J. 2017;8:295–311. https://doi:10.1007/s13167-017-0101-y [PMC free article] [PubMed] [Google Scholar]

20. Ritz C., Meng W., Stanley N.L., Baroja M.L., Xu C., Yan P., et al. Postvaccination graft dysfunction/aplastic anemia relapse with massive clonal expansion of autologous CD8+ lymphocytes. Blood Adv. 2020;4:1378–1382. https://doi:10.1182/bloodadvances. 2019000853 [PMC free article] [PubMed] [Google Scholar]

Bone Marrow Suppression Secondary to the COVID-19 Booster Vaccine: A Case Report

Authors: Toral Shastri 1Navkiran Randhawa 2Ragia Aly 3Masood Ghouse 3

PMID: 35210894 PMCID: PMC8863340DOI: 10.2147/JBM.S350290

Abstract

As of September 2021, SARS-CoV-2 booster shots became widely available in the US to ensure continued protection against the virus. A temporal relationship has been previously reported between the first or second dose of the COVID-19 vaccine and the development of thrombocytopenia. However, adverse events related to the third COVID-19 vaccine are still being reported and studied. We report a 74-year-old male who developed bone marrow suppression and pancytopenia recorded seven days after receiving the Pfizer SARS-CoV-2 vaccine. During his hospital stay, the patient’s hemoglobin, white blood cell, and platelet levels continued to trend downwards. However, all three levels showed improvement one week after discharge without robust intervention. Global vaccination is of utmost importance, as is understanding and documenting post-vaccination reactions including bone marrow suppression. Prompt evaluation and patient education are imperative to improve patient outcomes and combat hesitancy against vaccine administration.

Introduction

Since its emergence in December of 2019, the rapid spread of severe acute respiratory syndrome coronavirus (SARS-CoV-2) has quickly affected millions of lives across every continent.1 This highly transmittable and pathogenic viral infection has led to massive mitigation efforts and allocation of resources to prevent the spread of transmission and high mortality related to complications.2 The establishment of higher levels of community (herd) immunity and protection against SARS-CoV-2 via the widespread deployment of effective vaccines has become a global effort.3 In December of 2020, the FDA issued an Emergency use Authorization for the Pfizer-BioNTech and Moderna COVID-19 Vaccine as a two-dose series.4 In September 2021, booster vaccines became widely administered in the US due to waning immunity of the COVID-19 vaccines against variants of SARS-CoV-2 along with ensuring continued protection against the virus.5

Serious adverse events such as anaphylaxis, Guillain-Barre Syndrome, myocarditis, pericarditis, thrombocytopenia, and death have been previously reported following the first and/or second dose of vaccine.6 To our knowledge, no cases have been reported regarding bone marrow suppression related to the third COVID-19 vaccine. Adverse events reported between August 12-September 19, 2021 from the COVID-19 booster vaccine supported similar reactions to those after dose two.7 According to the Centers for Disease Control and Prevention (CDC), these initial findings indicate no unexpected patterns of adverse reactions after an additional dose of COVID-19 vaccination.7 However, adverse events related to the COVID-19 booster are still being reported and studied.6 This report presents a case of bone marrow suppression occurring after the third COVID-19 vaccine without a similar reaction after the first or second dose.Go to:

Case Report

A 74-year-old male with a history of polychondritis and hypothyroidism presented to the hospital after falling out of his chair and inability to ambulate. The patient was found to be mildly confused upon arrival to the emergency room, limiting our ability to obtain a full verbal history. Chart review revealed the patient had received his third Pfizer Covid vaccine shot seven days before admission followed by fatigue, decreased appetite, fever, and chills. The patient had received the second Pfizer Covid-19 shot nine months before the booster. No reactions to the previous two shots were noted.

Upon initial evaluation, vital signs were within normal limits and a physical exam revealed significant tenderness in the upper arm and no gross bleeding (Figure 1). Computed tomography (CT) imaging (Figure 2) was significant for enhancement of the left axillary lymph node. The patient’s initial complete blood count (CBC) was remarkable for a hemoglobin count of 9.9 g/dl and platelet count of 84 x 109/L; both values lower than his prior hemoglobin count of 13.7 g/dl and platelet count of 180 x 109/L from December of 2020. His mean corpuscular volume (MCV) was elevated at 101.3 femtolitres from his prior MCV value of 95.8 femtolitres in December of 2020. His white blood cell (WBC) count was recorded at 7.6 x 109/L.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0001.jpg

Figure 1

The patient’s upper arm showed erythema with no gross bleeding near the injection site

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0002.jpg

Figure 2

The patient’s CT imaging of the thoracic region showed enhancement of the left axillary lymph node.

The hemoglobin, WBC, and platelet count further down trended from his baseline (Figures 3​5).5). Anemia labs including ferritin levels (554 ng/mL), vitamin B12 (253 pg/mL), total bilirubin (0.5 mg/dL), and reticulocyte count (0.8%) were nonsignificant during the patient’s hospital stay. The patient’s left shoulder presented with extensive bruising, erythema, papular rash, warmth, and tenderness on palpation during the hospitalization. An improvement in WBC and platelet levels was noted on day 4 of hospitalization.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0003.jpg

Figure 3

The patient’s hemoglobin count throughout his hospital course and 6 days after discharge.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0004.jpg

Figure 4

The patient’s WBC count throughout his hospital course and 6 days after discharge.

An external file that holds a picture, illustration, etc.
Object name is JBM-13-69-g0005.jpg

Figure 5

The patient’s platelet count throughout his hospital course and 6 days after discharge.

Before discharge, the patient was fully alert and oriented and reported improvement in his symptoms. Examination of his lateral left arm showed decreased erythema and bruising with slight petechiae. The patient was discharged due to stabilization of labs and encouraged to take oral vitamin B12 supplements. During his outpatient follow-up six days after hospitalization, his hemoglobin increased to 10.5 g/dl, WBC count increased to 4.9 x 109/L, and platelets increased to 101 x 109/L.

Discussion

This paper presents a patient with pancytopenia recorded seven days after receiving the Pfizer booster vaccine. Interestingly, this patient did not report any reactions after the first or second dose of the Pfizer vaccine against SARS-CoV-2. Pancytopenia refers to a decrease in all peripheral bloodlines and is present when all three cell lines are below the normal reference range.8 The patient’s physical exam showed no signs of active bleeding along with his labs indicating no evidence of hemolysis. The patient’s hemoglobin, platelet, and white blood cell count presented below baseline followed by a decrease and slight improvement during his hospital stay. Six days after hospitalization, all three cell lines showed improvement. The temporal association with the booster vaccine and negative infectious disease workup raised suspicion for vaccine-induced bone marrow suppression. In addition, the patient’s reticulocyte count and lactate dehydrogenase value were consistent with hypoproliferation within the bone marrow.

Currently, there is a gap in knowledge of adverse events specific to the third vaccine against SARS-CoV-2 due to the recent initiation of administration and ongoing reporting of events.6 To our knowledge, bone marrow suppression after any dose of vaccine against SARS-CoV-2 has not been previously reported. However, a prior case of pancytopenia after the third vaccination with a recombinant hepatitis B vaccine has previously been reported.9 The patient’s bone marrow biopsy within this case displayed a paucity of late myeloid elements and CD8+ T cells.9 It was believed the patient’s CD8+T cells were causing excessive production of IFN-γ; a stimulant of negative regulators of hematopoiesis such as tumor necrosis factor and lymphotoxin.10 IFN-γ has also previously been reported to create immunological effects comprising an upregulation of histocompatibility gene transcription and alteration in class I and II antigen expression at the cell surface.11 It was predicted these changes resulted in an autoimmune reaction causing suppression of maturation of hematopoietic progenitor cells and pancytopenia.9 Via a similar mechanism, we believe that our patient’s pancytopenia was immune-mediated, potentially triggered by the vaccination.

Vaccines against SARS-CoV-2 (first or second dose) and the induction of Idiopathic Thrombocytopenic Purpura (ITP) have also been recently acknowledged in multiple cases.12 Our patient presented with low platelet levels and associated petechiae and purpura at the site of the vaccination. However, the patient’s presentation of low hemoglobin and white blood cells along with normal reticulocyte levels was more indicative of pancytopenia secondary to bone marrow suppression. In patients presenting with pancytopenia, the history and the physical exam should help assess the severity of the pancytopenia and comorbid illnesses that may complicate the disorder.13 In addition, suspicious medications and exposure to toxic agents should be ruled out.13 Initial screening laboratory evaluation should include the patient’s complete blood count, peripheral blood smear examination, reticulocyte count, complete metabolic panel, prothrombin time/partial thromboplastin time, and blood type and screen. Common interventions to alleviate bone marrow suppression and pancytopenia include treating the underlying cause and utilizing supplements to boost red blood cell production if indicated.

Vaccines against SARS-CoV-2 undergo continuous safety monitoring; adverse events are very rare.14 However, vaccine hesitancy remains a barrier towards full population inoculation against SARS-CoV-2 and is influenced by misinformation regarding vaccine safety.15 One study using an anonymous online questionnaire found a person’s trust in the effectiveness of the vaccine was a major facilitative factor affecting willingness to vaccinate.16 The same study also found that 66.7% of unvaccinated participants thought the vaccine’s safety was not enough, making it the main reason for reluctance or hesitance to be vaccinated.16 Therefore, education of adverse events and available interventions post-vaccination is imperative to prevent the spread of misinformation and combat hesitancy towards vaccination.15

As of September 19, 2021, about 2.2 million people in the United States received a third vaccine against SARS-CoV-2.17 Among those who received the vaccine, 22,000 people reported the effects of the vaccine with no unexpected patterns of adverse reactions.17 Our patient demonstrates abnormal pancytopenia first recorded seven days after receiving the booster vaccine, possibly indicating a rare adverse event from the vaccination given the temporal relationship. While additional studies and observations are indicated to verify bone marrow suppression as an adverse reaction, this case report provides an opportunity for patient education and treatment planning before symptoms arise.

Conclusion

Our case report highlights pancytopenia secondary to bone marrow suppression following Pfizer vaccination against SARS-CoV-2. It is important to consider the possibility of bone marrow suppression following the third vaccine against SARS-CoV-2. Although additional studies are indicated to determine the risk factors and pathogenesis of vaccine-induced bone marrow suppression, prompt evaluation and initiation of interventions can improve patient outcomes

Consent for Publication

Institutional approval was not required to publish the case details. The publication of this study has been consented to by the patient.

Disclosure

The authors report no conflicts of interest in this work.

1. Fernandes A, Chaudhari S, Jamil N, Gopalakrishnan G. COVID-19 vaccine. Endocr Pract. 2021;27(2):170–172. doi:10.1016/j.eprac.2021.01.013 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

2. Johansson MA, Quandelacy TM, Kada S, et al. SARS-CoV-2 transmission from people without COVID-19 symptoms. JAMA Network Open. 2021;4(1):e2035057–e2035057. doi:10.1001/jamanetworkopen.2020.35057 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

3. Graham BS. Rapid COVID-19 vaccine development. Science. 2020;368(6494):945–946. doi:10.1126/science.abb8923 [PubMed] [CrossRef] [Google Scholar]

4. Gee J, Marquez P, Su J, et al. First month of COVID-19 vaccine safety monitoring—United States, December 14, 2020–January 13. Morb Mortal Wkly Rep. 2021;70(8):283. doi:10.15585/mmwr.mm7008e3 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

5. Mahase E. Covid-19 booster vaccines: what we know and who’s doing what. BMJ. 2021. doi: 10.1136/bmj.n2082 [PubMed] [CrossRef] [Google Scholar]

6. Centers for Disease Control and Prevention. Selected adverse events reported after COVID-19 vaccination. Centers for Disease Control and Prevention. Available from: https://www.cdc.gov/coronavirus/2019-ncov/vaccines/safety/adverse-events.html. Accessed November 8, 2021. [Google Scholar]

7. Hause AM. Safety monitoring of an additional dose. Centers for Disease Control and Prevention; 2021. Available from: https://www.cdc.gov/mmwr/volumes/70/wr/mm7039e4.htm. Accessed February 11, 2022. [Google Scholar]

8. Valent P. Low blood counts: immune mediated, idiopathic, or myelodysplasia. Hematology. 2012;2012(1):485–491. doi:10.1182/asheducation.V2012.1.485.3798522 [PubMed] [CrossRef] [Google Scholar]

9. Viallard JF, Boiron JM, Parrens M, et al. Severe pancytopenia triggered by recombinant hepatitis B vaccine. Br J Haematol. 2000;110(1):230–233. doi:

10.1046/j.1365-2141.2000.02171.x [PubMed] [CrossRef] [Google Scholar]10. Collart MA, Belin D, Vassalli JD, De Kossodo S, Vassalli P. Gamma interferon enhances macrophage transcription of the tumor necrosis factor/cachectin, interleukin 1, and urokinase genes, which are controlled by short-lived repressors. J Exp Med. 1986;164(6):2113–2118. doi:10.1084/jem.164.6.2113 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

11. Wallach D, Fellous M, Revel M. Preferential effect of gamma interferon on the synthesis of HLA antigens and their mRNAs in human cells. Nature. 1982;299(5886):833–836. doi:10.1038/299833a0 [PubMed] [CrossRef] [Google Scholar]

12. Shah SRA, Dolkar S, Mathew J, et al. COVID-19 vaccination associated severe immune thrombocytopenia. Exp Hematol Oncol. 2021;10:42. doi:10.1186/s40164-021-00235-0 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

13. Elizabeth P, Weinzierl MD, Daniel A, Arber MD. The differential diagnosis and bone marrow evaluation of new-onset pancytopenia. Am J Clin Pathol. 2013;139(1):9–29. doi:10.1309/AJCP50AEEYGREWUZ [PubMed] [CrossRef] [Google Scholar]

14. Centers for Disease Control and Prevention. COVID-19 vaccination; 2020. Available from: https://www.cdc.gov/coronavirus/2019-ncov/vaccines/safety/safety-of-vaccines.html. Accessed February 11, 2022.

15. Dror AA, Eisenbach N, Taiber S, et al. Vaccine hesitancy: the next challenge in the fight against COVID-19. Eur J Epidemiol. 2020;35:775–779. doi:10.1007/s10654-020-00671-y [PMC free article] [PubMed] [CrossRef] [Google Scholar]

16. Gan L, Chen Y, Hu P, et al. Willingness to receive SARS-CoV-2 vaccination and associated factors among Chinese adults: a cross sectional survey. Int J Environ Res Public Health. 2021;18(4):1993. doi:10.3390/ijerph18041993 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

17. STAT. Early data suggest side effects after Covid booster similar to second dose; 2021. Available from: https://www.statnews.com/2021/09/28/side-effect-rates-from-a-third-covid-19-vaccine-dose-similar-to-those-after-second-shot-early-data-indicate/.

SARS-CoV-2 infection induces long-lived bone marrow plasma cells in humans

Authors: Jackson S. TurnerWooseob KimElizaveta KalaidinaCharles W. GossAdriana M. RauseoAaron J. SchmitzLena HansenAlem HaileMichael K. KlebertIskra PusicJane A. O’HalloranRachel M. Presti & Ali H. Ellebedy 

Nature volume 595, pages421–425 (2021)

Abstract

Long-lived bone marrow plasma cells (BMPCs) are a persistent and essential source of protective antibodies1,2,3,4,5,6,7. Individuals who have recovered from COVID-19 have a substantially lower risk of reinfection with SARS-CoV-28,9,10. Nonetheless, it has been reported that levels of anti-SARS-CoV-2 serum antibodies decrease rapidly in the first few months after infection, raising concerns that long-lived BMPCs may not be generated and humoral immunity against SARS-CoV-2 may be short-lived11,12,13. Here we show that in convalescent individuals who had experienced mild SARS-CoV-2 infections (n = 77), levels of serum anti-SARS-CoV-2 spike protein (S) antibodies declined rapidly in the first 4 months after infection and then more gradually over the following 7 months, remaining detectable at least 11 months after infection. Anti-S antibody titres correlated with the frequency of S-specific plasma cells in bone marrow aspirates from 18 individuals who had recovered from COVID-19 at 7 to 8 months after infection. S-specific BMPCs were not detected in aspirates from 11 healthy individuals with no history of SARS-CoV-2 infection. We show that S-binding BMPCs are quiescent, which suggests that they are part of a stable compartment. Consistently, circulating resting memory B cells directed against SARS-CoV-2 S were detected in the convalescent individuals. Overall, our results indicate that mild infection with SARS-CoV-2 induces robust antigen-specific, long-lived humoral immune memory in humans.

Main

Reinfections by seasonal coronaviruses occur 6 to 12 months after the previous infection, indicating that protective immunity against these viruses may be short-lived14,15. Early reports documenting rapidly declining antibody titres in the first few months after infection in individuals who had recovered from COVID-19 suggested that protective immunity against SARS-CoV-2 might be similarly transient11,12,13. It was also suggested that infection with SARS-CoV-2 could fail to elicit a functional germinal centre response, which would interfere with the generation of long-lived plasma cells3,4,5,7,16. More recent reports analysing samples that were collected approximately 4 to 6 months after infection indicate that SARS-CoV-2 antibody titres decline more slowly than in the initial months after infection8,17,18,19,20,21. Durable serum antibody titres are maintained by long-lived plasma cells—non-replicating, antigen-specific plasma cells that are detected in the bone marrow long after the clearance of the antigen1,2,3,4,5,6,7. We sought to determine whether they were detectable in convalescent individuals approximately 7 months after SARS-CoV-2 infection.

Biphasic decay of anti-S antibody titres

Blood samples were collected approximately 1 month after the onset of symptoms from 77 individuals who were convalescing from COVID-19 (49% female, 51% male, median age 49 years), the majority of whom had experienced mild illness (7.8% hospitalized, Extended Data Tables 12). Follow-up blood samples were collected three times at approximately three-month intervals. Twelve convalescent participants received either the BNT162b2 (Pfizer) or the mRNA-1273 (Moderna) SARS-CoV-2 vaccine between the last two time points; these post-vaccination samples were not included in our analyses. In addition, bone marrow aspirates were collected from 18 of the convalescent individuals at 7 to 8 months after infection and from 11 healthy volunteers with no history of SARS-CoV-2 infection or vaccination. Follow-up bone marrow aspirates were collected from 5 of the 18 convalescent individuals and from 1 additional convalescent donor approximately 11 months after infection (Fig. 1a, Extended Data Tables 34). We first performed a longitudinal analysis of circulating anti-SARS-CoV-2 serum antibodies. Whereas anti-SARS-CoV-2 spike protein (S) IgG antibodies were undetectable in blood from control individuals, 74 out of the 77 convalescent individuals had detectable serum titres approximately 1 month after the onset of symptoms. Between 1 and 4 months after symptom onset, overall anti-S IgG titres decreased from a mean loge-transformed half-maximal dilution of 6.3 to 5.7 (mean difference 0.59 ± 0.06, P < 0.001). However, in the interval between 4 and 11 months after symptom onset, the rate of decline slowed, and mean titres decreased from 5.7 to 5.3 (mean difference 0.44 ± 0.10, P < 0.001; Fig. 1a). In contrast to the anti-S antibody titres, IgG titres against the 2019–2020 inactivated seasonal influenza virus vaccine were detected in all control individuals and individuals who were convalescing from COVID-19, and declined much more gradually, if at all over the course of the study, with mean titres decreasing from 8.0 to 7.9 (mean difference 0.16 ± 0.06, P = 0.042) and 7.9 to 7.8 (mean difference 0.02 ± 0.08, P = 0.997) across the 1-to-4-month and 4-to-11-month intervals after symptom onset, respectively (Fig. 1b).

figure 1
Fig. 1: SARS-CoV-2 infection elicits durable serum anti-S antibody titres.

Induction of S-binding long-lived BMPCs

The relatively rapid early decline in the levels of anti-S IgG, followed by a slower decrease, is consistent with a transition from serum antibodies being secreted by short-lived plasmablasts to secretion by a smaller but more persistent population of long-lived plasma cells generated later in the immune response. The majority of this latter population resides in the bone marrow1,2,3,4,5,6. To investigate whether individuals who had recovered from COVID-19 developed a virus-specific long-lived BMPC compartment, we examined bone marrow aspirates obtained approximately 7 and 11 months after infection for anti-SARS-CoV-2 S-specific BMPCs. We magnetically enriched BMPCs from the aspirates and then quantified the frequencies of those secreting IgG and IgA directed against the 2019–2020 influenza virus vaccine, the tetanus–diphtheria vaccine and SARS-CoV-2 S by enzyme-linked immunosorbent spot assay (ELISpot) (Fig. 2a). Frequencies of influenza- and tetanus–diphtheria-vaccine-specific BMPCs were comparable between control individuals and convalescent individuals. IgG- and IgA-secreting S-specific BMPCs were detected in 15 and 9 of the 19 convalescent individuals, respectively, but not in any of the 11 control individuals (Fig. 2b). Notably, none of the control individuals or convalescent individuals had detectable S-specific antibody-secreting cells in the blood at the time of bone marrow sampling, indicating that the detected BMPCs represent bone-marrow-resident cells and not contamination from circulating plasmablasts. Frequencies of anti-S IgG BMPCs were stable among the 5 convalescent individuals who were sampled a second time approximately 4 months later, and frequencies of anti-S IgA BMPCs were stable in 4 of these 5 individuals but had decreased to below the limit of detection in one individual (Fig. 2c). Consistent with their stable BMPC frequencies, anti-S IgG titres in the 5 convalescent individuals remained consistent between 7 and 11 months after symptom onset. IgG titres measured against the receptor-binding domain (RBD) of the S protein—a primary target of neutralizing antibodies—were detected in 4 of the 5 convalescent individuals and were also stable between 7 and 11 months after symptom onset (Fig. 2d). Frequencies of anti-S IgG BMPCs showed a modest but significant correlation with circulating anti-S IgG titres at 7–8 months after the onset of symptoms in convalescent individuals, consistent with the long-term maintenance of antibody levels by these cells (r = 0.48, P = 0.046). In accordance with previous reports22,23,24, frequencies of influenza-vaccine-specific IgG BMPCs and antibody titres exhibited a strong and significant correlation (r = 0.67, P < 0.001; Fig. 2e). Nine of the aspirates from control individuals and 12 of the 18 aspirates that were collected 7 months after symptom onset from convalescent individuals yielded a sufficient number of BMPCs for additional analysis by flow cytometry. We stained these samples intracellularly with fluorescently labelled S and influenza virus haemagglutinin (HA) probes to identify and characterize antigen-specific BMPCs. As controls, we also intracellularly stained peripheral blood mononuclear cells (PBMCs) from healthy volunteers one week after vaccination against SARS-CoV-2 or seasonal influenza virus (Fig. 3a, Extended Data Fig. 1a–c). Consistent with the ELISpot data, low frequencies of S-binding BMPCs were detected in 10 of the 12 samples from convalescent individuals, but not in any of the 9 control samples (Fig. 3b). Although both recently generated circulating plasmablasts and S- and HA-binding BMPCs expressed BLIMP-1, the BMPCs were differentiated by their lack of expression of Ki-67—indicating a quiescent state—as well as by higher levels of CD38 (Fig. 3c).

figure 2
Fig. 2: SARS-CoV-2 infection elicits S-binding long-lived BMPCs.
figure 3
Fig. 3: SARS-CoV-2 S-binding BMPCs are quiescent and distinct from circulating plasmablasts.

Robust S-binding memory B cell response

Memory B cells form the second arm of humoral immune memory. After re-exposure to an antigen, memory B cells rapidly expand and differentiate into antibody-secreting plasmablasts. We examined the frequency of SARS-CoV-2-specific circulating memory B cells in individuals who were convalescing from COVID-19 and in healthy control individuals. We stained PBMCs with fluorescently labelled S probes and determined the frequency of S-binding memory B cells among isotype-switched IgDloCD20+ memory B cells by flow cytometry. For comparison, we co-stained the cells with fluorescently labelled influenza virus HA probes (Fig. 4a, Extended Data Fig. 1d). S-binding memory B cells were identified in convalescent individuals in the first sample that was collected approximately one month after the onset of symptoms, with comparable frequencies to influenza HA-binding memory B cells (Fig. 4b). S-binding memory B cells were maintained for at least 7 months after symptom onset and were present at significantly higher frequencies relative to healthy controls—comparable to the frequencies of influenza HA-binding memory B cells that were identified in both groups (Fig. 4c).

figure 4
Fig. 4: SARS-CoV-2 infection elicits a robust memory B cell response.

Discussion

This study sought to determine whether infection with SARS-CoV-2 induces antigen-specific long-lived BMPCs in humans. We detected SARS-CoV-2 S-specific BMPCs in bone marrow aspirates from 15 out of 19 convalescent individuals, and in none from the 11 control participants. The frequencies of anti-S IgG BMPCs modestly correlated with serum IgG titres at 7–8 months after infection. Phenotypic analysis by flow cytometry showed that S-binding BMPCs were quiescent, and their frequencies were largely consistent in 5 paired aspirates collected at 7 and 11 months after symptom onset. Notably, we detected no S-binding cells among plasmablasts in blood samples collected at the same time as the bone marrow aspirates by ELISpot or flow cytometry in any of the convalescent or control samples. Together, these data indicate that mild SARS-CoV-2 infection induces a long-lived BMPC response. In addition, we showed that S-binding memory B cells in the blood of individuals who had recovered from COVID-19 were present at similar frequencies to those directed against influenza virus HA. Overall, our results are consistent with SARS-CoV-2 infection eliciting a canonical T-cell-dependent B cell response, in which an early transient burst of extrafollicular plasmablasts generates a wave of serum antibodies that decline relatively quickly. This is followed by more stably maintained levels of serum antibodies that are supported by long-lived BMPCs.

Although this overall trend captures the serum antibody dynamics of the majority of participants, we observed that in three participants, anti-S serum antibody titres increased between 4 and 7 months after the onset of symptoms, after having initially declined between 1 and 4 months. This could be stochastic noise, could represent increased net binding affinity as early plasmablast-derived antibodies are replaced by those from affinity-matured BMPCs, or could represent increases in antibody concentration from re-encounter with the virus (although none of the participants in our cohort tested positive a second time). Although anti-S IgG titres in the convalescent cohort were relatively stable in the interval between 4 and 11 months after symptom onset, they did measurably decrease, in contrast to anti-influenza virus vaccine titres. It is possible that this decline reflects a final waning of early plasmablast-derived antibodies. It is also possible that the lack of decline in influenza titres was due to boosting through exposure to influenza antigens. Our data suggest that SARS-CoV-2 infection induces a germinal centre response in humans because long-lived BMPCs are thought to be predominantly germinal-centre-derived7. This is consistent with a recent study that reported increased levels of somatic hypermutation in memory B cells that target the RBD of SARS-CoV-2 S in convalescent individuals at 6 months compared to 1 month after infection20.

To our knowledge, the current study provides the first direct evidence for the induction of antigen-specific BMPCs after a viral infection in humans. However, we do acknowledge several limitations. Although we detected anti-S IgG antibodies in serum at least 7 months after infection in all 19 of the convalescent donors from whom we obtained bone marrow aspirates, we failed to detect S-specific BMPCs in 4 donors. Serum anti-S antibody titres in those four donors were low, suggesting that S-specific BMPCs may potentially be present at very low frequencies that are below the limit of detection of the assay. Another limitation is that we do not know the fraction of the S-binding BMPCs detected in our study that encodes neutralizing antibodies. SARS-CoV-2 S protein is the main target of neutralizing antibodies17,25,26,27,28,29,30 and a correlation between serum anti-S IgG binding and neutralization titres has been documented17,31. Further studies will be required to determine the epitopes that are targeted by BMPCs and memory B cells, as well as their clonal relatedness. Finally, although our data document a robust induction of long-lived BMPCs after infection with SARS-CoV-2, it is critical to note that our convalescent individuals mostly experienced mild infections. Our data are consistent with a report showing that individuals who recovered rapidly from symptomatic SARS-CoV-2 infection generated a robust humoral immune response32. It is possible that more-severe SARS-CoV-2 infections could lead to a different outcome with respect to long-lived BMPC frequencies, owing to dysregulated humoral immune responses. This, however, has not been the case in survivors of the 2014 Ebola virus outbreak in West Africa, in whom severe viral infection induced long-lasting antigen-specific serum IgG antibodies33.

Long-lived BMPCs provide the host with a persistent source of preformed protective antibodies and are therefore needed to maintain durable immune protection. However, the longevity of serum anti-S IgG antibodies is not the only determinant of how durable immune-mediated protection will be. Isotype-switched memory B cells can rapidly differentiate into antibody-secreting cells after re-exposure to a pathogen, offering a second line of defence34. Encouragingly, the frequency of S-binding circulating memory B cells at 7 months after infection was similar to that of B cells directed against contemporary influenza HA antigens. Overall, our data provide strong evidence that SARS-CoV-2 infection in humans robustly establishes the two arms of humoral immune memory: long-lived BMPCs and memory B cells. These findings provide an immunogenicity benchmark for SARS-CoV-2 vaccines and a foundation for assessing the durability of primary humoral immune responses that are induced in humans after viral infections.

Methods

Data reporting

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded during outcome assessment.

Sample collection, preparation and storage

All studies were approved by the Institutional Review Board of Washington University in St Louis. Written consent was obtained from all participants. Seventy-seven participants who had recovered from SARS-CoV-2 infection and eleven control individuals without a history of SARS-CoV-2 infection were enrolled (Extended Data Tables 14). Blood samples were collected in EDTA tubes and PBMCs were enriched by density gradient centrifugation over Ficoll 1077 (GE) or Lymphopure (BioLegend). The remaining red blood cells were lysed with ammonium chloride lysis buffer, and cells were immediately used or cryopreserved in 10% dimethyl sulfoxide in fetal bovine serum (FBS). Bone marrow aspirates of approximately 30 ml were collected in EDTA tubes from the iliac crest of 18 individuals who had recovered from COVID-19 and the control individuals. Bone marrow mononuclear cells were enriched by density gradient centrifugation over Ficoll 1077, and the remaining red blood cells were lysed with ammonium chloride buffer (Lonza) and washed with phosphate-buffered saline (PBS) supplemented with 2% FBS and 2 mM EDTA. Bone marrow plasma cells were enriched from bone marrow mononuclear cells using the CD138 Positive Selection Kit II (Stemcell) and immediately used for ELISpot or cryopreserved in 10% dimethyl sulfoxide in FBS.

Antigens

Recombinant soluble spike protein (S) and its receptor-binding domain (RBD) derived from SARS-CoV-2 were expressed as previously described35. In brief, mammalian cell codon-optimized nucleotide sequences coding for the soluble version of S (GenBank: MN908947.3, amino acids (aa) 1–1,213) including a C-terminal thrombin cleavage site, T4 foldon trimerization domain and hexahistidine tag cloned into the mammalian expression vector pCAGGS. The S protein sequence was modified to remove the polybasic cleavage site (RRAR to A) and two stabilizing mutations were introduced (K986P and V987P, wild-type numbering). The RBD, along with the signal peptide (aa 1–14) plus a hexahistidine tag were cloned into the mammalian expression vector pCAGGS. Recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transfection with purified DNA using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Supernatants from transfected cells were collected 3 (for S) or 4 (for RBD) days after transfection, and recombinant proteins were purified using Ni-NTA agarose (Thermo Fisher Scientific), then buffer-exchanged into PBS and concentrated using Amicon Ultracel centrifugal filters (EMD Millipore). For flow cytometry staining, recombinant S was labelled with Alexa Fluor 647- or DyLight 488-NHS ester (Thermo Fisher Scientific); excess Alexa Fluor 647 and DyLight 488 were removed using 7-kDa and 40-kDa Zeba desalting columns, respectively (Pierce). Recombinant HA from A/Michigan/45/2015 (aa 18–529, Immune Technology) was labelled with DyLight 405-NHS ester (Thermo Fisher Scientific); excess DyLight 405 was removed using 7-kDa Zeba desalting columns. Recombinant HA from A/Brisbane/02/2018 (aa 18–529) and B/Colorado/06/2017 (aa 18–546) (both Immune Technology) were biotinylated using the EZ-Link Micro NHS-PEG4-Biotinylation Kit (Thermo Fisher Scientific); excess biotin was removed using 7-kDa Zeba desalting columns.

ELISpot

Plates were coated with Flucelvax Quadrivalent 2019/2020 seasonal influenza virus vaccine (Sequiris), tetanus–diphtheria vaccine (Grifols), recombinant S or anti-human Ig. Direct ex vivo ELISpot was performed to determine the number of total, vaccine-binding or recombinant S-binding IgG- and IgA-secreting cells present in BMPC and PBMC samples using IgG/IgA double-colour ELISpot Kits (Cellular Technology) according to the manufacturer’s instructions. ELISpot plates were analysed using an ELISpot counter (Cellular Technology).

ELISA

Assays were performed in 96-well plates (MaxiSorp, Thermo Fisher Scientific) coated with 100 μl of Flucelvax 2019/2020 or recombinant S in PBS, and plates were incubated at 4 °C overnight. Plates were then blocked with 10% FBS and 0.05% Tween-20 in PBS. Serum or plasma were serially diluted in blocking buffer and added to the plates. Plates were incubated for 90 min at room temperature and then washed 3 times with 0.05% Tween-20 in PBS. Goat anti-human IgG–HRP (Jackson ImmunoResearch, 1:2,500) was diluted in blocking buffer before adding to wells and incubating for 60 min at room temperature. Plates were washed 3 times with 0.05% Tween-20 in PBS, and then washed 3 times with PBS before the addition of o-phenylenediamine dihydrochloride peroxidase substrate (Sigma-Aldrich). Reactions were stopped by the addition of 1 M HCl. Optical density measurements were taken at 490 nm. The half-maximal binding dilution for each serum or plasma sample was calculated using nonlinear regression (GraphPad Prism v.8). The limit of detection was defined as 1:30.

Statistics

Spearman’s correlation coefficients were estimated to assess the relationship between 7-month anti-S and anti-influenza virus vaccine IgG titres and the frequencies of BMPCs secreting IgG specific for S and for influenza virus vaccine, respectively. Means and pairwise differences of antibody titres at each time point were estimated using a linear mixed model analysis with a first-order autoregressive covariance structure. Time since symptom onset was treated as a categorical fixed effect for the 4 different sample time points spaced approximately 3 months apart. P values were adjusted for multiple comparisons using Tukey’s method. All analyses were conducted using SAS v.9.4 (SAS Institute) and Prism v.8.4 (GraphPad), and P values of less than 0.05 were considered significant.

Flow cytometry

Staining for flow cytometry analysis was performed using cryo-preserved magnetically enriched BMPCs and cryo-preserved PBMCs. For BMPC staining, cells were stained for 30 min on ice with CD45-A532 (HI30, Thermo Fisher Scientific, 1:50), CD38-BB700 (HIT2, BD Horizon, 1:500), CD19-PE (HIB19, 1:200), CXCR5-PE-Dazzle 594 (J252D4, 1:50), CD71-PE-Cy7 (CY1G4, 1:400), CD20-APC-Fire750 (2H7, 1:400), CD3-APC-Fire810 (SK7, 1:50) and Zombie Aqua (all BioLegend) diluted in Brilliant Stain buffer (BD Horizon). Cells were washed twice with 2% FBS and 2 mM EDTA in PBS (P2), fixed for 1 h using the True Nuclear permeabilization kit (BioLegend), washed twice with perm/wash buffer, stained for 1h with DyLight 405-conjugated recombinant HA from A/Michigan/45/2015, DyLight 488- and Alexa 647-conjugated S, Ki-67-BV711 (Ki-67, 1:200, BioLegend) and BLIMP-1-A700 (646702, 1:50, R&D), washed twice with perm/wash buffer, and resuspended in P2. For memory B cell staining, PBMCs were stained for 30 min on ice with biotinylated recombinant HAs diluted in P2, washed twice, then stained for 30 min on ice with Alexa 647-conjugated S, IgA-FITC (M24A, Millipore, 1:500), IgG-BV480 (goat polyclonal, Jackson ImmunoResearch, 1:100), IgD-SB702 (IA6-2, Thermo Fisher Scientific, 1:50), CD38-BB700 (HIT2, BD Horizon, 1:500), CD20-Pacific Blue (2H7, 1:400), CD4-BV570 (OKT4, 1:50), CD24-BV605 (ML5, 1:100), streptavidin-BV650, CD19-BV750 (HIB19, 1:100), CD71-PE (CY1G4, 1:400), CXCR5-PE-Dazzle 594 (J252D4, 1:50), CD27-PE-Cy7 (O323, 1:200), IgM-APC-Fire750 (MHM-88, 1:100), CD3-APC-Fire810 (SK7, 1:50) and Zombie NIR (all BioLegend) diluted in Brilliant Stain buffer (BD Horizon), and washed twice with P2. Cells were acquired on an Aurora using SpectroFlo v.2.2 (Cytek). Flow cytometry data were analysed using FlowJo v.10 (Treestar). In each experiment, PBMCs were included from convalescent individuals and control individuals.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this paper.

Data availability

Relevant data are available from the corresponding author upon reasonable request.

References

  1. Benner, R., Meima, F., van der Meulen, G. M. & van Muiswinkel, W. B. Antibody formation in mouse bone marrow. I. Evidence for the development of plaque-forming cells in situ. Immunology 26, 247–255 (1974).CAS PubMed PubMed Central Google Scholar 
  2. Manz, R. A., Thiel, A. & Radbruch, A. Lifetime of plasma cells in the bone marrow. Nature 388, 133–134 (1997).ADS CAS Article Google Scholar 
  3. Slifka, M. K., Antia, R., Whitmire, J. K. & Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity 8, 363–372 (1998).CAS Article Google Scholar 
  4. Hammarlund, E. et al. Duration of antiviral immunity after smallpox vaccination. Nat. Med9, 1131–1137 (2003).CAS Article Google Scholar 
  5. Halliley, J. L. et al. Long-lived plasma cells are contained within the CD19CD38hiCD138+ subset in human bone marrow. Immunity 43, 132–145 (2015).CAS Article Google Scholar 
  6. Mei, H. E. et al. A unique population of IgG-expressing plasma cells lacking CD19 is enriched in human bone marrow. Blood 125, 1739–1748 (2015).CAS Article Google Scholar 
  7. Nutt, S. L., Hodgkin, P. D., Tarlinton, D. M. & Corcoran, L. M. The generation of antibody-secreting plasma cells. Nat. Rev. Immunol15, 160–171 (2015).CAS Article Google Scholar 
  8. Hall, V. J. et al. SARS-CoV-2 infection rates of antibody-positive compared with antibody-negative health-care workers in England: a large, multicentre, prospective cohort study (SIREN). Lancet 397, 1459–1469 (2021).CAS Article Google Scholar 
  9. Houlihan, C. F. et al. Pandemic peak SARS-CoV-2 infection and seroconversion rates in London frontline health-care workers. Lancet 396, e6–e7 (2020).CAS Article Google Scholar 
  10. Lumley, S. F. et al. Antibodies to SARS-CoV-2 are associated with protection against reinfection. Preprint at https://doi.org/10.1101/2020.11.18.20234369 (2020).
  11. Long, Q.-X. et al. Clinical and immunological assessment of asymptomatic SARS-CoV-2 infections. Nat. Med26, 1200–1204 (2020).CAS Article Google Scholar 
  12. Ibarrondo, F. J. et al. Rapid decay of anti-SARS-CoV-2 antibodies in persons with mild Covid-19. N. Engl. J. Med383, 1085–1087 (2020).Article Google Scholar 
  13. Seow, J. et al. Longitudinal observation and decline of neutralizing antibody responses in the three months following SARS-CoV-2 infection in humans. Nat. Microbiol5, 1598–1607 (2020).CAS Article Google Scholar 
  14. Edridge, A. W. D. et al. Seasonal coronavirus protective immunity is short-lasting. Nat. Med26, 1691–1693 (2020).Article Google Scholar 
  15. Callow, K. A., Parry, H. F., Sergeant, M. & Tyrrell, D. A. The time course of the immune response to experimental coronavirus infection of man. Epidemiol. Infect105, 435–446 (1990).CAS Article Google Scholar 
  16. Kaneko, N. et al. Loss of Bcl-6-expressing T follicular helper cells and germinal centers in COVID-19. Cell 183, 143–157 (2020).CAS Article Google Scholar 
  17. Wajnberg, A. et al. Robust neutralizing antibodies to SARS-CoV-2 infection persist for months. Science 370, 1227–1230 (2020).ADS CAS Article Google Scholar 
  18. Isho, B. et al. Persistence of serum and saliva antibody responses to SARS-CoV-2 spike antigens in COVID-19 patients. Sci. Immunol5, eabe5511 (2020).Article Google Scholar 
  19. Dan, J. M. et al. Immunological memory to SARS-CoV-2 assessed for up to 8 months after infection. Science 371, eabf4063 (2021).CAS Article Google Scholar 
  20. Gaebler, C. et al. Evolution of antibody immunity to SARS-CoV-2. Nature 591, 639–644 (2021).ADS CAS Article Google Scholar 
  21. Rodda, L. B. et al. Functional SARS-CoV-2-specific immune memory persists after mild COVID-19. Cell 184, 169–183 (2021).CAS Article Google Scholar 
  22. Davis, C. W. et al. Influenza vaccine-induced human bone marrow plasma cells decline within a year after vaccination. Science 370, 237–241 (2020).ADS CAS Article Google Scholar 
  23. Turesson, I. Distribution of immunoglobulin-containing cells in human bone marrow and lymphoid tissues. Acta Med. Scand199, 293–304 (1976).CAS Article Google Scholar 
  24. Pritz, T. et al. Plasma cell numbers decrease in bone marrow of old patients. Eur. J. Immunol45, 738–746 (2015).CAS Article Google Scholar 
  25. Shi, R. et al. A human neutralizing antibody targets the receptor-binding site of SARS-CoV-2. Nature 584, 120–124 (2020).ADS CAS Article Google Scholar 
  26. Cao, Y. et al. Potent neutralizing antibodies against SARS-CoV-2 identified by high-throughput single-cell sequencing of convalescent patients’ B cells. Cell 182, 73–84 (2020).CAS Article Google Scholar 
  27. Robbiani, D. F. et al. Convergent antibody responses to SARS-CoV-2 in convalescent individuals. Nature 584, 437–442 (2020).ADS CAS Article Google Scholar 
  28. Kreer, C. et al. Longitudinal isolation of potent near-germline SARS-CoV-2-neutralizing antibodies from COVID-19 patients. Cell 182, 843–854 (2020).CAS Article Google Scholar 
  29. Alsoussi, W. B. et al. A potently neutralizing antibody protects mice against SARS-CoV-2 infection. J. Immunol205, 915–922 (2020).CAS Article Google Scholar 
  30. Wang, C. et al. A human monoclonal antibody blocking SARS-CoV-2 infection. Nat. Commun11, 2251 (2020).ADS CAS Article Google Scholar 
  31. Wang, K. et al. Longitudinal dynamics of the neutralizing antibody response to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) Infection. Clin. Infect. Dis2020, ciaa1143 (2020).Article Google Scholar 
  32. Chen, Y. et al. Quick COVID-19 healers sustain anti-SARS-CoV-2 antibody production. Cell 183, 1496–1507 (2020).CAS Article Google Scholar 
  33. Davis, C. W. et al. Longitudinal analysis of the human B Cell response to ebola virus infection. Cell 177, 1566–1582 (2019).CAS Article Google Scholar 
  34. Ellebedy, A. H. et al. Defining antigen-specific plasmablast and memory B cell subsets in human blood after viral infection or vaccination. Nat. Immunol17, 1226–1234 (2016).CAS Article Google Scholar 
  35. Stadlbauer, D. et al. SARS-CoV-2 seroconversion in humans: a detailed protocol for a serological assay, antigen production, and test setup. Curr. Protoc. Microbiol57, e100 (2020).CAS Article Google Scholar

ACE2-independent infection of T lymphocytes by SARS-CoV-2

Authors: Xu-Rui ShenRong GengQian LiYing ChenShu-Fen LiQi WangJuan MinYong YangBei LiYong YangBei LiRen-Di JiangXi WangXiao-Shuang ZhengYan ZhuJing-Kun JiaXing-Lou YangMei-Qin LiuQian-Chun GongYu-Lan ZhangZhen-Qiong GuanHui-Ling LiZhen-Hua ZhengZheng-Li ShiHui-Lan ZhangKe Peng & Peng Zhou 

Signal Transduction and Targeted Therapy volume 7, Article number: 83 (2022) 

Abstract

SARS-CoV-2 induced marked lymphopenia in severe patients with COVID-19. However, whether lymphocytes are targets of viral infection is yet to be determined, although SARS-CoV-2 RNA or antigen has been identified in T cells from patients. Here, we confirmed that SARS-CoV-2 viral antigen could be detected in patient peripheral blood cells (PBCs) or postmortem lung T cells, and the infectious virus could also be detected from viral antigen-positive PBCs. We next prove that SARS-CoV-2 infects T lymphocytes, preferably activated CD4 + T cells in vitro. Upon infection, viral RNA, subgenomic RNA, viral protein or viral particle can be detected in the T cells. Furthermore, we show that the infection is spike-ACE2/TMPRSS2-independent through using ACE2 knockdown or receptor blocking experiments. Next, we demonstrate that viral antigen-positive T cells from patient undergone pronounced apoptosis. In vitro infection of T cells induced cell death that is likely in mitochondria ROS-HIF-1a-dependent pathways. Finally, we demonstrated that LFA-1, the protein exclusively expresses in multiple leukocytes, is more likely the entry molecule that mediated SARS-CoV-2 infection in T cells, compared to a list of other known receptors. Collectively, this work confirmed a SARS-CoV-2 infection of T cells, in a spike-ACE2-independent manner, which shed novel insights into the underlying mechanisms of SARS-CoV-2-induced lymphopenia in COVID-19 patients.

Introduction

Since its emergence in December 2019, SARS-CoV-2, the etiology of coronavirus disease 2019 (COVID-19), quickly spread to the majority of countries in the world and posed great threats to public health. The virus shares 79.5% genome identity with SARS-CoV-1 and also uses angiotensin-converting enzyme 2 (ACE2) as a cell entry receptor.1,2,3,4,5 Typical clinical symptoms of COVID-19 patients include fever, fatigue, dry cough, and pneumonia, whereas around 20% of the severe cases may die of multi-organ failure.6,7,8,9

Apart from the respiratory system, multiple organs including the immune system of COVID-19 patients were also targeted by SARS-CoV-2 infection. Notably, lymphopenia was observed in 83.2% of the patients on admission, and fatal infections were associated with more severe lymphopenia over time.6,7,8 Lymphocytes (particularly T cells) play a central role in the human immune system, a decrease of which would result in immune suppression and serious complications.10 It has been proposed that viral-induced lymphopenia might be due to direct infection, cytokine-mediated cell death, tissue sequestration of lymphocytes, or suppression of the bone marrow or thymus for T-cell generation.11 In the case of MERS-CoV, apoptosis induced by direct viral infection of T cells has been observed in vitro, which possibly explained lymphopenia in MERS patients.11 SARS-CoV-1 viral particles were also observed in multiple leukocytes from an autopsy study, suggesting that direct infection might account for the decrease in lymphocytes.12 Similarly, SARS-CoV-2 particles or proteins were also found in the spleen and lymph nodes from a study of 91 deceased COVID-19 cases, suggesting an infection of lymphocytes.13 Furthermore, in COVID-19 immune landscape depicted by single-cell RNA-seq studies, SARS-CoV-2 viral RNA has been found in multiple immune cells, including myeloid cells with phagocytic activity (neutrophil and macrophage) and lymphocytes without phagocytic activity (T, B, and NK cells).14,15 Notably, SARS-CoV-2 RNA-positive immune cells did not co-express the entry factors ACE2 and TMPRSS2, or other hypothesized entry co-factors.14,15 It is speculated that cell-associated SARS-CoV-2 viral positivity may represent a mixture of replicating virus, immune cell engulfment, and virions or virally infected cells attached to the cell surface.14,15

It has been shown that SARS-CoV-2-infected human monocytes, monocyte-derived macrophages, and dendritic cells in vitro, which potentially plays a major role in COVID-19 pathogenesis.16,17 However, whether SARS-CoV-2 infects lymphocytes, which do not express ACE2, to result in lymphopenia is still unknown. This knowledge gap also brings difficulty for our understanding of how lymphocytes lost the ability to control viral infection. Here, we provided evidence that activated T lymphocytes could be infected by SARS-CoV-2 in an ACE2-independent manner. The infection leads to pronounced T-cell apoptosis in vitro or in patients with COVID-19. Our findings shed light on the understanding of SARS-CoV-2 infection-induced lymphopenia.

Results

Presence of SARS-CoV-2 in lymphocytes from patients with COVID-19

Multiple immune cell types, including lymphocytes, have been shown enriched for SARS-CoV-2 viral RNA in multiple single-cell RNA-seq studies.14,15 To determine whether SARS-CoV-2 infects lymphocytes, we analyzed peripheral blood cells (PBCs) collected from COVID-19 patients. PBCs were prepared from 22 patients, who were all at severe condition during the study along with 15 healthy donors. We first analyzed major lymphocyte cell types including T (CD4 + helper T and CD8 + cytotoxic T), B, and natural killer (NK) cells for their population changes or the presence of viral antigen upon infection. For all patients tested, the ratios of blood T lymphocytes declined significantly compared to those in healthy donors, whereas B and NK cells appeared to be unaffected (Fig. 1a). Notably, CD4 + and CD8 + T lymphocytes almost declined to zero in some patients (Fig. 1b). The results suggested that lymphopenia in these patients is likely attributed to a decline of T lymphocytes.

figure 1
Fig. 1

We then analyzed the presence of SARS-CoV-2 viral antigens in PBCs using flow cytometry or by immunofluorescence assay (IFA). The results suggested that T lymphocytes were infected and in certain patient CD4 + T cells showed a high infection rate (Supplementary Fig. S1a). We also confirmed the presence of viral antigen in T lymphocytes from patient blood by immunofluorescence analysis (IFA) (Fig. 1c). Furthermore, we prepared postmortem lung sections from patients with a fatal infection and analyzed T lymphocytes infiltration and virus infection. We found T lymphocytes infiltration in the lung section, and many T lymphocytes were also positive for SARS-CoV-2 NP staining, indicating virus infection (Fig. 1d). A similar finding has also been reported.13 Taken together, we showed the presence of SARS-CoV-2 viral antigen in T lymphocytes either in the blood or in the lung section from the COVID-19 patients.

To further corroborate these findings, virus isolation was attempted from viral NP-positive PBCs. Patient PBCs were collected, determined for viral antigen using flow cytometry, and then co-cultured with Caco2 cells after three washes. Positive detection of viral RNA in the supernatant or viral protein in the Caco2 cells after co-culture indicated successful isolation and amplification of SARS-CoV-2 from PBCs of some COVID-19 patients (3 out of 5) but not from the healthy control (Supplementary Fig. S1b–e). Notably, in the three viral isolation positive samples, two also showed viral positive in the flow cytometry assay (P2 and P4), while the third one (P5) likely carried infectious virus at a level that was under the detection limit of flow cytometric analysis. Above all, we observed SAR-CoV-2 viral RNA and viral protein, and likely infectious virus in T lymphocytes from COVID-19 patients.

SARS-CoV-2 infection of T cells in vitro

Since T lymphocytes population decreased in COVID-19 patients and CD4 + T lymphocytes showed a high viral antigen-positive rate, we then investigated whether SARS-CoV-2 infects CD4 + T lymphocytes. For this purpose, we conducted a serial of experiments to test whether SARS-CoV-2 infects T cells. Upon infection, both viral RNA detection targeting at the receptor-binding domain (RBD) and viral subgenomic mRNA (sgRNA) targeting at M gene were tested. Viral sgRNA is transcribed only in infected cells during viral replication and is not packaged into virions, and therefore indicates the presence of actively infected cells in samples. Viral nucleocapsid protein (NP) and viral particles were also detected using western blot (WB), flow or electron microscopy (EM). Jurkat or MT4 cells, two commonly used CD4 + T cell lines, and primary T cells isolated from healthy donors were infected with SARS-CoV-2 (Fig. 2a). In some experiments, T cells were also activated by Phorbol myristate acetate (PMA) for 2 h for Jurkat cells or by a combination of IL2 + CD3 + CD28 for 3 days for primary T cells before infection, considering a large proportion of T cells is activated in human (Supplementary Fig. S2).

figure 2
Fig. 2

At 0, 24, 48, and 72 h post infection, it was observed that SARS-CoV-2-infected Jurkat T-cell line in a time-dependent manner, and the infection was more robust in activated T cells. Accumulation of viral RNA and sgRNA in cells or viral RNA in the culture supernatant was observed (Fig. 2b). Next, we sought to determine whether the qPCR detection assay represents only partial viral genome replication. We performed RNA-seq analysis of the SARS-CoV-2-infected activated Jurkat T cells at 0 or 24 h p.i. and analyzed the viral reads depth and coverage across the viral genome. Compared to 0 h infected, a much higher depth of viral genomes (as high as 5000 reads depth) can be observed in the 24 h-infected cells, demonstrating an effective replication (Fig. 2c). We then determined viral antigens by WB and flow assay. Our results showed a time-dependent increased level of viral NP in cells or in the supernatant, similar to the findings in viral RNA detection (Fig. 2d, e). We further employed electron microscopy to analyze SARS-CoV-2 infection of T-cell lines. Activated Jurkat or MT4 cells were infected with SARS-CoV-2 for 72 h and viral particles with typical coronavirus morphology were observed in the cytoplasm of the infected cells (Fig. 2f). Finally, to corroborate the findings from T-cell lines, we tested the infectivity of primary T cells isolated from healthy donors. In the three donors, SARS-CoV-2 showed time-dependent infection of T cells that is peaked at 8 h, probably because of extensive cell death induced by the virus at this time point (discussed below). Activation sensitized the cells to SARS-CoV-2 infection in two of the three donors. As comparison, primary colon organoid was also infected, which showed much higher infection efficiency compared to T cells (Fig. 2g, h). Taken together, our data clearly show that SARS-CoV-2 could infect T cells in vitro, although at a lower efficiency compared to tissue cells.

SARS-CoV-2 infection of T cells is ACE2 and TMPRSS2-independent

It is generally believed that ACE2 is the entry receptor for SARS-CoV-2. However, major cell populations in PBCs express extremely low levels of ACE2, raising the question whether ACE2 also mediates SARS-CoV-2 virus entry of T cells. We first tested whether an ACE2 knockdown could dampen SARS-CoV-2 infection of T cells. The data showed ACE2 was successfully knocked down by ACE2-shRNAs in Caco2 cells. Jurkat T cells do not express detectable ACE2 under either mock or knocked down conditions (Fig. 3a). Correspondingly, ACE2 knockdown resulted in dramatically decreased SARS-CoV-2 infection in Caco2 cells but not in Jurkat T cells (Fig. 3b). To further confirm this finding, we did ACE2 knocked out in Caco2 and Jurkat cells (Fig. 3c). Similar to ACE2-knockdown cells, viral load decreased in Caco2-ACE2-KO cells but not in Jurkat-ACE2-KO cells (Fig. 3d). These results suggested that SARS-CoV-2-infected T cells in an ACE2-independent manner.

figure 3
Fig. 3

It was reported that soluble human ACE2 protein could block SARS-CoV-2 infection through competing virus binding with the cellular receptor.3 Thus, ACE2 antibody pre-incubated cells or spike antibody pre-incubated SARS-CoV-2 should also block viral infection, if the infection depends on spike-ACE2 binding. To analyze whether these molecules affect SARS-CoV-2 infection of T cells, we incubated virus with soluble human ACE2 protein or a commercial mAb targeting at RBD-ACE2 binding, or incubated cells with ACE2 blocking antibody before the infection of Caco2 or activated Jurkat T cells. The intracellular viral RNA was analyzed after infection. In Caco2, the three blockers strongly blocked SARS-CoV-2 infection, and ACE2 protein appears to be more potent than the other two treatments. In contrast, none of the three treatments affected the SARS-CoV-2 infection of Jurkat T cells (Fig. 3e).

Lastly, it is known that SARS-CoV-2 uses the serine protease TMPRSS2 for S protein priming before binding to ACE2 receptor, and a TMPRSS2 inhibitor has been approved for clinical use (Camostat) to block SARS-CoV-2 entry.1 The RNA expression of TMPRSS2 in Caco2, Jurkat, and activated Jurkat cells was determined by qPCR. The result suggested that neither unactivated nor activated Jurkat cell-expressed TMPRSS2 (Fig. 3f). We observed that Camostat inhibited SARS-CoV-2 infection of Caco2 cells in a dose-dependent manner. At a dose of 20 μm, Camostat almost completely blocked viral infection of Caco2 cells. In contrast, Camostat showed no inhibitory effect on SARS-CoV-2 infection of Jurkat T cells even at a high dose (Fig. 3g). Collectively, these results suggested that SARS-CoV-2 infection of T cells does not rely on the spike-ACE2/TMPRSS2 interaction.

SARS-CoV-2 infection triggered T-cell death

It is known that severe patients with COVID-19 showed marked decreased lymphocyte populations. To determine whether SARS-CoV-2 infection contributes to T-cell death, we tested PBC T lymphocytes apoptosis collected from patients with COVID-19. T lymphocytes from patients or from healthy donors were dual-labeled with a CD3 antibody and a viral NP antibody, and apoptosis was analyzed with the TUNEL assay. T lymphocytes from COVID-19 patients underwent pronounced apoptosis compared to those from the healthy donors, showing a more than tenfold increase of apoptotic cells. In some patients, most of the apoptotic cells were also viral antigen-positive (e.g., 65% in patient 1), suggesting viral infection played a role in peripheral blood T lymphocytes death in these patients (Fig. 4a).

figure 4
Fig. 4

To confirm the role of viral infection in T-cell death, we experimentally infected primary T cells isolated from healthy donors. With or without activation, cells were experimentally infected with SARS-CoV-2 for 8 h and apoptosis was analyzed with TUNEL assay. It can be observed that SARS-CoV-2 infection induced pronounced apoptosis in infected T cells compared with the mock-treated cells. Activation sensitized T cell to viral infection, as shown by higher apoptotic cells in the activated group (Fig. 4b).

Finally, we determined the cellular responses in T cells upon SARS-CoV-2 infection by bulk RNA-seq analysis. Activated Jurkat T cells were infected with SARS-CoV-2 for 0, 24, 48, and 72 h before they were collected for TUNEL assay. It can be observed that virus induced significant apoptosis at 72 h post infection, compared to mock-infected or cells at other time points (Fig. 4c). We then determined the dynamic cellular responses in cells that have been infected for 24 or 48 h, as the cells in 72 h groups contained too many dead cells and were not suitable for RNA-seq analysis. Compared to the 24 h group, the hypoxia-related GO pathways are significantly upregulated in 48 h group, including “PID HIF1 TF pathway”, “response to hypoxia”, “positive regulation of cell death”, and “intrinsic apoptotic signaling pathway”. It has been shown that SARS-CoV-2 infection triggers mitochondrial ROS production, which induces stabilization of hypoxia-inducible factor-1a (HIF-1a) in monocytes.16 Similarly in T cells, multiple genes involved in this oxidative stress response were upregulated: BNIP3, PFKFB3, FOS, JUN, BHLHE40, GADD45B, PDK1, and DDIT4 (Fig. 4d). To corroborate the findings in T cell lines, we conducted RNA-seq analysis to primary peripheral blood mononuclear cells (PBMCs) collected from three healthy donors and three severe COVID-19 patients. Our data showed an upregulation of cell responses to stimuli, cell death, or response to hypoxia pathways, and a down-regulation of leukocytes activation and signaling pathways, similar to the findings in the T-cell line (Fig. 4e). In summary, SARS-CoV-2 infection induced pronounced T-cell death, which is probably dependent on mitochondria ROS-hypoxia pathways.

Exploration of potential receptors in T cells

Since our results suggested that the infection of SARS-CoV-2 to Jurkat T cell is ACE2-independent, we tried to identify the potential receptors. We first explored the expression of the known SARS-CoV-2 receptors or co-factors that have been identified in primary T cells from public single-cell NGS data14 and in Jurkat T cells in RNA-seq analysis with or without activation, including ACE2/TMPRSS2, AXL, NRP1, KIM-1/TIM-1, ASGR1, and KREMEN1.18,19,20 Moreover, ITGB2 (leukocyte-associated molecule-1, LFA-1), the leukocyte cell Adhesion molecule, has been suggested binding to SARS-CoV-1 ORF7a.21 As SARS-CoV-2 shares similar ORF7a as SARS-CoV-1, it would be interesting to evaluate whether LFA-1 also mediated SARS-CoV-2 infection of T cells.

Our data showed minimal expression of the following molecules in SARS-CoV-2-positive T cells from patients: ACE2, TMPRSS2, ASGR1, KREMEN1, and NRP1 (Fig. 5a and Supplementary Fig. S3a). In contrast, AXL and LFA-1 were expressed in these cells. In Jurkat cells, LFA-1 also showed very high expression, although it was not upregulated following a 2 h activation (Supplementary Fig. S3b). Taken together, AXL and LFA-1 appeared to be promising targets as entry molecules.

figure 5
Fig. 5

AXL was proposed to be a candidate receptor for SARS-CoV-2 in a previous study and the function in mediating SARS-CoV-2 infection is independent of ACE2.19 BEAS-2B that was used as a positive control for AXL-SARS-CoV-2 studies was pretreated with AXL proteins of different concentrations (25, 50, 100 μg/ml) for 30 min and then infected with SARS-CoV-2. The infection of SARS-CoV-2 could be significantly inhibited by AXL protein at a concentration of 25 μg/ml. In contrast, SARS-CoV-2 infection of Jurkat cells could not be inhibited even at 100 μg/ml (Fig. 5b). Next, we constructed AXL-knockdown or overexpression cell lines on Jurkat cells and then tested the effect on viral infection. Our data showed that AXL knockdown could not block SARS-CoV-2 infection, but an AXL overexpression could slightly enhance the infection (1.5-fold) (Fig. 5c). Taken together, AXL should not be a main receptor for SARS-CoV-2 in Jurkat cells but it may contribute to infection.

LFA-1 is widely expressed on the surface of many leukocytes, and T-cell activation changed the structure of LFA-1 to a high-affinity mode, but not expression level.22 We then overexpressed the high-affinity alpha subunit of LFA-1 protein in ACE2 knockdown Caco2 cells (Caco2-ACE2-shRNA) and Jurkat cells. Our qPCR data showed that the LFA-1 overexpression successfully restored the dampened infection in ACE2 knockdown Caco2 cells, and also enhanced viral infection in Jurkat cells (threefold increase), as shown in cellular viral RNA levels (Fig. 5d, e). To corroborate the finding, we also performed IFA to detect viral NP expression. After an 8 h infection, viral NP-positive cells were compared. Our data showed a dampened SARS-CoV-2 infection in ACE2-knockdown cells, and a much higher NP in LFA-1 overexpression ACE2-knowckdown cells (Fig. 5f, g).

Finally, the LFA-1-knockdown Jurkat cell line was constructed and infected by SARS-CoV-2 (MOI = 0.01). At a 24 h post infection, viral load in the knockdown cell line was significantly decreased compared to the control cell line (Fig. 5h). Lifitegrast, an inhibitor that blocked LFA-1 binding to its extracellular ligand, was also used to pretreat activated Jurkat cells before infection. The qPCR results showed that at a concentration of 200 nM, Lifitegrast could also reduce the viral load in Jurkat cells (Fig. 5i). Collectively, our results suggested that LFA-1 should be an attachment factor or potential entry molecular for SARS-CoV-2 during its infection in Jurkat cells.

Discussion

Here, we showed that SARS-CoV-2 infected T lymphocytes, mainly CD4 + T cells, in an ACE2-independent manner. SARS-CoV-2 infection triggered pronounced T-cell death, which potentially contributed to lymphopenia in patients with COVID-19. T-cell infection may also pose profound influences on patients. Infected T lymphocytes not only lost the ability to control viral infection but may also carry viruses to other parts of the body through blood circulation. In addition, this ACE2-independent infection mode may compromise the therapeutic effect of neutralizing antibodies targeting at spike-ACE2 binding. These may synergistically result in more severe infection outcomes in patients with COVID-19.

It has been debated whether SARS-CoV-2 impaired the functionality of immune cell populations through direct infection. Our results provided evidence to show that SARS-CoV-2-infected T cells, as viral RNA, viral sgRNA, viral protein, and the infectious virus could be detected from T cell upon infection or from patient PBCs, although the production of infectious virus particles may stay at a low level. Several recent studies also revealed that multiple immune cells carry viral antigen or viral RNA, including neutrophils, macrophages, inflammatory monocytes, plasma B cells, T cells, and NK cells through postmortem histology analysis and single-cell/single-nuclear RNA-seq to lung or BALF.13,14,15 This suggests that SARS-CoV-2 should have a broad tropism of target cells, including major immune cells populations.

Human ACE2 and TMPRSS2 proteins were recognized as the main proteins that mediated SARS-CoV-2 cell entry.14 The newly discovered binding molecules AXL and NRP1 are still dependent on ACE2 as the main receptor.18,19 Our discovery of ACE2-independent infection of T cells is surprising, but is also supported by previous discoveries that there are SARS-CoV-2 RNA+ cells which did not co-express ACE2 and TMPRSS2.15 In our data, SARS-CoV-2 showed significant infection of activated T cells, suggesting there should be a new entry mechanism in T cells. The identification of LFA-1, as an entry molecule that contributed to a SARS-CoV-2 infection of T cells would be important for developing clinical therapeutics, although future questions remain. For example, what is the LFA-1 binding protein in SARS-CoV-2 virion if it is not the spike protein. Since LFA-1 is expressed in a number of other leukocytes, it can be expected that other immune cells (including macrophages or monocytes) could also be infected by SARS-CoV-2 potentially through binding with LFA-1. These questions should be addressed in future studies.

The infection of CD4 + T lymphocytes by SARS-CoV-2 virus may be a major contributor of virus induced pathogenesis. Armed T cells play a pivotal role against pathogen infection.10 As shown in our data, these T cells are likely to be targets of SARS-CoV-2 infection and undergo apoptosis in the HIF-1a-dependent pathway. These events may lead to T-cell dysfunction, depletion, and eventually lymphopenia in patients. In addition, the dying CD4 + T lymphocytes could trigger excessive inflammation that leads to severe immunopathogenesis in patients. Notably, the population of CD8 + T lymphocytes is also significantly decreased in COVID-19 patients. Unlike CD4 + T lymphocytes, these cells were not determined to contain SARS-CoV-2 viral antigen in flow cytometry. The mechanism underlying SARS-CoV-2 infection-induced CD8 + T lymphocytes depletion is currently unknown. Besides viral infection, several mechanisms, including the presence of endogenous or exogenous glucocorticoids, over-activated neutrophil releasing inhibitors of T cell activation (Arginase 1 and CD274) and cytokine-regulated selective differentiation of bone marrow cells, might also contribute to lymphocytes depletion.11,23 Further in-depth investigation is needed to address the potentially multi-mode mechanisms that lead to lymphopenia in the COVID-19 patients. Considering the apparent correlation between lymphopenia and disease progression in COVID-19 patients, it is important to develop strategies to prevent virus-induced lymphopenia.

Materials and methods

Samples and ethics

Human blood and tissue samples from patients with COVID-19 or from healthy donors were collected by Tongji hospital with consent from all persons. Fresh lung biopsy sections were prepared from a deceased patient. The ethics committee of the designated hospitals for emerging infectious diseases approved all human samplings.

Cell lines and virus culture

Vero E6, Caco2, 293T-sg, GP2-293, and BEAS-2B in DMEM + 10% FBS, or MT4 and Jurkat T cells in RPMI1640 + 10% FBS (Gibco, C22400500BT), or A549 cells in DMEM/F12 + 10% FBS, or primary T cells in X-vivo (Lonza, 04-418Q) medium containing IL-2 (Peprotech, 200-02) were cultured at 37 °C in a humidified atmosphere of 5% CO2. All cell lines were tested free of mycoplasma contamination and applied to species identification and authenticated by microscopic morphologic evaluation. None of cell lines was on the list of commonly misidentified cell lines (by ICLAC). SARS-CoV-2 isolate WIV04 (GISAID accession number EPI_ISL_402124) was used in this study. WIV04 was isolated from Huh7 cells from the original sample and was passaged in Caco2 cells. Viral titer (TCID50/ml) was determined in Vero E6 cells.

Proteins and antibodies for SARS-CoV-2

SARS-CoV-2 strain WIV04 NP and predicted RBD were inserted into pCAGGS vector with an N-terminal S-tag. Constructed plasmids were transiently transfected into HEK293T-17. Supernatant collected for protein purification was purified using S-tag resin, the purity and yield were tested using anti-S-tag mAb (generated in-house). Rabbits were immunized with purified NP proteins three times at a dose of 700 ng/each, 2 weeks interval. Rabbit serum was collected at 10 days after the final immunization. Antibody titer was determined in an ELISA using purified NP protein as a detection antigen.

Peripheral blood cells (PBCs) preparation and SARS-CoV-2 infection

The blood samples from patients with COVID-19 or healthy donors were processed in BSL3 lab at WIV. In all, 1× RBC lysis buffer was made from eBioscience™ 10× RBC Lysis Buffer before the experiment (Multi-species, Invitrogen). Human blood samples were centrifuged at 500 × g for 10 min before being treated with 2 ml 1× RBC lysis buffer for no more than 15 min at room temperature. Cells were spun down at 500 × g for 10 min, followed by treatment using 2 ml 1× RBC lysis buffer for another 10 min at room temperature to remove the residue red blood cells. Cells were ready for use after centrifugation. Cells were spin washed (500 × g for 10 min each time) three times with PBS containing 2% BSA before staining of cell marker antibodies.

For infection, PBCs were seeded into 24-well plates in Roswell Park Memorial Institute 1640 culture medium (RPMI1640, ThermoFisher, 22400500BT) supplemented with 10% fetal bovine serum (FBS, Life Technologies, 10099141) at a density of 1 × 106 cells/ml. PBCs were infected with SARS-CoV-2 at 0.1 MOI. One hour after incubation, cells were spin washed for three times using RPMI1640. PBCs were then seeded with RPMI1640 supplemented with 10% FBS in new 24-well plates at 37 °C supplied with 5% CO2 for 12 h or 24 h before being collected for further analysis.

For IFA on patient PBCs, overnight fixed cells were evenly smeared over a glass coverslip. The presence of viral NP was detected with rabbit pAb against the SARS-CoV-2 NP protein (generated in-house, 1:1000) and a Cy3-conjugated goat anti-rabbit IgG (1:200, Abcam, ab6939). T lymphocytes were detected using a rabbit anti-human CD3 antibody (1:100, Abcam, ab5690). Nuclei were stained with DAPI (Beyotime, C1002). Staining patterns were examined using confocal microscopy on a FV1200 microscope (Olympus).

For immunohistochemistry analysis on patient lung, the biopsy tissues from a deceased patient were fixed with 4% paraformaldehyde for 24 h, paraffin-embedded and cut into 5-μm sections. Multiplex immunofluorescence staining was obtained using PANO 7-plex IHC kit (0004100100, Panovue, Beijing, China). Slides were deparaffinized and rehydrated, followed by 15-min heat-induced antigen retrieval with EDTA pH 9.0. The slides were washed with PBS/0.02% Triton X-100 then blocked with 10% BSA at RT for 30 min, rabbit pAb against the SARS-CoV-2 NP protein (generated in-house, 1:1000) and rabbit anti-human CD3 antibody (1:100, Abcam, ab5690) were then used in incubation at 37 °C 1 h, followed by horseradish peroxidase-conjugated secondary antibody incubation and tyramide signal amplification. The slides were microwave heat-treated after each TSA operation. Nuclei were stained with 4’-6’-diamidino-2-phenylindole (DAPI, Beyotime, C1002) at the final stage of staining. To obtain multispectral images, the stained slides were scanned using the Mantra System (PerkinElmer). The scans were combined to build a single stack image. Unstained images and single-stained sections were used to extract the spectrum of autofluorescence of tissues or each fluorescein, respectively. The extracted images were further used to establish a spectral library required for multispectral immixing by InForm image analysis software (PerkinElmer). Using this spectral library, we obtained reconstructed images of sections with the autofluorescence removed.

PBCs co-cultured with Caco2 cells

PBCs from five patients were washed three times with PBS before co-cultured with Caco2 cells for 4 days and tested for SARS-CoV-2 viral RNA in the supernatant or antigen in Caco2 cells. In the meantime, PBCs were analyzed for the presence of viral antigen by flow cytometry.

Human colon organoids culture and SARS-CoV-2 infection

Human colon organoids were generated and cultured as described in the previous study.24 Briefly, colon organoids in matrigel were digested and washed twice with medium before infection. SARS-CoV-2 was added to infect colon organoids at an MOI of 0.01. 24 h later, colon organoids were then spun down and washed twice with medium. Viral RNA in colon organoids was determined by qPCR.

Activation of Jurkat and primary T cells

To activate Jurkat cells, 2.5E + 06 of cells were seeded to a well of a six-well plate containing 2.5 ml of RPMI1640 medium containing 10% FBS. In total, 40 ng/ml of PMA (Invivogen, tlrl-pma) was added to cells and incubated at 37 °C for 2 h. Cells were centrifuged at 300 × g at room temperature for 10 min before discarding the supernatant and cultured with fresh RPMI1640 medium containing 10% FBS. Primary human CD3 T lymphocytes were isolated from blood of healthy donors using CD3 Microbeads of Human (Miltenyi, 130-050-101). To activate primary T cells, frozen T cells were thawed and cultured with X-vivo (Lonza, 04-418Q) containing 1 μg/ml of IL-2 (Peprotech, 200-02). Cells were cultured with a volume of 7.5 μl of T Cell TransAct (Miltenyi Biotec) in the medium for 3 days at 37 °C. Cells were then spun down and cultured with fresh IL-2/X-vivo medium before viral infection.

T-cells infection

Jurkat T cells or primary human CD3 T lymphocytes were infected with SARS-CoV-2 at a MOI of 0.01, 0.1, or 1 depending on the purpose of the experiment. Supernatant or cells were harvested at 0, 24, 48, or 72 hpi after three times PBS washing for Jurkat T cells, or 0, 4, 8, and 12 hpi for primary T cells. Cellular or supernatant viral RNA or protein expression was determined by qPCR, RNA-seq, WB, or flow cytometry. GAPDH was used in qPCR as internal control and beta-tubulin was used in WB (1:5000, 66240-1-Ig from Proteintech) as an internal control.

Flow cytometry analysis of human peripheral blood samples

For surface staining, PBCs were incubated with fluorochrome-labeled antibodies specific for humans before fixation: AF-700-anti-CD45 (2D1), percp-anti-CD19 (HIB19), APC/CY7-anti-CD3 (UCHT1), BV510-anti-CD4 (OKT4) and percp/Cy5.5-anti-CD8a (HTT8a). Antibody-stained PBCs were fixed overnight with 4% PFA at 4 °C and taken out of BSL3 lab for downstream analysis. Cells were stained further with in-house-made SARS-CoV-1 NP pAb (1:500) at 4 °C for 30 min after permeabilization. Then cells were stained with FITC-anti-Rabbit IgG (H + L) at room temperature for 30 min. AF-700-anti-CD45 (2D1), APC/CY7-anti-CD3 (UCHT1), BV510-anti-CD4, and percp/Cy5.5-anti-CD8a antibodies were purchased from Biolegend and all were used at 1:100. FITC-anti-Rabbit IgG (H + L) was from Proteintech (SA00003-2).

RNA extraction and qPCR

Whenever commercial kits were used, the manufacturer’s instructions were followed without modification. RNA was extracted from 140 μl of samples with the QIAamp® Viral RNA Mini Kit (QIAGEN). RNA was eluted in 50 μl of elution buffer and used as the template. The qPCR detection of SARS-CoV-2 was performed using HiScript® II One-Step qPCR SYBR® Green Kit plus One-Step qPCR Probe kit targeting at either M for sgRNA (designed in house) or RBD of spike gene (commercial) following the instructions of the manufacturer (Q222-CN, Vazyme Biotech Co., Ltd). QPCR was run in a Step-One Plus real-time PCR machine (ABI) machine using default settings.

SARS-CoV-2 genome depth and coverage analysis

RNA was extracted from SARS-CoV-2 24 h-infected activated Jurkat T cells with the RNAprep Pure Cell/Bacteria Kit (TIANGEN, DP430). RNA was eluted in 50 μl of elution buffer and used as the template for RNA-seq. Clean reads were mapping to SARS-CoV-2 genome (WIV04) using software HISAT2 v2.1.0. After sorted and indexed with samtools v1.10-24, the coverage was calculated using genomeCoverageBed function from bedtools v2.29.2.

Transcriptome analysis

The SARS-CoV-2 24 h- and 48 h-infected Jurkat T cells (3 replicates each), blood samples from three healthy donors, and 3 severe COVID-19 patients were subjected for RNA-seq analysis. After mapping clean reads to GRCh38.p13 with HISAT2 v2.1.0 and format conversion with samtools v1.10-24, we used stringtie v2.1.0 to assemble and quantitate transcripts. Reads counts table of transcriptome generated by prepDE.py, a tool in stringtie, was used for gene differential expression analysis in R v4.1.0 with package DESeq2 v1.32.0. The gene with log2 fold change >2 and P value <0.05 was selected to perform enrichment analysis using online tools Metascape.

Public single-cell NGS data analysis

Public single-cell NGS data were downloaded, COVID-19 patients’ data were downloaded from GSE15805514 and healthy donors’ data were from GSE134355 (human cell landscape). According to the original information of each article, we extracted data of primary T cells from lung, thymus, and peripheral blood of healthy donors and virus-positive T cells of COVID-19 patients. Following the standard Seurat v4.0.4 workflow, we normalized the data and scaled it with UMI information. The expression of candidate receptors or co-factors was visualized with Seurat function FeaturePlot.

Western blot (WB) analysis

Infected or transduced cells were harvested at the indicated time point and lysed with RIPA Lysis Buffer (Beyotime, P0013C) for WB. Proteins in cell lysates were then separated on 10–12% SDS-polyacrylamide gel electrophoresis (PAGE) and further transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, SLHVR33RB). Blots were incubated with rabbit polyclonal anti-ACE2 (Servicebio, GB11267, 1:1000 dilution), rabbit polyclonal anti-2019-nCoV NP (1:1000 dilution), mouse monoclonal anti-beta-tubulin (Proteintech, 66240-1-Ig, 1:5000 dilution), and then appropriate rabbit or mouse peroxidase-conjugated secondary antibodies (Proteintech, 1:5000 dilution, SA00001-2, or SA00001-1). Immobilon western chemiluminescent HRP substrate (Millipore, WBKLS0500) was used for protein detection.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay

The TUNEL Assay kit purchased from Beyotime Biotechnology (C1088) was used to detect apoptosis in SARS-CoV-2-infected cells according to the manufacturer’s instructions. Briefly, cells fixed in 4% paraformaldehyde were permeabilized with 0.25% Triton X-100 for 20 min at 4 °C. Then the TdT reaction mixture containing TdT enzyme and fluorescent labeling solution was added to the cells to label the fragmented DNA. Cells were further stained with Rp3-CoV NP pAb (1:8000) or Rabbit anti-SARS-CoV-2 NP pAb (1:500) and CY3-anti-Rabbit IgG (H + L) (Proteintech, SA00009-2) after fixation. Labeled cells were analyzed with a flow cytometer (BD LSRFortessa).

ACE2 competition inhibition and antibody blocking experiments

Human recombinant full-length ACE2-Fc protein (GenScript, Z03484), Anti-ACE2 Ab (R&D, AF933) and RD#4-anti-Spike Ab (house-made monoclonal antibodies) were used. ACE2-Fc protein was diluted to 20 μg/μl in culture medium and then incubated with SARS-CoV-2 virus solution (MOI = 0.01) at a volume of 1:1 at 37 °C for 30 min. The RD#4-anti-Spike Ab was diluted to 320 ng/μl in culture medium and then incubated with SARS-CoV-2 virus solution (MOI = 0.01) at a volume of 1:1 at 37 °C for 30 min. The virus-ACE2 or virus–antibody mixtures were then added to Jurkat cells or Caco2 cells. Cells were collected for further analysis at 24 h post infection. For anti-ACE2 antibody blocking experiments, Jurkat cells or Caco2 cells were pretreated with 3.33 ng/μl anti-ACE2 antibody (R&D Systems, goat, AF933) at 37 °C for 30 min before infection.

Generation of KO, KD, overexpression cell lines

KO, KD, and overexpression plasmids were constructed on different vectors (pLenti-V2 for knockout, pLKO.1 vector for knockdown, and pQCXIH vector for overexpression). Knockout of ACE2 was accomplished by transduction of Caco2 and Jurkat cells with lentiviruses expressing specific sgRNAs targeting ACE2 (F: CACCG GCCTCCATCGATATTAGCAA; R: AAAC TTGCTAATATCGATGGAGGCC).

Knockdown of ACE2, AXL, LFA-1 was accomplished by transduction of Caco2 or Jurkat cells with lentiviruses expressing specific siRNAs (ACE2: 5′-GCCGAAGACCTGTTCTATCAA-3′; AXL: 5′- CCTGTGGTCATCTTACCTT-3′; LFA-1: 5′-GCCATCAATTATGTCGCGACA-3′ or scramble siRNA).

Then the transduced cells were cultured with puromycin (5 μg/ml for Caco2 or 1.5 μg/ml for Jurkat) for 7 days.

For overexpression, the full length of AXL or domain I of LFA-1 alpha subunit were amplified from Hep G2 cells or Jurkat cells respectively. Lentivirus transduced cells were cultured with hygromycin (35 μg/ml for Caco2 and Jurkat cells) for 7 days. For the infection, virus was added to the cells until the end of the experiment with 0.01 MOI. Infected cells were harvested at 24 hpi after twice washing with PBS. Intracellular viral protein expression was determined by western blotting assay with antibody against virus NP protein and viral RNA in the cytoplasm was determined by qPCR.

TMPRSS2 blocking assay

Camostat mesylate (MCE, HY-13512-10 mM) was diluted to a final concentration of 20 μM or 2 μM. In total, 100 μl (for a 48-well plate) or 200 μl (for a 24-well plate) of Camostat solutions were added to cells. One hour later, activated Jurkat and Caco2 cells were infected with SARS-CoV-2 at 0.01 MOI. The cell lysate was harvested at 24 hpi and viral RNA in the cytoplasm was determined by qPCR. Viral NP was analyzed by western blot.

Candidate receptor proteins competition inhibition experiments

Recombinant Human AXL Protein (MedChemExpress, HY-P7622) was diluted to different concentrations with culture medium and then incubated with SARS-CoV-2 virus (MOI = 0.01) at a volume of 1:1 at 37 °C for 30 min. Mixtures were then added to infect activated Jurkat cells and BEAS-2B cells. Samples were harvested at 24 hpi and cellular viral RNA was determined by qPCR.

LFA-1 inhibition experiment

Lifitegrast (MedChemExpress, HY-19344) was diluted to different concentrations and pretreated activated Jurkat cells at 37 °C before infection. Thirty minutes later, cells were infected with SARS-CoV-2 (MOI = 0.01) and samples were harvested at 24 hpi. Viral RNA in the cytoplasm was determined by qPCR.

Electron microscopy

Activated Jurkat and MT4 cells were infected with the SARS-CoV-2 (MOI = 1) for 72 h. Cells were collected and fixed with 2.5% (w/v) glutaraldehyde and 1% osmium tetroxide, dehydrated through a graded series of ethanol concentrations (from 30 to 100%), and embedded with epoxy resin. Ultrathin sections (80 nm) of embedded cells were prepared, deposited onto Formvar-coated copper grids (200 mesh), stained with uranyl acetate and lead citrate, and analyzed using a 200-kV Tecnai G2 electron microscope.

Statistical analysis

Data analyses were performed using GraphPad Prism 7.0 software. Data were shown as mean ± SD. Data were analyzed with Shapiro–Wilk normality test and confirmed to the Gaussian distribution. Statistical analysis was performed using Student’s t test with two-tailed, 95% confidence. P values less than 0.05 were considered statistically significant.

Data availability

Data presented in this study are available on request from the corresponding authors. The data are not publicly available due to limitations in the material transfer agreement.

References

  1. Hoffmann, M. et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell 181, 271–280 e278 (2020).CAS Article Google Scholar 
  2. Li, W. et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 426, 450–454 (2003).CAS Article Google Scholar 
  3. Monteil, V. et al. Inhibition of SARS-CoV-2 infections in engineered human tissues using clinical-grade soluble human ACE2. Cell 181, 905–913 e907 (2020).CAS Article Google Scholar 
  4. Wang, Q. et al. Structural and functional basis of SARS-CoV-2 entry by using human ACE2. Cell 181, 894–904 e899 (2020).CAS Article Google Scholar 
  5. Zhou, P. et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579, 270–273 (2020).
  6. Guan, W. J. et al. Clinical characteristics of coronavirus disease 2019 in China. N. Engl. J. Med. 382, 1708–1720 (2020).CAS Article Google Scholar 
  7. Huang, C. et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 395, 497–506 (2020).CAS Article Google Scholar 
  8. Wang, D. et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in Wuhan, China. JAMA 323, 1061–1069 (2020).CAS Article Google Scholar 
  9. Xu, Z. et al. Pathological findings of COVID-19 associated with acute respiratory distress syndrome. Lancet Respir. Med. 8, 420–422 (2020).CAS Article Google Scholar 
  10. Kumar, B. V., Connors, T. J. & Farber, D. L. Human T cell development, localization, and function throughout life. Immunity 48, 202–213 (2018).CAS Article Google Scholar 
  11. Chu, H. et al. Middle east respiratory syndrome coronavirus efficiently infects human primary T lymphocytes and activates the extrinsic and intrinsic apoptosis pathways. J. Infect. Dis. 213, 904–914 (2016).CAS Article Google Scholar 
  12. Gu, J. et al. Multiple organ infection and the pathogenesis of SARS. J. Exp. Med. 202, 415–424 (2005).CAS Article Google Scholar 
  13. Bian, X. W., COVID-19 Pathology Team. Autopsy of COVID-19 victims in China. Natl Sci. Rev. 7, 1414–1418 (2020).CAS Article Google Scholar 
  14. Ren, X. et al. COVID-19 immune features revealed by a large-scale single-cell transcriptome atlas. Cell 184, 1895–1913 e1819 (2021).CAS Article Google Scholar 
  15. Delorey, T. M. et al. COVID-19 tissue atlases reveal SARS-CoV-2 pathology and cellular targets. Nature 595, 107–113 (2021).CAS Article Google Scholar 
  16. Codo, A. C. et al. Elevated glucose levels favor SARS-CoV-2 infection and monocyte response through a HIF-1alpha/glycolysis-dependent axis. Cell Metab. 32, 498–499 (2020).CAS Article Google Scholar 
  17. Zheng, J. et al. Severe acute respiratory syndrome coronavirus 2-induced immune activation and death of monocyte-derived human macrophages and dendritic cells. J. Infect. Dis. 223, 785–795 (2021).CAS Article Google Scholar 
  18. Cantuti-Castelvetri, L. et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science 370, 856–860 (2020).CAS Article Google Scholar 
  19. Wang, S. et al. AXL is a candidate receptor for SARS-CoV-2 that promotes infection of pulmonary and bronchial epithelial cells. Cell Res. 31, 126–140 (2021).CAS Article Google Scholar 
  20. Gu, Y. et al. Receptome profiling identifies KREMEN1 and ASGR1 as alternative functional receptors of SARS-CoV-2. Cell Res. 32, 24–37 (2022).CAS Article Google Scholar 
  21. Hanel, K. & Willbold, D. SARS-CoV accessory protein 7a directly interacts with human LFA-1. Biol. Chem. 388, 1325–1332 (2007).Article Google Scholar 
  22. Mao, D., Lu, S., Li, N., Zhang, Y. & Long, M. Conformational stability analyses of alpha subunit I domain of LFA-1 and Mac-1. PLoS ONE 6, e24188 (2011).CAS Article Google Scholar 
  23. Darcy, C. J. et al. Neutrophils with myeloid derived suppressor function deplete arginine and constrain T cell function in septic shock patients. Crit. Care. 18, R163 (2014).Article Google Scholar 
  24. Crespo, M. et al. Colonic organoids derived from human induced pluripotent stem cells for modeling colorectal cancer and drug testing. Nat. Med. 23, 878–884 (2017).CAS Article Google Scholar 

The potential for antibody-dependent enhancement of SARS-CoV-2 infection: Translational implications for vaccine development

Authors:  Jiong Wang andMartin S. Zand Published online by Cambridge University Press: 13 April 2020

Journal of Clinical and Translational Science>Volume 5 Issue 1

Abstract

There is an urgent need for vaccines to the 2019 coronavirus (COVID19; SARS-CoV-2). Vaccine development may not be straightforward, due to antibody-dependent enhancement (ADE). Antibodies against viral surface proteins can, in some cases, increase infection severity by ADE. This phenomenon occurs in SARS-CoV-1, MERS, HIV, Zika, and dengue virus infection and vaccination. Lack of high-affinity anti-SARS-CoV-2 IgG in children may explain the decreased severity of infection in these groups. Here, we discuss the evidence for ADE in the context of SARS-CoV-2 infection and how to address this potential translational barrier to vaccine development, convalescent plasma, and targeted monoclonal antibody therapies.

Introduction

The coronavirus disease 2019 (COVID-19) pandemic, caused by the SARS-CoV-2 coronavirus (CoV), is currently an immense global health threat. There are currently no effective treatments available, sparking a global rush to develop vaccines, small molecule inhibitors, plasma therapies, and to test a variety of existing compounds for antiviral activity. Estimates are that 14–20% of infected patients develop severe illness requiring hospitalization [Reference Wu and McGoogan1,Reference Bi2]. Approximately ∼5% of those infected develop acute respiratory distress syndrome (ARDS), with high mortality. SARS-CoV-2 infection appears to occur at similar rates across age groups, although the severity of disease is less for those <20 years of age [Reference Bi2,3]. Interestingly, younger individuals are also known to lack or have a lower incidence of high-affinity anti-CoV IgG. This is relevant as certain antibodies can potentiate, rather than protect against, coronavirus infection through antibody-dependent enhancement (ADE), wherein normal mechanisms of antigen–antibody complex clearance fail and instead provide an alternative route for host cell infection [Reference Tetro4].

These observations have serious implications for the development strategy of vaccines that induce anti-SARS-CoV-2 IgG antibodies. Rapid translational vaccine development should include checks for ADE at multiple stages in vaccine development across translational stages. Here we discuss the data underlying our concerns and suggest strategies for assessing this risk during vaccine development and deployment.

Epidemiology of COVID-19

Initial data regarding the epidemiology of SARS-CoV-2 show that individuals ≤20 years of age accounted for <3% of all confirmed cases [Reference Wu and McGoogan1,3]. Multiple reports have also indicated that individuals ≤20 years old have milder symptoms, a lower hospitalization risk, and lower case fatality rates [Reference Wu and McGoogan1,Reference Bi2]. However, recent work by the Shenzhen Center for Disease Control, following 1286 close contacts of 391 index cases over a 28-day period, demonstrated that SARS-CoV-2 infection rates among close contacts ≤20 years old were equivalent to those found in older cohorts [Reference Bi2]. Importantly, this younger cohort was often asymptomatic (<50% presenting with fever) and had less severe infection even when symptomatic. Similar patterns have been observed for the SARS-CoV-1 [Reference Chan-Yeung and Xu5] coronavirus from 2003, with a low incidence of symptomatic infection and fewer severe cases. The inverse relationship of age and asymptomatic coronavirus infection with less pathogenic human strains (e.g. 229 E, NL63, OC43) has been known for over a decade [Reference van der Zalm6].

An important difference between children and adults is the presence of IgG antibodies directed at common circulating human coronavirus strains. Children lack anti-CoV IgG prior to 6 years of age, but then begin to develop antibodies against the common circulating strains in humans (229 E, NL63, OC43, HKU1). Anti-CoV IgG increases with age, with high titers ∼75% of those >6 years old [Reference Zhou7]. Importantly, the anti-CoV IgG repertoire in children may consist of predominately low-affinity IgG, which will mature to high-affinity anti-CoV IgG only after repeated infections.

Antibody-Dependent Enhancement in CoV Infections

Coronaviruses make use of ADE as an alternative mode of viral fusion with target cells (Fig. 1A) [Reference Wang8,Reference Wan9]. Both SARS virus S (spike) proteins contain a binding domain for the the angiotensin-converting enzyme 2 (ACE2) protein [Reference Yan10]. Antibodies targeting the receptor binding sites can prevent S-protein:ACE2 binding and potentially viral fusion [Reference Tian11]. However, anti-S protein IgG complexed with virus will facilitate virus-IgG uptake via the Fc family of receptors [Reference Wang8,Reference Wan9]. This can lead to subsequent viral fusion and infection in macrophages, B cells, monocytes, increasing sources of viral production, and decreasing viral clearance. Binding of complement to antigen–antibody complexes formed by IgG1 and IgG3 may also facilitate ADE via complement receptors. Normally, a mechanism for viral clearance and antigen presentation, phagocytosis now potentiates viral infection. This mechanism is well known for SARS-CoV-1, respiratory syncytial (RSV), HIV, and dengue virus (DENV) [Reference Wan9].

Fig. 1.Antibody-dependent enhancement (ADE). (A) Mechanism – normal viral fusion occurs with binding of the coronavirus spike protein to its receptor, the angiotensin-converting enzyme 2 protein (ACE2). This induces a conformational change in the S protein, exposing a membrane fusion domain, resulting in viral fusion and mRNA release into the cell. With ADE, antibody binding to the S-protein both facilitates cell binding via the FcRγ and induces a conformational change in the spike protein exposing the fusion domain. A similar process can occur if the IgG binds complement, with the C3b:IgG:virus complex being taken up via the C3b receptor. (B) The ADE-associated spike glycoprotein peptide sequences S579-603 from SARS [12] are also conserved in SARS-CoV-2 strains (bold) and the closely related bat CoV strain (RaTG). There is less sequence homology in MERS and the common human CoV strains (HKU1, OC43, 229 E). Sequence homologies analyzed with the Clustal Omega method using Unipro UGENE v33.0 software.

The protein sequences responsible for ADE have been identified on the S protein (Fig. 1B) [Reference Wang12]. Importantly, sera from SARS-CoV-1 patients contain a mixture of IgG antibodies that both inhibit infection and cause ADE [Reference Jaume13,Reference Ho14]. Similarly, vaccination with recombinant S protein in animal models can elicit both neutralizing and ADE-inducing IgG antibodies [Reference Wang12]. Even the presence of neutralizing antibodies can cause severe disease, including cytokine storm, similar to that seen in DENV [Reference Rothman15].

Preexisting anti-coronavirus IgG antibodies that cross-react with SARS-CoV-2, including those against common and less pathogenic coronavirus strains, may increase the risk of ADE and the severity of COVID-19 disease [Reference Wan9]. This is a well-described phenomenon for DENV, where antibodies against one strain are a risk factor for severe disease during infection with another DENV strain [Reference Dejnirattisai16]. Thus, high-affinity anti-CoV IgG may be most effective not only in neutralizing CoV binding during infection but also increase the risk for ADE. This is not a hypothetical concern. Clinical trials for DENV and RSV vaccines were halted when vaccinated subjects were found to have increased disease severity after viral infection [Reference Halstead17,Reference Kim18].

Anti-CoV IgG Levels and Infection Severity

Paradoxically, these findings suggest that lower levels of anti-SARS-CoV-2 IgG antibodies might, in some cases, explain decreased severity of COVID-19 in subjects ≤20 years of age. Their relative lack of high-affinity, cross-reactive, anti-SARS-CoV antibodies, with the associated absence of ADE, may contribute to lower viral loads as fewer host cells become infected and produce virus. Second, the development of high-affinity, class-switched IgG antibodies can occur during the immune response around days 7–14 and can increase after multiple rounds of antigenic exposure with serial vaccination (e.g. priming and boosting) or recurrent infection. Emergence of such antibodies during a primary infection, or after prior vaccination or infection, may increase the risk of ADE [Reference Wan9]. Importantly, we currently lack data on how the balance of neutralizing versus ADE-inducing IgG to SARS-CoV-2 may differ in children and adults. Finally, ADE has been linked to the development of cytokine storm syndrome, which occurs in the most severe cases of MERS, SARS, and COVID-19 infection [Reference Tetro4,Reference Jaume13]. Thus, absence of high-affinity anti-SARS-CoV-2 IgG could potentially mitigate infection severity and explain the milder disease in children and younger adults.

This hypothesis comes with a number of questions and caveats. It is important to note that a lower severity of disease in children will also be influenced by other immune-related factors, including the relative immaturity of macrophages and monocytes in infants, lower levels of Th1, Th2, and Th17 CD4 memory T cells in adolescents and young adults, and lower memory B cell repertoire diversity in younger individuals [Reference Simon, Hollander and McMichael19]. In addition, we currently lack data on whether IgG antibodies against spike proteins from less pathogenic human strains are prevalent in the 6–20-year-old age group and on the balance of neutralizing versus ADE-inducing IgG before, during, and after SARS-CoV-2 infection. Further work will be needed to assess this hypothesis.

Implications for Vaccine Development

The above data suggest that development of a SARS-CoV-2 vaccine will require careful design and testing to assure efficacy and safety. There are several vaccine types currently being pursued including mRNA, DNA, recombinant protein, virus-like particle, and live-attenuated or killed virus. With the potential exception of live, attenuated virus vaccines, the general goal is to induce adaptive immune response resulting in high-affinity IgG against S or N viral capsid proteins. However, unless care is taken to modify the protein sequences to remove or inactivate regions highly associated with ADE, if this is even possible, we may produce vaccines that enhance, rather than protect against, severe SARS-CoV-2 infection. This could be particularly problematic in children, with their reduced risk of severe infection.

Given these issues, we suggest several translational considerations for vaccine development and clinical trials. It may be useful to group these by translational stage and category (Table 1). First, the immunodominance of various antibody subsets should be assessed carefully. This should include mapping epitope targets on SARS-CoV-2 protein sites, especially those known to induce ADE, with the goal of altering the vaccine antigens to minimize ADE. Next, clinical trials will need to be designed to specifically look for ADE in vaccine recipients who are subsequently infected. These should include pre- and post-vaccination measurement of anti-SARS-CoV-2-reactive IgG and the fraction of such antibodies directed against ADE-associated epitopes. Additional in vitro and in vivo testing of vaccine recipient sera for ability to induce ADE should be performed. Considering the incidence of milder disease in many younger individuals, and the potential for increasing the risk of ADE in vaccinated children subsequently infected with SARS-CoV-2, initial clinical trials should carefully consider whether to include children.

Table 1. Translational considerations for SARS-CoV-2 vaccine development

Importantly, long-term follow-up of vaccinated cohorts will be essential to assess vaccine efficacy and the risk of ADE. We will likely need to track the proportion of protective versus ADE-inducing antibodies generated by each vaccine type. Vaccine-specific variations in ADE could occur for many reasons, including differences in vaccine adjuvant, vaccine protein glycosylation, and prior exposure to other CoV strains. Multiplex methods developed for influenza can be quickly adapted to this use [Reference Wang, Wiltse and Zand20], especially to assess the balance between vaccine-induced protection from infection versus increased risk of severe disease with subsequent infection despite vaccination. Further clinical studies will be needed to assess this risk in both vaccinated and infected individuals. Such data may become even more critical as SARS-CoV-2 virus mutates or becomes seasonal.

Similar issues may emerge with the use of convalescent plasma to treat SARS-CoV-2 infection [Reference Casadevall and Anne Pirofski21], especially with hyperimmune plasma from vaccinated individuals, and with targeted monoclonal antibodies. The hypothesis is that such plasma or antibodies may improve infection morbidity and mortality, if given early enough in the course of COVID-19 illness [Reference Casadevall and Anne Pirofski21]. However, the presence of neutralizing antibodies has also been associated with a worse prognosis in some individuals with SARS-CoV-1 [Reference Ho14]. Similar phenomena could also occur with targeted monoclonal antibody therapies. It may be prudent to assess for ADE-inducing antibodies in convalescent plasma and therapeutic monoclonal antibodies prepared for clinical administration. Given the paucity of data on this issue, further work will be needed to rigorously determine whether this is indeed a significant issue.

The current urgency for COVID-19 therapies has brought together the scientific community to find treatments. In our rush to develop vaccines and antibody-based therapies, we should be mindful of what we have learned about ADE from SARS-CoV-1, HIV, and dengue virus research. A rapid but careful approach to vaccine, convalescent plasma, and targeted monoclonal antibody therapies for COVID-19 treatment seems warranted until we have more data on the risks of ADE.

Acknowledgments

This work was supported by the National Institutes of Health Institute of Allergy, Immunology and Infectious Diseases grant R21 AI138500, and the University of Rochester Clinical and Translational Science Award UL1 TR002001 from the National Center for Advancing Translational Sciences. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. None of the above funders had any role in the decision to publish or preparation of the manuscript.

Disclosures

The authors have no competing interests to declare.


References

1 Wu, Z, McGoogan, JM. Characteristics of and important lessons from the coronavirus disease 2019 (COVID-19) outbreak in China: summary of a report of 72,000 cases from the Chinese Center for Disease Control and Prevention. JAMA 2020. doi: 10.1001/jama.2020.2648.CrossRefGoogle Scholar

2 Bi, Q, et al. Epidemiology and transmission of COVID-19 in Shenzhen China: analysis of 391 cases and 1,286 of their close contacts. medRxiv. 2020; p. 2020.03.03.20028423. doi: 10.1101/2020.03.03.20028423.Google Scholar

3 COVID-19 Response Team C. Severe Outcomes Among Patients with Coronavirus Disease 2019 (COVID-19) – United States. MMWR Morbidity Mortality Weekly Report 2020; 69. doi: 10.15585/mmwr.mm6912e2.CrossRefGoogle Scholar

4Tetro, JA. Is COVID-19 receiving ADE from other coronaviruses? Microbes and Infection 2020. doi: 10.1016/j.micinf.2020.02.006.CrossRefGoogle ScholarPubMed

5Chan-Yeung, M, Xu, RH. SARS: epidemiology. Respirology 2003; 8 Suppl: S9–S14. doi: 10.1046/j.1440-1843.2003.00518.x.CrossRefGoogle ScholarPubMed

6 van der Zalm, MM, et al. Respiratory pathogens in children with and without respiratory symptoms. The Journal of Pediatrics 2009; 154(3): 396–400.e1. doi: 10.1016/j.jpeds.2008.08.036.CrossRefGoogle ScholarPubMed

7 Zhou, W, et al. First infection by all four non-severe acute respiratory syndrome human coronaviruses takes place during childhood. BMC Infectious Diseases 2013; 13(1): 433. doi: 10.1186/1471-2334-13-433.CrossRefGoogle ScholarPubMed

8 Wang, SF, et al. Antibody-dependent SARS coronavirus infection is mediated by antibodies against spike proteins. Biochemical Biophysical Research Communications 2014; 451(2): 208–214. doi: 10.1016/j.bbrc.2014.07.090.CrossRefGoogle ScholarPubMed

9 Wan, Y, et al. Molecular mechanism for antibody-dependent enhancement of coronavirus entry. Journal of Virology 2020; 94(5). doi: 10.1128/JVI.02015-19.Google ScholarPubMed

10 Yan, R, et al. Structural basis for the recognition of the SARS-CoV-2 by full-length human ACE2. Science 2020; doi: 10.1126/science.abb2762.CrossRefGoogle ScholarPubMed

11 Tian, X, et al. Potent binding of 2019 novel coronavirus spike protein by a SARS coronavirus-specific human monoclonal antibody. Emerging Microbes & Infections 2020; 9(1): 382–385. doi: 10.1080/22221751.2020.1729069.CrossRefGoogle ScholarPubMed

12 Wang, Q, et al. Immunodominant SARS coronavirus epitopes in humans elirefd both enhancing and neutralizing effects on infection in non-human primates. ACS Infectious Diseases 2016; 2(5): 361–376. doi: 10.1021/acsinfecdis.6b00006.CrossRefGoogle ScholarPubMed

13 Jaume, M, et al. Anti-severe acute respiratory syndrome coronavirus spike antibodies trigger infection of human immune cells via a pH- and cysteine protease-independent FcgammaR pathway. Journal of Virology 2011; 85(20): 10582–10597. doi: 10.1128/JVI.00671-11.CrossRefGoogle Scholar

14 Ho, MS, et al. Neutralizing antibody response and SARS severity. Emerging Infectious Diseases 2005; 11(11): 1730–1737. doi: 10.3201/eid1111.040659.CrossRefGoogle ScholarPubMed

15 Rothman, AL. Immunity to dengue virus: a tale of original antigenic sin and tropical cytokine storms. Nature Reviews Immunology 2011; 11(8): 532–543. doi: 10.1038/nri3014.CrossRefGoogle ScholarPubMed

16 Dejnirattisai, W, et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science 2010; 328(5979): 745–748. doi: 10.1126/science.1185181.CrossRefGoogle ScholarPubMed

17 Halstead, SB. Dengvaxia sensitizes seronegatives to vaccine enhanced disease regardless of age. Vaccine 2017; 35(47): 6355–6358. doi: 10.1016/j.vaccine.2017.09.089.CrossRefGoogle ScholarPubMed

18 Kim, HW, et al. Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. American Journal of Epidemiology 1969; 89(4): 422–434. doi: 10.1093/oxfordjournals.aje.a120955.CrossRefGoogle ScholarPubMed

19 Simon, AK, Hollander, GA, McMichael, A. Evolution of the immune system in humans from infancy to old age. Proceedings of the Royal Society B: Biological Sciences 2015; 282(1821): 20143085. doi: 10.1098/rspb.2014.3085.CrossRefGoogle ScholarPubMed

20 Wang, J, Wiltse, A, Zand, MS. A complex dance: measuring the multidimensional worlds of influenza virus evolution and anti-influenza immune responses. Pathogens 2019; 8(4). doi: 10.3390/pathogens8040238.CrossRefGoogle ScholarPubMed

21 Casadevall, A, Anne Pirofski, L. The convalescent sera option for containing COVID-19. The Journal of Clinical Investigation 2020; 130(4). doi: 10.1172/JCI138003.CrossRefGoogle ScholarPubMed